Tag: Cancer microenvironment

  • Evolution of myeloid-mediated immunotherapy resistance in prostate cancer

    Evolution of myeloid-mediated immunotherapy resistance in prostate cancer

    [ad_1]

    scRNA-seq of samples derived from patients with prostate cancer

    Tumour tissues were obtained from baseline biopsies of patients participating in clinical trials for localized prostate cancer (NCT03821246), de novo oligometastatic prostate cancer (NCT03007732) and metastatic mCRPC (NCT03248570). Viable cryopreserved tumour tissue samples were digested in Roswell Park Memorial Institute (RPMI) medium containing Collagenase I and II (0.1 mg ml−1, Thermo Fisher Scientific) and DNase I (Thermo Fisher Scientific), minced and then subjected to 1 h digestion using the gentleMACS system (Miltenyi Biotec). Live cell isolation was done using MACS LS columns (Miltenyi Biotec). The 10x Genomics Chromium Controller was used to generate GEM bead emulsions using the Single Cell 5′ Library & Gel Bead Kit (10x Genomics), followed by cDNA synthesis and amplification, and subsequent library preparation steps using 10x Genomics kits. Library sequencing was done by the University of California, San Francisco (UCSF) Institute for Human Genetics core on a NovaSeq 6000 (Illumina), targeting a median read depth of 150,000 reads per cell for total gene expression libraries and 60,000 reads per cell for CITE-seq libraries. All antibodies were obtained from BioLegend unless otherwise indicated. This work was done with informed consent obtained from all human research participants, and the sample procurement and analysis were approved by the institutional review board committees at UCSF.

    Human scRNA-seq analysis

    The raw data from 10× sequencing were processed using the Cell Ranger pipeline (v.3, Genome build, GRCh38). The raw gene-expression matrices were subjected to processing by CellBender (v.0.1.0)61 to eliminate ambient RNAs. The filtered gene-expression matrices then underwent doublet detection using the package DoubletDetection (https://doi.org/10.5281/zenodo.2678041) with default parameters. The results were analysed through the SCANPY pipeline62. To ensure the retention of high-quality cells, the following filters were applied: first, cells with less than 10% mitochondrial genes were retained; second, the number of detected genes per cell was set between 100 and 2,500 genes; third, genes expressed in at least three cells were kept; and finally, platelets (PF4, unique molecular identifier (UMI) > 0), red blood cells (HBB, UMI > 1) and doublets were removed. The gene-expression matrix was log2-transformed with the addition of 1 and normalized to 10,000 counts per cell, followed by highly variable gene selection using default parameters with the SCANPY function. The resulting matrix was corrected by regressing out total UMI counts and mitochondria percentage, followed by scaling to a mean of 0 and a variance of 1. Principal component analysis was performed using the top 50 principal components, followed by sample-wise batch correction using the SCANPY-implemented Harmony63. Leiden clustering (default resolution = 1.0) and UMAP plotting were performed, with a resolution of 1.0 applied for both T cell and myeloid cell clustering. Differential expression analysis identified the top-ranked genes that were upregulated in each individual cluster relative to the combination of all other cells, as determined by the SCANPY function tl.rank_genes_groups. Annotation of each unbiased population was achieved through manual inspection of the top-ranked genes of each cluster. Analysis of cell density on the UMAP was carried out using the SCANPY function tl.embedding_density, and boxplots were generated to represent cell population frequencies for each cell type. Gene scores were computed using the SCANPY function tl.score_genes with curated gene lists provided. To calculate gene scores at the sample level, scores were computed for each cell and subsequently combined at the sample level by using the median score of cells within a given sample.

    Mice

    FVB/NJ and C57BL/6J male mice (from the Jackson Laboratory) were used in the experiments at 6–10 weeks of age. The STOCK Tg(Spp1-EGFP)PD43Gsat/Mmucd (Spp1-EGFP)64 mouse strain was sourced from the Mutant Mouse Resource & Research Centers at the University of California, Davis. All mice were housed in a pathogen-free facility under standardized environmental conditions, including a controlled 12 h:12 h light:dark cycle, humidity of 30–70% and a temperature range of 20–26 °C. For experiments, a total of 1 × 106 cells (murine prostate cancer cell line MyC-CaP (CRL3255, American Type Culture Collection (ATCC)) or TRAMP-C2 (CRL-2731, ATCC)) were resuspended in sterile PBS and transplanted subcutaneously in the right flank of either FVB/NJ or C57BL/6J mice, respectively. The identities of MyC-CaP and TRAMP-C2 were authenticated using the Mouse Cell STR Profiling Service (137-XV, ATCC), and mycoplasma contamination was tested before each injection using a mycoplasma PCR detection kit (G238, abm). Sample size was determined using preliminary data and previous publications to ensure reproducibility of the experiment. Tumour volume = (L × W × W)/2 (mm3), with length (L) and width (W) being the longest diameter and shortest diameter, respectively. All experimental procedures were approved by the Institutional Animal Care and Use Committee at UCSF.

    The model for CRPC was established by subcutaneously engrafting 1 × 106 MyC-CaP cells into the right flank of male FVB/NJ mice 6–10 weeks old. When the tumour size reached 100–200 mm3, each mouse was injected subcutaneously with 1.875 mg degarelix (Firmagon) in 100 μl PBS, followed by a maintenance dose of 0.625 mg degarelix in 100 μl PBS every 28–30 days to induce CRPC. The development of CRPC was defined as a tumour volume that regressed after degarelix treatment and then grew back to 100–200 mm3. Subsequently, the mice were randomized and treated with the indicated antibodies and/or inhibitors.

    Cell line culture

    MyC-CaP and TRAMP-C2 cells were cultured in complete DMEM medium comprising Dulbecco’s Modified Eagle Medium supplemented with 10% fetal bovine serum (FBS, Omega Scientific) and 1× penicillin/streptomycin (10,000 ml streptomycin sulfate and 10,000 units ml−1 penicillin G). All reagents were obtained from the UCSF Cell Culture Facility, unless otherwise indicated.

    Flow cytometric analysis

    Mouse organs were collected and processed as follows. Spleens were mechanically dissociated with FACS wash buffer (PBS supplemented with 2% (v/v) FBS and 0.5 mM EDTA (Teknova)). Tumours were sequentially digested three times with 12 ml of a cocktail of 2 mg ml−1 (w/v) collagenase type IV and 100 Kunitz units per ml DNase I (both from Sigma-Aldrich) for 12 min for each digest. All single-cell suspensions were filtered using 70-μm filters (Fisher Scientific) and subjected to red-blood-cell lysis using ACK Lysing Buffer (Quality Biological). Cells were immunostained by incubating at 4 °C for 30 min with the fluorescently labelled antibodies below (all antibodies were purchased from BioLegend unless otherwise indicated). After staining, cells were washed once or twice in FWB and resuspended in FWB or FWB containing 1 μg ml−1 propidium iodide (PI, BioLegend) to assess viability. All flow cytometric data were acquired using an LSRFortessa X-50 flow cytometer operated with FACSDiva software (BD Biosciences). Post-acquisition data analysis was performed using FlowJo (v.10.10.0, Tree Star). All antibodies used in this study are commercially available and have been validated by the manufacturer or through published literature. On receipt, laboratory testing was conducted with known positive and negative controls to confirm the reliability of each antibody.

