[ad_1]
Animals
Zebrafish husbandry and experiments were conducted according to UCL Fish Facility standard protocols and under project licenses PA8D4D0E5 and PP6325955 awarded to J.R., according to the UK Animal Scientific Procedures Act (1986). Embryos were kept in Petri dishes in fish water (5 mM NaCl, 0.17 mM KCl, 0.33 mM CaCl2, 0.33 mM MgSO4 and 0.1% methylene blue) in a 14 h–10 h light–dark cycle incubator at 28 °C. Petri dishes exposed only to fish water were cleaned with 75% ethanol, washed, soaked overnight in distilled water, air-dried and rinsed with fish water before reuse. The sex of AB/TL zebrafish larvae is not biologically determined at the early developmental stages used for these studies.
Cloning and transgenesis
Transgene constructs that simultaneously encode FingR targeting PSD95 and membrane markers of neuronal morphology were generated using the In-Fusion HD Cloning System (Clontech). First, the GFP in a pCS2-P2A-GFP-CAAX was replaced with mKate2f by combining the linearized pCS2 (through inverse PCR; primers: 5′-GGATCTAGGACCGGGGTTTTC-3′ and 5′-GTGCTCTCCTGACCTCTAGAA-3′) with amplified mKate2f from dUAS-mKate2f (gift from the Tada laboratory, UCL) with 15 bp overhangs complementary to pCS2 site of insertion (primers: 5′-CCCGGTCCTAGATCCATGGTGAGCGAGCTGATTAAG-3′ and 5′- AGGTCAGGAGAGCACTCAGGAGAGCACACAGCAGCT-3′). Next, the template plasmid pTol2-zcUAS:PSD95.FingR-EGFP-CCR5TC-KRAB(A) (from the Bonkowsky laboratory, University of Utah; Addgene, 72638) was linearized by inverse PCR after the KRAB(A) sequence (primers: 5′-AGCCATAGAAGCAAGATTAGA-3′ and 5′– GGAGGTGTGGGAGGTTTTTTC–3′). The P2A-mKate2f sequences were then amplified with 15 bp overhangs complementary to the pTol2-zcUAS:PSD95.FingR-EGFP-CCR5TC-KRAB(A) insertion site (primers: 5′-CTTGCTTCTATGGCTGCCACGAACTTCTCTCTGTTA-3′ and 5′- ACCTCCCACACCTCCTCAGGAGAGCACACAGCAGCT-3′) and combined with the linearized FingR template.
To generate the stable Tg(UAS:FingR(PSD95)-GFP-CCR5TC-KRAB(A)-P2A-mKate2f) line, purified pTol2-zcUAS:PSD95.FingR-EGFP-CCR5TC-KRAB(A)-P2A-mKate2f DNA construct was sequenced to confirm gene insertion and co-injected (10 ng µl−1) with emx3:Gal4FF57 (10 ng µl−1) and tol2 transposase mRNA (100 ng µl−1) at 1 nl into wild-type TL embryos at the one-cell stage. At 3 d.p.f., injected embryos were screened for mosaic expression of mKate2f, then raised to adulthood. The tol2 transposase mRNA was in vitro transcribed from the NotI-linearized pCS-TP6287 plasmid (gift from the Wilson laboratory, UCL) using the SP6 mMESSAGE mMACHINE Kit (Ambion). RNA was purified using RNA Clean & Concentrator Kits (Zymo Research). Germline transmission was determined by mating adult fish to nacre mutants (mitfaw2/w2, pigmentation mutants58) and subsequently identifying their progeny for mKate2f fluorescence, then raising to adulthood to establish a stable Tg(UAS:FingR(PSD95)-GFP-CCR5TC-KRAB(A)-P2A-mKate2f)u541;Tg(emx3:Gal4FF)u542 line. Owing to the negative-feedback mechanism in the system, Tg(UAS:FingR(PSD95)-GFP-CCR5TC-KRAB(A)-P2A-mKate2f) expression is extremely low. To increase the number of transgene copies and the level of expression in the background reporter line, the double transgenic Tg(UAS:FingR(PSD95)-GFP-CCR5TC-KRAB(A)-P2A-mKate2f);Tg(emx3:Gal4) fish were incrossed for imaging experiments and maintained by alternating incrosses and outcrosses to nacre mutants.