    For mouse lymphoid staining, we used anti-mouse CD3-Brilliant Ultraviolet 395 (563565, Clone 145-2C11, BD Biosciences, 1:200), CD4-Brilliant Violet 711 (100447, GK1.5, 1:200), CD8-Brilliant Ultraviolet 805 (612898, 53-6.7, BD Biosciences, 1:200), NK-1.1-Alexa Fluor 647 (108719, PK136, 1:200), CD38-PE/Cyanine7 (102717, 90, 1:200), CD39-Brilliant Violet 421 (567105, Y23-1185, BD Biosciences, 1:200), CD45-Brilliant Violet 785 (103149, 30-F11, 1:200), CD279 (PD-1)-PE/Dazzle 594(109115, RMP1-30, 1:200) antibodies were used. For mouse myeloid staining, anti-mouse CD11b-Brilliant Violet 605 (101257, M1/70, 1:200), CD39-Brilliant Violet 421 (567105, Y23-1185, BD Biosciences, 1:200), CD73-PE (12-0731-82, eBioTY/11.8 (TY/11.8), Invitrogen, 1:200), CX3CR1-PE/Cyanine7 (149015, SA011F11, 1:200), F4/80-Alexa Fluor 647 (565853, T45-2342, BD Biosciences, 1:200), I-A/I-E-Alexa Fluor 700 (107621, M5/114.15.2, 1:200), Ly-6G-APC/Cyanine7 (127623, 1A8, 1:200), Podoplanin-PerCP/Cyanine5.5 (127421, 8.1.1, 1:200), Siglec-F-Brilliant Violet 421 or Brilliant Ultraviolet 395 (562681 or 740280, E50-2440, BD Biosciences, 1:200) antibodies. The relevant isotype-matched antibodies (eBRG1, RTK2758, RTK4530 and SHG-1) were used as controls.

    For intracellular immunostaining of proteins, single-cell suspensions were labelled with LIVE/DEAD Fixable Aqua Dead Cell Stain Kit (L34957, Invitrogen, 1:1,000) and then treated with eBioscience Foxp3/Transcription Factor Staining Buffer Set (Invitrogen), according to the manufacturer’s protocol designed for intracellular (cytoplasmic) proteins. Cells were then stained with fluorescently labelled antibodies against anti-mouse CD3; Brilliant Ultraviolet 395 (563565, 145-2C11, BD Biosciences, 1:200), CD8-Brilliant Ultraviolet 805 (612898, 53-6.7, BD Biosciences, 1:200), CD11b-Brilliant Violet 605 (101257, M1/70, 1:200), CD45-Brilliant Violet 785 (103149, 30-F11, 1:200), IFN-γ-PE/Cy7 (505825, XMG1.2, 1:100), and TNF-α-Brilliant Violet 421 (506327, MP6-XT22, 1:100). The relevant isotype-matched antibodies (RTK2071) were used as negative controls.

    In vitro co-culture of purified myeloid cells with T cells

    Complete RPMI cell culture medium was made up of RPMI 1640 supplemented with 10% FBS (Omega Scientific), 1× β-mercaptoethanol (Gibco, 55 µM), 1× glutamine (29.2 g l−1 l-glutamine, 200 mM), 1 mM sodium pyruvate (11 g  l−1 sodium pyruvate), 1× MEM non-essential amino acids, 1× penicillin/streptomycin (10,000 μg ml−1 streptomycin sulfate and 10,000 units ml−1 penicillin G). All reagents were obtained from the UCSF Cell Culture Facility, unless otherwise indicated.

    For enrichment of mouse CD8+ T cells, single-cell suspensions of spleens from CRPC-bearing mice were labelled with BD Violet proliferation dye 450 (Fisher Scientific) and subsequently negatively enriched using the MojoSort Mouse CD8 T cell isolation kit, according to the manufacturer’s instructions. For isolation of specific myeloid subsets, single-cell suspensions from CRPC developed in Spp1-EGFP mice were incubated with the LIVE/DEAD Fixable Aqua Dead Cell Stain Kit (L34957, Invitrogen, 1:1,000), anti-mouse CD11b-Brilliant Violet 605 (101257, M1/70, 1:200), CX3CR1-PE/Cyanine7 (149015, SA011F11, 1:200), F4/80-Alexa Fluor 647 (565853, T45-2342, BD Biosciences, 1:200), I-A/I-E-Alexa Fluor 700 (107621, M5/114.15.2, 1:200), Ly-6G-APC/Cyanine7 (127623, 1A8, 1:200), Podoplanin-PerCP/Cyanine5.5 (127421, 8.1.1, 1:200) and Siglec-F-Brilliant Violet 421 (562681, BD Biosciences, 1:200) antibodies. After immunostaining, cells were washed twice in FWB and resuspended in FWB containing 1 μg ml−1 propidium iodide to assess viability. The cells of interest were FACS-purified using BD FACSAria Fusion operated with FACSDiva software (BD Biosciences).

    To determine whether TAM cells, including Spp1hi-TAMs, CX3CR1hi-TAMs and CD163hi-TAMs, mediate immunosuppression, 1 × 104 CD8+ T cells, labelled with BD Violet Proliferation Dye 450 (BDB562158, Fisher Scientific, 1:1,000) and stimulated with 1 × 104 Dynabeads Mouse T-Activator CD3/CD28 (Gibco) were cultured in the presence or absence of purified myeloid subsets at a 1:1, 5:1 or 10:1 ratio, respectively, in 200 µl complete RMPI medium in round (U)-bottom 96-well plates at 37 °C, 5% CO2 for 3 days. T cell proliferation was assessed by flow cytometry.

    To determine whether Spp1hi-TAMs suppress T cell activation, 1 × 104 CD8+ T cells, labelled with BD Violet Proliferation Dye 450 (Fisher Scientific) and activated with 1 × 104 Dynabeads Mouse T-Activator CD3/CD28 (Gibco), were cultured with or without purified Spp1hi-TAMs at a 1:1 ratio in 200 µl complete RMPI medium in round (U)-bottom 96-well plates at 37 °C, 5% CO2 for 3 days. The cells were subsequently restimulated with 1× eBioscience Cell Stimulation Cocktail (plus protein transport inhibitors, Invitrogen) for 5 h. After washing, cells were stained for intracellular immunostaining of proteins. T cell activation was assessed by flow cytometry.

    To determine whether Spp1hi-TAM-mediated T cell suppression requires adenosine signalling, 1 × 104 CD8+ T cells, labelled with BD Violet Proliferation Dye 450 (BDB562158, Fisher Scientific, 1:1,000) and activated with 1 × 104 Dynabeads Mouse T-Activator CD3/CD28 (Gibco), were cultured with or without purified Spp1hi-TAMs at a 1:1 ratio in 200 µl complete RMPI medium in the presence of ciforadenant (10 μM, Corvus Pharmaceuticals) or InVivoMAb anti-mouse CD73 (10 μg ml−1; TY/23, BioXCell) in round (U)-bottom 96-well plates at 37 °C, 5% CO2 for 3 days. T cell proliferation was assessed by flow cytometry and compared with cells treated with the equivalent amount of DMSO or isotype-matched control antibodies (2A3, BioXCell).