Whole-mount synaptic immunohistochemistry and imaging
Staining for MAGUK expression was performed using whole-mount immunohistochemistry adapted from a previous study59. Zebrafish larvae (2 d.p.f.) were dechorionated and fixed with 4% formaldehyde methanol-free (Pierce Thermo Fisher Scientific, 28906) in BT buffer (1.0 g sucrose, 18.75 µl 0.2 M CaCl2, topped up to 15 ml with PO4 buffer (8 parts 0.1 M NaH2PO4 and 2 parts 0.1 M Na2HPO4)). To increase the signal-to-noise ratio, the fixing time was decreased to 1.5–2 h at 4 °C, although this led to softer samples. The samples were washed with PO4 buffer and distilled H2O for 5 min at room temperature, then permeabilized with ice-cold 100% acetone for 5 min at −20 °C. After washing with distilled H2O and PO4 buffer for 5 min each, the samples were blocked with blocking buffer containing 2% goat serum, 1% bovine serum albumin and 1% DMSO in 0.1 M PBS pH 7.4 for at least 2 h. The samples were then incubated with primary antibodies (see below for list) diluted in blocking buffer at 4 °C overnight. The embryos were washed 4–6 times for at least 20 min in blocking buffer at room temperature and incubated in secondary antibodies overnight at 4 °C. To remove unbound secondary antibodies, the embryos were washed again and transferred to glycerol in a stepwise manner up to 80% glycerol in PBS.
The primary antibodies used for staining were anti-pan-MAGUK (mouse monoclonal, K28/86, Millipore) and anti-tRFP (rabbit polyclonal, AB233, Evrogen), both at a dilution of 1:500. To avoid overamplification of signal outside of the synapse, FingR(PSD95)–GFP puncta were visualized using its own fluorescence. The following secondary antibodies were used at a dilution of 1:200: Alexa-Fluor 568 goat anti-rabbit IgG and Alexa-Fluor 633 goat anti-mouse IgG monoclonal (Life Technologies).
Confocal images were obtained using the Leica TCS SP8 system with HC PL APO ×20/0.75 IMM CS2 multi-immersion objective set to glycerol (Leica Systems). z stacks were obtained at 1.0 μm depth intervals with sequential acquisition settings of 1,024 × 1,024 px. The raw images were compiled using NIH Image J (http://imagej.nih.gov/ij/). To analyse the colocalization of the puncta, maximum projections of 5–10 μm were taken for each cell. Grey values were taken from the cross-section of the puncta using the plot-profile tool from ImageJ. Puncta grey values were normalized against the whole-stack grey value of their respective channels.
The colocalization and relationships between FingR(PSD95)–GFP and antibody staining were analysed using custom Python scripts (available at GitHub (https://github.com/anyasupp/single-neuron-synapse)). For colocalization of FingR and antibody puncta (and vice versa), the presence of puncta with maximum normalized grey value of at least 50% higher than the baseline was used. To estimate the size of the puncta, the normalized grey values were interpolated with a cubic polynomial implemented by the SciPy (v.1.11.4) function scipy.interpolate.interp1d before finding the full width at half maximum.