    To determine whether IL-1R signalling is involved in Spp1hi-TAM-mediated T cell suppression, 1 × 104 CD8+ T cells, labelled with BD Violet Proliferation Dye 450 (BDB562158, Fisher Scientific, 1:1,000) and activated with 1 × 104 Dynabeads Mouse T-Activator CD3/CD28 (Gibco), were cultured with or without purified Spp1hi-TAMs at a 1:1 ratio in 200 µl complete RMPI medium in the presence of either purified in vivo GOLD functional grade anti-mouse IL-1R (10 μg ml−1, JAMA-147) or the relevant isotype-matched control antibody (PIP, both from Leinco Technologies) in round (U)-bottom 96-well plates at 37 °C, 5% CO2 for 3 days. T cell proliferation was assessed by flow cytometry.

    Extracellular adenosine detection

    Spp1hi-TAMs and MDSCs (both 1 × 105 cells) were isolated from the same CRPC and plated in 250 µl complete RMPI medium in flat-bottom 48-well plates at 37 °C, 5% CO2. After 24 h, supernatants were collected and adenosine levels were measured using an adenosine assay kit (Fluoreometric, ab211094, Abcam) following the manufacturer’s protocol. Fluorescence was measured using a GluoMax plate reader (Promega; Ex/Em = 535/587 nm), and the concentration of accumulated extracellular adenosine was calculated by subtracting the baseline adenosine levels from medium without cells.

    Transwell assays

    Transwell assays were performed as previously reported65. In brief, FACS-isolated Spp1hi-TAMs or enriched CD8+ T cells labelled with BD Violet Proliferation Dye 450 (BDB562158, Fisher Scientific, 1:1,000), from CRPC developed in mice or their spleens respectively, were plated into the top or bottom chambers of Transwell plates containing 6.5 mm cell culture inserts with 0.4 µm pore polyester membrane (CLS3379, Corning), as depicted in Extended Data Fig. 6e. In the top chamber of the inserts, 1 × 104 CD8+ T cells alone or those stimulated with 1 × 104 Dynabeads Mouse T-Activator CD3/CD28 (Gibco) were plated, and in the bottom chamber, 6 × 104 Spp1hi-TAMs or 6 × 104 CD8+ T cells with or without anti-CD3/28 stimulation at a 1:1 ratio were plated, each with 100 µl or 600 µl complete RMPI medium, respectively. After 3 days of culture, T cell proliferation in each chamber was assessed by flow cytometry.

    In vivo treatment of antibodies or inhibitors

    To determine whether Spp1hi-TAMs are resistant to CSF1R blockade, mice were randomly divided into two groups when they developed CRPC (tumour volume of 100–200 mm3) and were administered intraperitoneally 1 mg anti-mouse CSF1R (AFS98, BioXCell) or the respective isotype-matched control (2A3, BioXCell) antibodies in 200 μl PBS. A maintenance dose of 0.5 mg in 200 μl PBS was given after 5 days. The myeloid composition was analysed by flow cytometry 2 days after the final injection.

    For immune checkpoint inhibition, mice with established CRPC (tumour volume of 100–200 mm3) were randomly divided into four groups and subjected to intraperitoneal injection with these antibodies in 200 μl PBS every 3 days for a total of three injections: 200 μg anti-mouse CTLA-4 (24H2)66 alone; 400 μg anti-mouse PD-1 (17D2)67 alone; a combination of anti-mouse CTLA-4 and PD-1; or the respective IgG2a, κ isotype-matched control. Tumour burden was measured every 2–3 days after the initial injection until it reached 750 mm3, unless otherwise indicated.

    To determine whether Spp1hi-TAMs contribute to resistance to ICIs in vivo, mice with developed CRPC (tumour volume of 100–200 mm3) were randomly divided into three groups. They were administered with: a combination of anti-mouse CTLA-4 and PD-1 in 200 μl PBS injected intraperitoneally along with intratumoral injection of 1 × 105 Spp1hi-TAMs purified from digested CRPC (more than 350 mm3) of a mouse from the same cohort in 50 μl PBS; a combination of anti-mouse CTLA-4 and PD-1 in 200 μl PBS injected intraperitoneally along with 50 μl of PBS intratumorally; or the respective isotype-matched control antibody in 200 μl PBS injected intraperitoneally along with 50 μl PBS intratumorally. Antibodies were administered every 3 days for a total of three injections, and Spp1hi-TAMs were adoptively transferred every 5 days for a total of two injections. Tumour growth was measured every 2–3 days after the initial injection until it reached 750 mm3, unless otherwise indicated. The lymphoid composition was analysed by flow cytometry one day after the final injection.

    For blockade of adenosine receptors (A2ARs), mice with established CRPC (tumour volume, 100–200 mm3) were randomly divided into two groups. Ciforadenant (10 mg per kg, Corvus Pharmaceuticals) or DMSO vehicle control (Sigma-Aldrich) in 200 μl of injection solution was administered once daily through oral gavage for 10 consecutive days. The injection solution consisted of 10% ciforadenant (or DMSO medium) and 90% corn oil (MedchemExpress). Tumour growth was measured every 2–3 days after the initial injection.

    To determine whether A2AR blockade enhances immunotherapy efficacy, mice with established CRPC (tumour volume, 100–200 mm3) were randomly divided into two groups. Ciforadenant (10 mg per kg, Corvus Pharmaceuticals) or DMSO vehicle control (Sigma-Aldrich) in 200 μl of injection solution described above was administered once daily by oral gavage for 10 consecutive days. Simultaneously, mice were injected intraperitoneally with 400 µg anti-mouse PD-1 or the respective isotype-matched control antibodies in 200 µl PBS every 3 days for a total of three injections. Tumour growth was monitored every 2–3 days after the initial injection. The lymphoid and myeloid compositions were analysed by flow cytometry 1–2 h after the eighth injection of ciforadenant (1 day after the final anti-mouse PD-1 antibody injection).

    All comparisons within experiments were carried out using age-matched mice (6–10 weeks old) engrafted with the same stock of MyC-CaP throughout the study.

    scRNA-seq of prostate cancer mouse samples

    For the single-cell assessment of MyC-CaP, a cohort of FVB/NJ mice bearing MyC-CaP were injected subcutaneously with either degarelix (n = 3) or PBS (n = 3), as described above. HSPC or CRPC tissues were collected on reaching a tumour volume of more than 350 mm3. Tumours were processed and single-cell suspensions were prepared as described above. For the cell-surface protein staining, cells were incubated with CD45.1-Brilliant Violet 510 (A20) for 30 min at 4 °C. After immunostaining, cells were washed twice in FWB and resuspended in FWB containing 1 μg ml−1 propidium iodide for viability assessment. Cells were then sorted into CD45+ and CD45 populations using FACSAria (BD Biosciences). Each population was transferred into separate 75 mm flow-cytometry tubes, centrifuged for 5 min at 250g at 4 °C and the supernatant was discarded. Cells were then resuspended in 100 μl Fc blocking buffer, consisting of 95 μl FWB + 5 μl of 0.5 mg ml−1 anti-mouse CD16/32 antibody (2.4G2, Cytek Biosciences), followed by a 10-minute incubation at 4 °C. CD45+ cells were subsequently stained directly with 2 μl of 0.05 mg ml−1 TotalSeq-C hashtag antibodies 2, 4 and 6 (M1/42, 30-F11) without washing, for 40 min at 4 °C. All sorted populations from each tissue were then pooled to yield a total of 1 × 106 cells and these cells were stained with 100 μl of a cocktail of TotalSeq-C surface antibodies (CD11c (N418), CD163 (S15049I), F4/80 (BM8) and Ly-6G (1A8), each at a concentration of 2.5 μg ml−1) for 30 min at 4 °C. After staining, cells were washed with 1 ml complete RPMI medium and filtered through a 70 µm cell strainer. Cell viability and counting were reassessed and the volumes were adjusted for 10x chromium chip input at a concentration of 1.29 × 106 cells per ml. For scRNA-seq of TRAMP-C2, single-cell suspensions were initially labelled with LIVE/DEAD Fixable Dead Cell Stain Kit (Near-IR; Invitrogen) for 10 min at 4 °C. Subsequently, cells were stained with anti-mouse CD16/32 antibody (2.4G2) and CD45-Brilliant Violet 570 (30-F11) antibodies for 30 min on ice. After immunostaining, cells were washed with FWB and sorted into CD45+ and CD45 populations using a FACSAria2 (BD Biosciences). Each sorted population was transferred into separate 75 mm flow-cytometry tubes, centrifuged for 5 min at 250g at 4 °C and the supernatant was discarded. Cells were then resuspended in 100 μl Fc blocking buffer as above, followed by a 10-minute incubation at 4 °C. Cells were then stained directly with 2 μl of 0.05 mg ml−1 TotalSeq-C hashtag antibodies 1 and 2 (M1/42, 30-F11) for 40 min at 4 °C without washing. Equal proportions of cells labelled with hashtags were pooled together, and three individual reactions, each containing a total of 6 × 104 cells, were washed with 1 ml complete RPMI medium and filtered through a 70 µm cell strainer. After reassessing cell viability and counting, cell concentrations were adjusted to 1.29 × 106 cells per ml for loading into the 10x chromium chip. A 10x Genomics chromium controller was used to create GEM bead emulsions using a Single Cell 5′ Library & Gel Bead Kit (10x Genomics), followed by synthesis and amplification of cDNA and subsequent library preparation steps using 10x Genomics kits. The UCSF Institute for Human Genetics core performed library sequencing on a NovaSeq 6000 (Illumina), targeting a median read depth of 150,000 reads per cell for total gene expression libraries and 60,000 reads per cell for CITE-seq libraries. All antibodies were obtained from BioLegend, unless otherwise indicated.

    Mouse scRNA-seq analysis

    The raw data obtained from 10× sequencing were processed through the Cell Ranger pipeline (v.5, Genome build GRCm38). Subsequent steps in the analysis were the same as those used in human scRNA-seq until batch correction using Harmony, followed by Leiden clustering (resolution = 1.0) and UMAP plotting. A resolution of 1.0 was applied for myeloid-cell clustering. Differential expression analysis was done to identify the top-ranked genes upregulated in each individual cluster compared with the combination of all other cells. This analysis was done using the SCANPY function tl.rank_genes_groups. Annotation of each population was established through manual examination of the top-ranked genes in each cluster. To analyse cell density on the UMAP, the SCANPY function tl.embedding_density was used. Box plots were generated to visually represent cell population frequencies for each cell type. Gene scores were computed using the SCANPY function tl.score_genes with curated gene lists provided. Gene scores were computed using the SCANPY function tl.score_genes for each cell, using curated gene lists. To calculate similarity scores between myeloid subsets in humans and mice, a pseudo-bulk analysis was done to aggregate gene-expression data from the cellular level to the sample level. Z-scores were computed for each gene on the basis of cells in a given sample, and the mean was determined as the representative value for the sample. We then identified the shared genes in both human and mouse datasets, focusing on the top 50 genes within each subset.

    Immunostaining and microscopy

    For immunostaining of SPP1hi-TAMs and CD4+ or CD8+ T cells in human tissues, in situ hybridization was done using RNAscope (Advanced Cell Diagnostics, ACDBio) on FFPE sections 4 μm thick from patients with either HSPC or mCRPC (NCT03007732, NCT03248570 and NCT02655822). Tissues were pretreated with target retrieval reagents and protease to improve target recovery according to the RNAscope Multiplex Fluorescent Reagent Kit v.2 assay protocol (323100, ACD Bio). Probes for human SPP1 and CD68 mRNA (420101-C2 and 560591-C4, respectively; ACDBio) were applied at a 1:50 dilution for 2 h at 40 °C. The probes were then hybridized with Opal 7-Color Manual IHC Kit (NEL811001KT, PerkinElmer) for the detection of SPP1 and CD68 transcripts using Opal 650 and Opal 690, respectively, at a dilution of 1:700. Immunofluorescence staining for human CD4 (MA-12259, 4B12, Invitrogen) and CD8 (ab60076, YTC182.20, abcam) was then done at a 1:100 dilution each. Targets were detected using Alexa Fluor 488-conjugated donkey anti-mouse IgG secondary antibody (ab150105, abcam) at a 1:100 dilution and Alexa Fluor 555-conjugated goat anti-rabbit IgG secondary antibody (4050-32, Southern Biotech) at a 1:100 dilution. Tissues were counterstained with 4′,6diamidino-2-phenylindole (DAPI, ACD Bio) and mounted with ProLong Gold Antifade Mountant (P36930, Invitrogen). Slides were imaged at 63× magnification using a Leica SP8 X white-light laser confocal microscope (Leica Microsystems) with multiple regions of interest from each specimen slide randomly selected for analysis. No staining was observed using negative control probes specific for the bacterial dapB gene (321831, ACD Bio) counterstained with Opal dyes, or with secondary antibodies alone on tonsil tissue.

    Immunostaining of PD-L1 expression on EpCAM+ cells and CD68+ cells in human tissues was done on FFPE tissue sections 4 µm thick from responders and non-responders in clinical trial NCT02655822. This staining was done using a Ventana DISCOVERY ULTRA automated slide stainer and Ventana DISCOVERY ULTRA reagents (Roche Diagnostics), according to the manufacturer’s instructions (UCSF Protocol 3612), unless otherwise indicated. After deparaffinization, antigen retrieval was performed with cell conditioning 1 solution for 64 min at 97 °C. Primary antibodies for human CD68 (PG-M1; Agilent), PD-L1 and EpCAM (E1L3N and D9S3P, respectively, Cell Signaling Technology) were applied at 1:200, 1:100 and 1:50 dilutions for 32 min, respectively, at 36 °C. Goat Ig Block Ventana (760-6008) was applied for 4 min before the secondary antibodies (OmniMap anti-Ms for the anti-CD68 antibody and OmniMap anti-Rb for the anti-PD-L1 and anti-EpCAM antibodies) were incubated for 12 min. A stripping step between each primary was done with cell conditioning 2 solution at 97 °C for 8 min between primary antibodies. Endogenous peroxidase was inhibited using DISCOVERY Inhibitor RUO Ventana (760-4840) for 12 min. The CD68 was visualized using DISCOVERY Rhodamine 6G Kit Ventana (760-244), PD-L1 was visualized with DISCOVERY Cy5 Kit (760-238) and EpCAM was visualized with DISCOVERY FAM Kit (RUO) (760-243) for 8 min each. Finally, slides were counterstained with spectral DAPI (FP1490, Akoya) for 8 min. Slides were scanned using an AxioScan.Z1 in a whole-slide scanner (Zeiss) with a Plan-Apochromat 20×/0.8 M27 objective lens. Images were captured using an Orca-Flash 4.0 v.2 CMOS camera (Hamamatsu).