Single-cell FingR(PSD95) expression using electroporation
To sparsely label single tectal cells, a FoxP2.A:Gal4FF activator plasmid (gift from M. Meyer) was electroporated into the Tg(UAS:FingR(PSD95)-GFP-ZFC(CCR5TC)-KRAB(A)-P2A-mKate2f)-positive larvae at 3 d.p.f according to a previously described method33. Anaesthetized 3 d.p.f. zebrafish larvae were mounted in 1% low-melting-point agarose (Sigma-Aldrich), perpendicular to a glass slide in a Petri dish filled with electroporation buffer (180 mM NaCl, 5 mM KCl, 1.8 mM CaCl2, 5 mM HEPES, pH 7.2) with 0.02% tricaine (MS-222, Sigma-Aldrich). Excess agarose along the larval body was then removed to allow access for the electroporation electrodes. A FoxP2.A:Gal4FF construct (500 ng µl−1) was injected into the midbrain ventricle together with tol2 mRNA (20 ng µl−1) and Phenol Red (~0.025%) at 5–8 nl using a micro glass needle (0.58 mm inside diameter, Sutter Instrument, BF100-58-15) pulled using a micropipette puller (Model P-87 Sutter Instrument). After injection, the positive electroporation electrode was placed lateral and slightly dorsal to the hemisphere of the target optic tectum, and the negative electrode was placed lateral and ventral to the contralateral eye. Five 5 ms trains of 85 V voltage pulses at 200 Hz were delivered through the electrodes using an SD9 stimulator (Grass Instruments). Electroporated larvae were screened for sparse, single-cell expression of FoxP2:FingR(PSD95)+ neurons using a ×20/1.0 NA water-dipping objective and an LSM 980 confocal microscope with Airyscan 2 (Zeiss) at 5–6 d.p.f.
Repeated Imaging of FingR-labelled synapses
For synapse-tracking experiments, Tg(UAS:FingR(PSD95)-GFP-CCR5TC-KRAB(A)-P2A-mKate2f) larvae that were electroporated with FoxP2.A:Gal4FF were reared at 28 °C under various light schedules. At 5–6 d.p.f., larvae were visually screened for the expression of single or sparsely labelled FoxP2.A:FingR(PSD95)+ neurons in the tectum using a ×20/1.0 NA water-dipping objective and the LSM 980 confocal microscope with Airyscan 2 (Zeiss) and placed into individual wells of six-well plates (Thermo Fisher Scientific) to keep track of individual larvae and the corresponding labelled neurons, each well containing approximately 10 ml of fish water. For repeated live imaging of reticulospinal neurons, Tg(UAS:FingR(PSD95)-GFP-CCR5TC-KRAB(A)-P2A-mKate2f) were crossed to a Tg(pvalb6:KALTA4)u508 driver line50 (gift from the Bianco laboratory at UCL) and visually screened for larvae with a labelled reticulospinal population. For imaging FingR(PSD95)-GFP puncta, the larvae were anaesthetized with 0.02% tricaine for 5–10 min and immobilized in 1.5–2% low-melting-point agarose (Sigma-Aldrich) in fish water. The larvae were head-immobilized with the tail free and allowed to recover from anaesthesia during imaging. Imaging was performed at the appropriate zeitgeber/circadian time (ZT, where ZT0 is lights on) according to the experimental paradigm. For day–night synapse tracking, larvae were repeatedly imaged at approximately ZT0–ZT2 and ZT10–ZT12 at 7 d.p.f., 8 d.p.f. and 9 d.p.f. at 28.5 °C with the chamber lights on. For imaging performed during the dark phase (ZT14–ZT24), the temperature was kept at 28.5 °C with the chamber lights off. When immobilizing the larvae for night imaging, the handling was performed under low red light (Blackburn Local Bike Rear Light 15 Lumen; 5.2–30.5 lux, measured at the plate level). After imaging, larvae were unmounted from agarose by releasing agarose around their heads and allowing the larvae to independently swim out of the agarose. Unmounted larvae were then placed back into individual wells of six-well plates.
FingR(PSD95)+ neuron image stacks were acquired using a ×20/1.0 NA water-dipping objective and the LSM 980 confocal microscope with Airyscan 2 (Zeiss). GFP and mKate2f were excited at 488 nm and 594 nm, respectively. z stacks were obtained at a 0.34 μm voxel depth with sequential acquisition settings of 2,024 × 2,024 px, giving a physical resolution of 0.0595376 μm in x, 0.0595376 μm in y and 0.3399999 μm in z and 16-bit using SR4 mode (imaging 4 pixels simultaneously). Pixel alignment and processing of the raw Airyscan stack were performed using ZEN Blue software (Zeiss).