    Immunostaining of mouse tissues was done on 5-μm acetone-fixed cryosections following standard protocols, as previously described68. Sections were immunostained with the following antibodies: anti-mouse F4/80-Alexa Fluor 647 (565853, T45-2342, BD Biosciences) at a 1:200 dilution, and Spp1-EGFP was amplified using chicken anti-GFP antibody (ab13970, abcam) at a 1:2,000 dilution, followed by donkey anti-chicken IgY(IgG)-DyLight 405 (703-475-155, Jackson ImmunoResearch) at a 1:500 dilution. After staining, slides were washed, stained with DAPI to detect nuclei and mounted with ProLong Gold Antifade Mountant (P36930, Invitrogen). Images were obtained on a Leica DMi8 microscope with a 63×/1.32 oil objective lens and a Leica DFC9000 GTC digital microscope camera, with LAS X software (v.3.5.7.23225). Images were processed using ImageJ (v.2.14.0/1.54 f) for fluorescent channel overlays and uniform exposure adjustment.

    Statistical analysis

    Statistical analyses were done using Prism (v.10, GraphPad Software). Normality was determined with the D’Agostino & Pearson or Shapiro–Wilk tests, chosen according to sample size. Statistical significance was determined using two-sided unpaired Student’s t-tests for normally distributed data or the non-parametric Mann–Whitney test, two-sided paired Student’s t-tests, one sample t-tests, ordinary one-way ANOVA with Sidak correction for normally distributed data or the non-parametric Kruskal–Wallis test with Dunn’s correction, ordinary two-way ANOVA with Sidak correction, simple linear regression analyses, Wilcoxon tests with Benjamini–Hochberg correction, or log-rank tests, as indicated in the figure legends.

    Reporting summary

    Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

    [ad_2]

    Source link

  • Cancer cells impair monocyte-mediated T cell stimulation to evade immunity

    Cancer cells impair monocyte-mediated T cell stimulation to evade immunity

    [ad_1]

    Cell lines

    YUMM1.7 and YUMM3.3 mouse melanoma62 cell lines (obtained from M. Bosenberg, Yale University) were cultured in Dulbecco’s modified Eagle’s medium (DMEM)–F12 produced in-house. A375, M249 (ref. 63) (obtained from J. Massague, MSKCC), KPAR64 (obtained from J. Downward, Francis Crick Institute) and EPP2 (ref. 65) (obtained from J. Zuber, IMP) cell lines were cultured in DMEM (Gibco). LOX48 (obtained from J. Massague, MSKCC), CT-26 (ref. 66) and NCI-H358 cell lines were purchased from the American Type Culture Collection and cultured in RPMI-1640 (Gibco). The NCI-H358 RTT derivative was generated by culturing NCI-H358 parental cells in the presence of 1 μM KRAS inhibitor (Amgen) for 90 days until cells became resistant. YUMM1.7OVA clones and all NTT and RTT derivatives were generated as previously described15. RTT BRAFi-resistant cancer cells (YUMM1.7 and YUMM3.3 model) and all genetically engineered derivatives were cultured continuously in 100 nM dabrafenib (Selleckchem). MEKi-resistant cancer cells were cultured continuously in 10 nM trametinib (Selleckchem). Human NTT and RTT melanoma cell line derivatives (A375, M249 and LOX) were generated as previously described48, and RTT cells were maintained in culture on 1 µM vemurafenib (LC-Labs). HEK-293T cells were purchased from Takara (Lenti-X 293T, 632180) and cultured in DMEM high-glucose produced in-house. BMDCs were cultured according to an adapted version of a previously described protocol67. In brief, for the first 6–7 days, cells were cultured at a density of 1 × 106 cells per ml. On day 4, fresh medium was added to minimize cell death. After that, cells were either seeded for assays or counted and re-seeded at a density of 300,000 cells per ml. BMDCs were cultured in full T cell medium supplemented with 200 ng ml–1 FLT3L-Ig (BioXcell) and 5 ng ml–1 GM-CSF (in-house produced). Bone-marrow-derived Ly6C+ monocytes were cultured in DMEM medium (Gibco). Human MONO-MAC-1 (obtained from J. Zuber, IMP) and BLaER-1 (ref. 68) (obtained from M. Gaidt, IMP) cell lines were cultured in RPMI-1640 (Gibco). All media for cell lines were supplemented with 10% FBS, 2 mM l-glutamine (Gibco) and 100 IU ml–1 penicillin–streptomycin (Thermo Fisher). BLaER-1 and NCI-H358 cells were additionally supplemented with 1× sodium pyruvate. CD8+ T cells were cultured in full T cell medium containing RPMI-1640 supplemented with 10% FBS, 2 mM l-glutamine and 100 IU ml–1 penicillin–streptomycin, 1× sodium pyruvate (Gibco), 1× non-essential amino acids (Gibco), 20 mM HEPES (produced in-house) and 0.05 mM β-mercaptoethanol (Millipore). All cells were cultured at 37 °C and 5% CO2. Cells were routinely tested negative for mycoplasma contamination. STR Profiling was performed in-house for the YUMM1.7, YUMM3.3, EPP2 and KPAR cell lines. Moreover, sensitivity to MAPK inhibitors was confirmed for A375, M249 and LOX (BRAFi), CT-26 (MEKi) and for NCI-H358 (KRAS inhibitor).

    Animal experiments and ethics

    All mice were bred and housed in pathogen-free conditions with a housing temperature of 22 ± 1 °C, 55 ± 5% humidity and a photoperiod of 14 h of light and 10 h of dark. Within each experiment, age-matched and sex-matched groups were used. B6.129S(C)-Batf3tm1Kmm/J (Batf3–/–) mice, B6(Cg)-Zbtb46tm1(HBEGF)Mnz/J (zDC-DTR) mice, B6.Cg-Tg(Itgax-cre)1-1Reiz/J (Cd11ccre) mice and NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ (NSG) mice were purchased from Jackson Laboratories. B6.Cg-Rag2tm1.1Cgn/J Ly5.2 (Rag2–/–), BALB/c and C57BL/6J mice were obtained from the Vienna Biocenter in-house breeding facility. ItgaxcrePtger2−/−Ptger4fl/fl mice were provided by J. Boettcher (TUM, Munich). For Rag2–/–Batf3–/– strain generation, Batf3–/– mice were crossed to Rag2–/– mice, and homozygous offspring (Rag2–/– × Batf3–/–) were confirmed by genotyping and used in subsequent experiments to evaluate the lack of cDC1s in the context of ACT. For Rag2–/– zDC-DTR strain generation, zDC-DTR mice were crossed to Rag2–/– mice and homozygous offspring were confirmed by genotyping and used in subsequent experiments to evaluate the effects of DC depletion. For ACT experiments and injection of YUMM1.7OVA cell lines, Rag2–/– mice were used. For the injection of YUMM3.3, KPAR and EPP2 cell lines, C57BL/6 mice were used. For the injection of the CT-26 cell line, BALB/c mice were used. For the generation of BMDCs and Ly6C+ monocytes, bones (femurs and tibias) were collected from in-house-bred C57BL/6 mice. For all above strains, mice were used between 6 and 12 weeks old. For OT-1Luc CD8+ T cell isolation, 6–24-week-old OT-1Luc Thy1.1 mice69 were used. All mouse experiments were performed according to our licence approved by the Austrian Ministry (GZ: MA58-2260492-2022-22; GZ: 340118/2017/25; BMBWF-66.015/0009-V/3b/2019; GZ: 801161/2018/17; and GZ: 2021-0.524.218 and their amendments). Mice were euthanized when the humane end point was reached (for example, weight loss > 20%, signs of distress and pain), when tumours displayed signs of continuous necrosis or when tumours reached the maximum allowed tumour volume of 1,500 mm3.

    Tumour cell injections

    For subcutaneous injections, mice were anaesthetized with 2–4% isoflurane. For the YUMM1.7OVA model and all its derivatives, 0.5–1 × 106 YUMM1.7OVA cancer cells were subcutaneously injected into the flank of each mouse in a volume of 50 µl. For contralateral experiments, alternating flanks were used for the injection of NTT and RTT cells to avoid preferential growth biases. For the YUMM3.3 model, 0.3–1 × 106 cells were subcutaneously injected in a volume of 50 µl. For the CT-26 model, 0.25 × 106 cells were subcutaneously injected in 50 µl. For the KPAR model 0.35 × 106 cells were subcutaneously injected in 50 µl. For the EPP2Luc cell line derivative, orthotopic injections were performed as previously described65. In brief, surgeries were performed under isoflurane (2–4%) anaesthesia on a heated plate. A small incision on the upper left quadrant of the shaved abdomen was made and the was spleen identified. After externalization of the pancreas, 1 × 106 cells were intrapancreatically injected. Organs were re-situated, and the peritoneum closed with a resorbable 6-0 Vicryl suture, followed by skin closure with sterile wound clips. Animals received intraperitoneal (i.p.) injections of 5 mg kg–1 carprofen pre-emptively and every 12–48 h after surgery. The health status of mice was monitored daily, and the tumour burden was assessed by BLI. All cell lines were resuspended in PBS mixed 1:1 with Matrigel (Corning) in the final injection volume. Subcutaneous tumours were monitored by calliper measurements every 2–4 days, and tumour volume was calculated according to the following formula: volume = (D × d2)/2, in which D and d are the long and short tumour diameters, respectively.

    Isolation and activation of naive OT-1Luc CD8+ T cells

    Spleen and lymph nodes were isolated from OT-1Luc mice, and red blood cell lysis was performed with ammonium–chloride–potassium lysis buffer (Thermo Fisher) according to the manufacturer’s protocol. T cell isolation was performed using a Magnisort mouse CD8+ naive T cell enrichment kit (Thermo Fisher) according to the manufacturer’s protocol. T cells were activated for the first 24 h by seeding them on a plate coated with 2 µg ml–1 anti-CD3 (145-2C11, eBioscience) overnight, and adding 1 µg ml–1 anti-CD28 (37.51, eBioscience) and 20 ng ml–1 carrier-free IL-2 (BioLegend). T cells were expanded for approximately 6–7 days in the presence of IL-2 and maintained daily at a concentration of 1 × 106 cells per ml in fresh T cell medium.

    ACT, intratumoral injection and BLI

    Unless otherwise specified, when tumours reached a volume of 100–150 mm3, 4 × 106 in vitro-activated OT-1Luc CD8+ T cells were i.v. injected into mice in a volume of 100 µl PBS. For i.t. injections, 4 × 106 in vitro-activated OT-1Luc CD8+ T cells were injected in a volume of 50 µl PBS. For measuring T cell infiltration by BLI, d-luciferin (150 mg kg–1, Goldbio) was injected retro-orbitally or by tail vein injection into anaesthetized mice, and mice were imaged with an IVIS machine (Caliper Life Sciences) and analysed using Living Image software (v.4.4; Caliper Life Sciences). In NTT tumours, T cell recruitment to the tumour is detectable by BLI within 24–48 h. This initial recruitment is followed by a phase of T cell expansion, with peak BLI signals between 96 and 120 h. Hence, we depict 96 h post-ACT images (unless otherwise specified in figure legends) as a suitable time point to assess T cell expansion in immune-permissive TMEs.

    In vivo treatments

    For treatment with ICB, mice were i.p. injected with anti-PD1 (clone RMP1-14, BioXcell) and anti-CTLA4 (clone 9D9, BioXcell) in 100 µl of PBS when tumours reached a volume of 150–200 mm3 (usually between 6 and 8 days after injection). The YUMM3.3 model was treated with 200 µg anti-PD1/anti-CTLA4, the CT-26 model with 100 µg anti-PD1, and the EPP2 model with 100 µg anti-PD1. ICB treatment was administered every 3 days and continued for at least for 3 weeks, as indicated in the figure legends. Control mice were treated with an isotype control antibody (rat IgG2a anti-trinitrophenol, clone 2A3, BioXcell, and mouse IgG2b, clone MPC-11, BioXcell). For COX2i treatment, celecoxib (LC Laboratories) was reconstituted in a 60:40 (DMSO to PEG400, dH2O) mixture as previously described53. Etoricoxib (Sellekchem) was dissolved first in a small volume of DMSO and then in 1% sodium carboxymethyl cellulose. COX2i was given by oral gavage every day (30 mg kg–1) in a volume of 200 µl. For both COX2i regiments (celecoxib and etoricoxib), the treatment was started at day 3 after injection, when tumours were palpable, and continued every day until the termination of the experiment. 5-AZA (Sigma-Aldrich) was reconstituted in DMSO to a stock concentration of 10 mg ml–1 and further diluted in PBS for in vivo treatments and given as i.p. injections (1 mg kg–1) in 100–250 µl every 3 days, as previously described54. For NK cell depletion, 200 µg anti-NK1.1 (clone PK136, BioXcell) was administered every 3 days through i.p. injections, starting at day 1 after tumor induction. NK cell depletion was confirmed by flow cytometry. For blocking T cell egress from the lymph node, mice were given an i.p. injection of 20 µg per mouse of FTY720 (Sigma) in 100 µl saline. Treatment was started on the day of T cell transfer and administered for 5–7 consecutive days. Control mice received saline injection. FLT3L (recombinant FLT3L-Ig, hum/hum, BioXCell) treatment (30 µg per mouse in 100 µl PBS i.p.) was started at day 3 after injection and administered every day for 9 consecutive days. In vivo IFNAR blockade was performed with InVivoMab anti-mouse IFNAR-1 (clone MAR1-5A3, BioXcell) and was administered i.p. (200 µg per mouse) in 100 µl. For IFNγ, the neutralizing anti-mouse IFNγ monoclonal antibody was used (clone XMG1.2, BioXcell). Treatment was started on the day of tumour engraftment and administered every 3 days. InVivoMab IgG1 isotype control (BioXCell) was used as the control. For experiments in which CD8 depletion was performed, mice were treated with 50 µg anti-CD8 (clone 2.43, in-house produced), whereas control mice were treated with isotype control (rat IgG2b anti-keyhole limpet haemocyanin, clone LTF-2) starting the day before tumour engraftment and then every 3 days.

    DC vaccination with BMDCs

    BMDCs were cultured with FLT3L and GM-CSF as described above. At day 10–12 after isolation, DCs were activated overnight with polyI:C (5 µg ml–1, Invitrogen), pulsed with recombinant SIINFEKL peptide (5 µg ml–1, Genscript) and sorted by FACS on the basis of alive MHCII+CD103+CD11c+ cells. Next, 1 × 106 cells in a volume of 50 µl PBS were i.t. injected. Control mice received 50 µl PBS. For DC vaccinations, 2 doses of i.t. injections were administered on day 4 and day 6 after tumour engraftment.