Locomotor activity assay
Tracking of larval zebrafish behaviour was performed as previously described45, with slight modifications. Zebrafish larvae were raised at 28.5 °C under a 14 h–10 h light–dark (LD) cycle or constant light (LL) or switching from 14 h–10 h light–dark to constant light (free-running (FR) conditions). At 5–6 d.p.f., each FoxP2.A:FingR(PSD95)+ larva was placed into individual wells of a six-well plate (Thermo Fisher Scientific) containing approximately 10 ml of fish water. The locomotor activity of some larvae was monitored using an automated video tracking system (Zebrabox, Viewpoint LifeSciences) in a temperature-regulated room (26.5 °C) and illuminated with white lights on either 14 h–10 h light–dark cycles or constant light conditions at 480–550 lux with constant infrared illumination. The larval movement was recorded using the Videotrack ‘quantization’ mode with the following detection parameters: detection threshold, 15; burst, 100; freeze, 3; bin size, 60 s. The locomotor assay data were analysed using custom MATLAB (MathWorks) scripts available at GitHub (https://github.com/JRihel/Sleep-Analysis). Any 1 min period of inactivity was defined as 1 min of sleep, according to the established convention for larval zebrafish40. For experiments examining the effects of drug treatment on behaviour that did not involve live imaging, such as the clonidine dark pulse experiment (Extended Data Fig. 10d–g), 24-well (Thermo Fisher Scientific) and 96-well plates (Whatman) were used instead of the 6-well plates used for synapse imaging experiments. Sleep latency for Extended Data Fig. 9c–e was calculated using frame-by-frame data (collected at 25 fps), using code available at GitHub (https://github.com/francoiskroll/FramebyFrame).
Sleep deprivation assay
Zebrafish larvae were raised at 28.5 °C under a 14 h–10 h light–dark cycle to 6 d.p.f., when they were video-tracked (see the ‘Locomotor activity assay’ section). Randomly selected 7 d.p.f. larvae were then sleep deprived for 4 h immediately after lights off from ZT14 to ZT18. Non-deprived control larvae were left undisturbed. Larvae that were individually housed in six-well plates were manually sleep deprived under dim red light (Blackburn Local Bike Rear Light 15 Lumen) by repeated gentle stimulation using a No. 1-2 paintbrush (Daler-Rowney Graduate Brush) to prevent larvae from being immobile for longer than 1 min. For most stimulations, this required only putting the paintbrush into the water; if the larvae remained immobile, they were gently touched. The 4 h SD protocol was performed by experimenters in 2 h shifts. All sleep deprived and control larvae were imaged at around ZT14 and ZT18 on 7 d.p.f. and again at ZT0 on 8 d.p.f. (see the ‘Repeated imaging of FingR-labelled synapses’ section).
Drug exposure for live imaging
Tg(UAS:FingR(PSD95)-GFP-CCR5TC-KRAB(A)-P2A-mKate2f) larvae that had been electroporated with FoxP2.A:Gal4FF (see the ‘Single-cell FingR(PSD95) expression using electroporation’ section) were kept under a 14 h–10 h light–dark cycle until 7 d.p.f., then imaged at ZT4–ZT5 (see the ‘Repeated imaging of FingR-labelled synapses’ section). Larvae were transferred to individual wells of a six-well plate containing 10 ml of sleep-promoting drugs, alone or in combination, as follows: 30 µM melatonin (M5250, Sigma-Aldrich) in 0.02% DMSO; 30 µM of clonidine hydrochloride (C7897, Sigma-Aldrich) in 0.02% DMSO; 45 µM 2-chloroadenosine (C5134, Sigma-Aldrich) in 0.02% DMSO; and 0.02% DMSO in fish water as controls45,52,60,61. Combinations of drugs were applied at the same concentrations as the single-dose conditions, maintaining the final DMSO concentration of 0.02%. Sleep induction was monitored with video-tracking (see the ‘Locomotor activity assay’ section) for 5 h, after which the drugs were removed by 2–3 careful replacements of the fish water using a transfer pipette followed by transferring the larvae individually to a new six-well plate with fresh water. The larvae were then reimaged using the Airyscan system (see the ‘Repeated imaging of FingR-labelled synapses’ section).
Tectal cell segmentation and clustering
The morphology of tectal neurons at 7 d.p.f. was segmented and measured using Imaris v.8.0.2 (Bitplane) and ImageJ (NIH). The total filament length for each neuron was obtained using the Imaris Filament function. The anterior–posterior span of the distal arbour was calculated using the Measurement function at an orthogonal view in 3D. The relative proximal arbour locations were calculated by dividing the proximal arbour distance from the nucleus by the total length of the neuron obtained using Filament function of Imaris. The distance from the skin, distal arbour thickness and distal arbour to skin distance were obtained using the rectangle Plot_Profile tool of ImageJ at an orthogonal view of the neuron to calculate the fluorescence intensity across the tectal depth. The intensity profiles were then analysed using custom Python scripts to obtain the maximum width using area under the curve functions following published methods33,43.
Additional clustering and statistical analyses were performed using custom scripts written in Python (available at GitHub (https://github.com/anyasupp/single-neuron-synapse)). For segmentation clustering, six morphological features of FoxP2.A cells were standardized and reduced in dimensionality by projecting into principal component analysis space. The first four components, which explained 89% of the variance, were selected to use for clustering. These components were then clustered using k-means clustering with k ranging from 1 to 11. Using the elbow method, Calinski Harabasz coefficient and silhouette coefficient, we found k = 4 to be the optimal number of k clusters.
Puncta quantification and statistics
All image files of synapse tracking experiments were blinded by an independent researcher before segmentation and puncta quantification. To count the number of FingR(PSD95)–GFP puncta, each neuron’s morphology was first segmented using the Filament function in Imaris v.8.0.2 (Bitplane). FingR(PSD95)–GFP puncta were labelled using the Spots function, thresholded using the Quality classification function at approximately 130–200 depending on the image file. The number and location of GFP puncta were also manually checked for accuracy. FingR(PSD95)–GFP puncta lying on the FingR+ neuron (mKate2f red channel) were extracted using the Find Spots Close to Filament XTension add-on in IMARIS.
The percentage changes in synapse number and intensity were calculated using the following formula:
$$\Delta ( \% )=\left(\frac{x-{x}_{t-1}}{{x}_{t-1}}\right)\times 100,$$
Where x represents either synapse number or intensity and xt − 1 is the respective synapse number or intensity at the previous timepoint. Statistical tests were implemented using Python62. Values in the figures represent the average ± 68% CI unless stated otherwise.
Synapse intensity was calculated using the ratio of the normalized average FingR(PSD95)–GFP intensity and mKate2f, to account for depth-dependent signal reduction63. First, the average FingR(PSD95)–GFP and mKate2f (cell morphology) intensities at the same location within the neuron were extracted using the Imaris Spots function. Next, these average intensity values were normalized to their respective channel maximum and minimum value to account for larval position inconsistencies between imaging as follows:
$${\rm{Normalized}}\,{\rm{mean}}\,{\rm{intensity}}=\frac{{\rm{Average}}\,{\rm{intensity}}-{{\rm{Channel}}}_{\min }}{{{\rm{Channel}}}_{\max }-{{\rm{Channel}}}_{\min }}.$$
Depth-dependent signal reduction was corrected by calculating the FingR(PSD95)–GFP:mKate2f ratio as follows:
$${\rm{Normalized}}\,{\rm{mean}}\,{\rm{puncta}}\,{\rm{intensity}}=\frac{{\rm{Normalized}}\,{\rm{mean}}\,{\rm{GFP}}}{{\rm{Normalized}}\,{\rm{mean}}\,{\rm{mKate2f}}}.$$
Before statistical analysis, all datasets were tested for normality using the Shapiro–Wilk test followed by direct visual inspection of Q–Q plots. For repeated-measures design, the data were first tested for sphericity using Mauchly’s test; repeated-measures or mixed ANOVAs were then performed, corrected with Greenhouse–Geisser correction when sphericity was violated, followed by post hoc t-tests corrected with Benjamini–Hochberg correction for multiple comparisons. For multiple-sample comparisons, equal variances were tested using Levene’s tests. If variances were equal, either one-way ANOVA (multiple groups) with post hoc Benjamini–Hochberg correction or Student’s t-tests (two groups) were performed to test for significant differences. If variances were unequal, Kruskal–Wallis (multiple groups) with Dunn’s multiple-comparison correction or Mann–Whitney U-tests (two groups) were performed to test for significant differences. All of the statistical analyses performed are provided in Supplementary Data 1.