    In vivo depletion of DCs with diphtheria toxin

    For generation of bone marrow chimeras, Rag2–/– Ly5.1 mice were preconditioned (2×5 Gy), before transferring back 10 × 106 bone marrow cells by i.v. injection. As donor mice, Rag2–/– Ly5.2 zDC-DTR mice were used. After 8 weeks of reconstitution, mice were used for experiments. NTT cells were injected, and DCs were depleted by injecting 25 µg kg–1 of body weight of diphtheria toxin (Sigma-Aldrich) i.p. in PBS, starting on the day of tumour engraftment and then every 3 days for 3–4 doses. Reconstitution efficiency and depletion of intratumoral DCs was confirmed by flow cytometry.

    Lentivirus generation and cell transduction

    Lenti-X (HEK-293T) cells were transfected with 4,000 ng of the plasmid of interest, 2,000 ng of VSV-G plasmid and 1,000 ng of PAX2 plasmid using polyethylenimine (Avantor). Virus-containing supernatant was collected 24 h and 48 h after transfection and subsequently filtered through a 0.45 µm filter. The cell lines of interest were transduced with the collected virus mixed with 8 µg ml–1 polybrene (Merck).

    Generation of CRISPR–Cas9 KO and overexpression cell lines

    Doxycycline-inducible Cas9 (iCas9) clones from parental cell lines were generated to allow inducible expression of Cas9. sgRNAs were chosen on the basis of the best VBC score70 (Supplementary Table 7) and were cloned into a vector containing a puromycin selection marker and mCherry or eGFP (hU6-sgRNA–PuroR–mCherry/eGFP). sgRNAs targeting the ROSA26 locus were used as controls for KO cell lines. After transduction, cells were selected with puromycin (5–8 µg ml–1) for 5 days. All sgRNA sequences are provided in Supplementary Table 7. For the generation of single-cell-derived clonal cell lines, cells were FACS sorted on the basis of the fluorescent marker on the sgRNA backbone, at 1 cell per well into 96-well plates. To avoid immunogenicity caused by antibiotic selection markers or fluorophores in the YUMM3.3 model, we transiently transfected the cell lines with an all-in-one vector containing Cas9, the sgRNA of interest and eGFP (U6-IT-EF1As-Cas9-P2A-eGFP). For transient transfection, 7,000 ng of the plasmid with polyethylenimine was used, and single-cell clones were established. For IRF3/7 overexpression, synthesized cDNA sequences were ordered from Twist Biosciences and cloned into two different expression vectors with distinctive selection/fluorescent markers (SFFV-IRF3–mCherry and SFFV-IRF7–PuroR). After transduction, cells were selected with puromycin (5–8 µg ml–1 for 5 days) and bulk FACS-sorted on the basis of mCherry expression. The same cell line engineered with an empty vector containing an mCherry and a puromycin resistance cassette was used as a control. KO and overexpression of the target proteins was confirmed by genotyping, western blotting or quantitative PCR with reverse transcription (RT–qPCR). For the YUMM1.7 and YUMM3.3 Ptgs2 KO cell lines, single-cell-derived clonal cell lines were generated, and several were tested in vivo for growth kinetics.

    EP2 and EP4 KO in T cells

    sgRNAs targeting the Ptger2 and Ptger4 mouse genes were designed according to the VBC score70 and cloned into a dual hU6-sgRNA-mU6-sgRNA-EF1α-mCherry-PuroR backbone (Supplementary Table 7). As a control, we used a sgRNA targeting a gene desert in chromosome 1. The lentiviral vector was produced as described above. T cells were isolated from Cas9–OT-1 mice, which were a gift from J. Zuber (IMP), as described above. Twelve hours after CD3/CD28 activation, T cells were spin-infected with the lentiviral vector containing the sgRNAs in a 1:1 ratio for 1 h at 32 °C and 800g. At 12 h after infection, T cells were removed from the activation plate, washed with PBS and cultured in the presence of 20 ng ml–1 IL-2. Selection with puromycin was performed 30 h after viral transduction. Before ACT, mCherry levels were assessed, and KO was confirmed by functional in vitro assays.

    Flow cytometry and cell sorting

    For flow-cytometry-based characterization of the TME, tumours were isolated between day 7 and 11 after injection, cut into pieces and digested for 1.5 h at 37 °C with collagenase A (1 mg ml–1, Roche) and DNAse (20 µg ml–1, Worthington) in unsupplemented RPMI-1640 medium. Digested tumours were strained through a 70 µm filter and resuspended in FACS buffer (0.5% BSA and 2 mM EDTA in PBS). Fc-block was performed with anti-CD16/32 (clone 2.4G2, Pharmingen) for 10 min at 4 °C to avoid Fc-specific antibody capture, and staining for cell surface markers was performed for 30 min at 4 °C. For intracellular staining, a Foxp3 Transcription Factor staining kit was used (eBioscience). Live/dead exclusion was performed by staining with the fixable viability dye eFluor780 (1:1,000, eBioscience). DCs were defined in most experiments as MHCII+CD11c+CD24+ out of alive CD45+ cells. cDC1s were identified as CD103+CD11b out of the total DCs, cDC2s as CD103CD11b+ and inflammatory cDC2 as CD103CD11b+AXL+. AXL was previously described to identify inflammatory cDC2s37. Monocytes were defined as Ly6C+CD11b+F4/80, and inflammatory monocytes were identified as monocytes that were Ly6A+. Ly6A was previously described to identify monocytes expressing high levels of ISGs38. Macrophages were defined as Ly6CF4/80+Cd11b+. Acquisition of the samples was performed using a BD LSR Fortessa machine (BD Biosciences) with FACS Diva software (v.9.0.1), and analysis was conducted using FlowJo software (v.10.8 or newer). For cell sorting, a BD Aria cell sorter (BD Biosciences) with FACS Diva software (v.9.0.1) was used.

    Antibodies for flow cytometry

    The following antibodies (all anti-mouse) were used for flow cytometry stainings (target (clone, catalogue number, manufacturer, dilution)): AXL PE-Cy7 (MAXL8DS, 25-1084-82, eBioscience, 1:200); CD103 PerCP/cyanine5.5 (2E7, 121415, BioLegend, 1:100); CD103 PE (2E7, BioLegend, 121405, 1:100); CD11b APC (M1/70,17-0112-81, eBioscience, 1:200); CD11b PerCP/cyanine5.5 (M1/70, 101229, BioLegend, 1:200); CD11c BV605 (HL3, 563057, BD Pharmigen, 1:100); CD11c FITC (N418, 117305, BioLegend, 1:100); CD24 BV510 (M1/69, 101831, BioLegend, 1:100); CD24 FITC (M1/69, 11-0242-82, eBioscience, 1:100); CD279/PD-1 BV785 (29F.1A12, 135225, BioLegend, 1:200); CD279/PD-1 FITC (29F.1A12, 135213, BioLegend, 1:200); CD40 APC (3/23, 124611, BioLegend, 1:200); CD45 BV711 (30-F11, 103147, BioLegend, 1:500); CD45 FITC (30-F11, 103107, BioLegend, 1:500); CD86 BV510 (GL-1, 105039, BioLegend, 1:100); CD3 BV605 (17A2, 564009, BD Horizon, 1:100); CD3 AF647 (17A2, 100209, BD Horizon, 1:100); CD3 AF488 (17A2, 100212, BD Horizon, 1:100); CD8a eFluor 450 (53-6.7, 48-0081-80, eBioscience, 1:100); CD8a AF647 (53-6.7, 128041, BioLegend, 1:100); MHCI (H-2Kb) APC (AF6-88.5.5.3, 17-5958-82, Bioscience, 1:200); MHCI (H-2Kb) PE (AF6-88.5.5.3, 17-5958-80, Bioscience, 1:200); MHCII (I-A/I-E) eFluor450 (M5/114.15.2, 48-5321-80, eBioscience, 1:200); MHCII (I-A/I-E) APC (M5/114.15.2, 107613, BioLegend, 1:200); NK-1.1 BV711 (PK136, 108745, BioLegend, 1:100); TCF1 PE (S33-966, 564217, BD Pharmigen, 1:50); TIM3 BV711 (RMT3-23, 119727, BioLegend, 1:100); CD88 PE (20/70, 135805, BioLegend, 1;100); Ly-6A/E (Sca-1) FITC (D7, 108105, BioLegend, 1:100); SIINFEKL-HK2B PE (25-D1.16, 12-5743-81, Invitrogen, 1:100); F4/80 PE (BM8, B123110, BioLegend, 1:200); and rat IgG1, K Isotype control PE (R3-34, 5546, BD Pharmigen). Further information is provided in Supplementary Table 8.