per3 circadian rhythm bioluminescence assay
Larvae (6 d.p.f.) from a Tg(per3:luc)g1;Tg(elavl3:EGFP)knu3 incross were individually placed into wells of 24-well plates in water containing 0.5 mM beetle luciferin (Promega). From ZT14 (the light to dark transition) the next day, half of the larvae were subjected to a sleep deprivation paradigm (see the ‘Sleep deprivation assay’ section) under dim red light, while the others were left undisturbed in similar lighting conditions. At the end of the 4 h sleep deprivation period, the larvae were individually transferred to the wells of a white-walled 96-round-well plate (Greiner Bio-One) and sealed with an oxygen-permeable plate-seal (Applied Biosystems). Bioluminescence photon counts, reflecting luciferase expression driven by the per3 promoter, were sampled every 10 min for three consecutive days, in constant dark at 28 °C, using the TopCount NXT scintillation counter (Packard).
HCR fluorescence in situ hybridization
FoxP2.A neurons were sparsely labelled with GFP by co-electroporating wild-type AB larvae with FoxP2.A:Gal4FF and UAS:eGFP1 at 500 ng µl−1 each (see the ‘Single-cell FingR(PSD95) expression using electroporation’ section). Whole-mount hybridization chain reaction (HCR) was performed on larvae with FoxP2.A neurons positive for GFP at 7 d.p.f. using an adapted protocol from a previous study64. In brief, larvae were fixed with 4% PFA and 4% sucrose overnight at 4 °C. The next day, the larvae were washed with PBS to stop fixation and the brains were removed by dissection. The dissected specimens were permeabilized using proteinase K (30 µg ml−1) for 20 min at room temperature, then washed twice in PBS with 0.1% Tween-20 (PBST), before being post-fixed in 4% PFA for 20 min at room temperature. The larvae were then washed in 0.1% PBST and prehybridized with prewarmed HCR hybridization buffer (Molecular Instruments) for 30 min at 37 °C.
Probes targeting multiple genes associated with different types of adenosine or adrenergic receptors were combined and labelled to the same hairpins. For example, probes detecting adora1a-b (encoding adenosine receptor A1a and A1b) contain initiators that correspond with hairpins (B3) labelled with Alexa 546 fluorophore, whereas adora2aa, adora2ab and adora2b (encoding adenosine receptors A2aa, A2ab and A2b) contain initiators that correspond with hairpins (B5) labelled with Alexa 647 fluorophore (Supplementary Data 2). Probe solutions consisting of cocktails of HCR probes for each transcript (Thermo Fisher Scientific) were prepared with a final concentration of 24 nM per HCR probe in HCR hybridization buffer. The larvae were then incubated in probe solutions overnight at 37 °C. Excess probes were removed by washing larvae four times for 15 min with probe wash buffer (Molecular Instruments) at 37 °C followed by two 5 min washes of 5× SSCT buffer (5× sodium chloride sodium citrate and 0.1% Tween-20) at room temperature. Preamplification was performed by incubating the samples with amplification buffer (Molecular Instruments) for 30 min at room temperature. Hairpin h1 and hairpin h2 were prepared separately by snap-cooling 4 µl of 3 µM stock at 95 °C for 20 min and 20 °C for 20 min. The larvae were then incubated with h1 and h2 hairpins in 200 µL amplification buffer overnight in the dark at room temperature. Excess hairpins were washed thoroughly the next day twice for 5 min and three times for 30 min with 5× SSCT at room temperature. The specimens were then imaged using a ×20 water-immersion objective and the LSM 980 confocal microscope with Airyscan 2 (Zeiss). The endogenous GFP signal from FoxP2.A was visualized without amplification.
Reporting summary
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.
[ad_2]
Source link
Leave a Reply