    RNA extraction of cancer cells sorted from tumours, in vitro cell lines and myeloid cells

    Tumours were surgically removed between days 10 and 12 after injection. The tissue was processed as described above, and cancer cells were isolated by flow cytometry on the basis of alive, CD45 cells and a fluorescent marker. For cancer cell lines and in vitro assays with myeloid cells, cells were washed with PBS and snap-frozen in liquid nitrogen and kept at −70 °C until further processing. RNA was extracted using a magnetic bead-based RNA extraction protocol (in-house produced). In brief, cells were lysed and incubated with beads together with DNase I (NEB) followed by magnetic isolation. RNA was purified by further elution with nuclease-free water.

    RT–qPCR

    Reverse transcription was performed for cDNA formation with 1 µg of RNA per sample utilizing a LunaScript RT SuperMix kit (NEB) according to the manufacturer’s instructions. RT–qPCR was performed with 10 ng cDNA per sample either with Luna Universal qPCR master mix (NEB) or an in-house produced MTD qPCR Dye 2× HS master mix according to the manufacturer’s protocol. Each sample included four technical replicates. The RT–qPCR reaction was carried out in a Bio-Rad CFX384 real‐time cycler and contained 1 min of initial denaturation (95 °C) and 45 annealing cycles lasting 15 s at 95 °C and 30 s at 60 °C. The analysis of gene expression levels was determined by the quantification cycles (Cq). Internal controls and the housekeeping gene GAPDH were used to correct for differences in sample quality and to normalize expression values. qPCR primer pair sequences are listed in Supplementary Table 7.

    In vitro assays with BMDCs

    For cancer cell CM experiments, supernatants (in full T cell medium) from confluent cancer cells were collected after 48 h, filtered through a 45 µm filter and frozen at −70 °C until further use. Full T cell medium was supplemented with 20 µM of the COX1/2i indomethacin (Selleckchem) or 5 nM of the MEKi trametinib (Selleckchem) for the evaluation of MAPK and COX1/2 activity before media conditioning. BMDCs were differentiated as described above and collected at day 6. Next, 0.5–1 × 106 cells were seeded in triplicate in a 12-well plate in CM and treated with 10 µg ml–1 InVivoMab anti-mouse IFNAR-1 antibody or InVivoMab IgG1 isotype control (BioXCell). Cells were cultured for 24 h, collected and processed for flow cytometry analysis or RNA extraction. For treatment with PGE2 and IFNβ, cells were collected at day 6 and seeded at a concentration of 0.5–1 × 106 cells per ml. Cells were treated for 24–48 h with recombinant PGE2 (100 ng ml–1, Sigma-Aldrich) and recombinant mouse/human IFNβ (R&D Systems) at the concentrations indicated in the corresponding figures. Same volumes of acetone and PBS were used as a control for PGE2 and IFNβ, respectively.

    Isolation of bone-marrow-derived Ly6C+ monocytes for intratumoral injection and in vitro assays

    Ly6C+ monocytes were directly isolated from the bone marrow of CD45.1+ C57BL/6 mice using a monocyte isolation kit (Miltenyi Biotec) following the manufacturer’s instructions. For intratumoral monocyte transfer, 1 × 106 monocytes were i.t. injected into NTT and RTT tumours established in CD45.2+ Rag2–/– mice. Tumours were isolated for FACS analysis 72 h after intratumoral transfer. For in vitro assays to assess effects of PGE2, Ly6C+ monocytes were seeded at a density of 1 × 106 cells per ml and cultured in recombinant IL-4 and GM-CSF (both produced in-house) and exposed to 200 ng ml–1 PGE2 or vehicle for 3 or 5 days. For CM experiments, monocytes were seeded at a density of 1 × 106 cells per ml in CM obtained from NTT, RTT or RTT IRF3/7 cells with or without 20 µM COX1/2i (indomethacin) during media conditioning and subsequently supplemented with or without 10 µg ml–1 InVivoMab anti-mouse IFNAR1 anti-mouse (BioXCell) or isotype IgG1 control (BioXCell).

    In vitro monocyte co-culture assay

    Ly6C+Ly6A+ or Ly6C+Ly6A monocytes were FACS-sorted from NTT tumours grown in Rag2–/– mice or BALB/c mice and co-cultured for 72 h with naive OT-1 T cells (1:3 ratio: 100,000 monocytes for 300,000 naive OT-1 cells) previously labelled with 0.25 µM CFSE for 30 min at 37 °C.

    In vitro human monocyte assays

    BLaER-1 cells were transdifferentiated into monocytes as previously described68. In brief, BlaER-1 transdifferentiation medium was freshly prepared by adding 10 ng ml–1 human recombinant (hr-)IL-3 (PeproTech), 10 ng ml–1 hr-M-CSF (PeproTech) and 100 nM β-oestradiol (Sigma-Aldrich) to complete RPMI medium. Cells were resuspended in transdifferentiation medium and plated in a 12-well plate at 0.7 × 106 cells per ml. Cells were incubated at 37 °C for 5–6 days until mature monocytes were differentiated. For CM experiments, BLaER-1 or MONO-MAC-1 human monocytes were seeded at a density of 0.7 × 106 cells per ml in CM obtained from NTT or RTT cells from the human melanoma cell lines A375, M249 and LOX or the human NSCLC cell line NCI-H358 with or without 20 µM COX1/2i (indomethacin) during media conditioning. Cells were cultured in CM for 24 h and collected for RNA extraction, as described above.

    Evaluation of pMHCI cross-dressing on monocytes

    For mismatched MHCI haplotype experiments, 1 × 106 YUMM1.7OVA NTT cells from C57BL/6 origin (H-2Kb) were injected in the flank of BALB/c (H2-Kd) mice. BALB/c mice were treated with anti-CD8 (50 µg in 100 µl, in-house produced), whereas control mice were treated with isotype control (rat IgG2b anti-keyhole limpet haemocyanin, clone LTF-2) starting the day before tumour engraftment and then every 3 days to avoid T cell-mediated mismatched MHCI rejection of YUMM1.7 cells. On day 10, tumours were collected and processed for flow cytometry staining of H2-Kb or FACS-sorted on the basis of Ly6A expression for in vitro assays.

    Sample preparation for scRNA-seq

    For scRNA-seq experiments involving TME characterization, tumours were isolated at day 10 after injection (72 h after ACT) and were processed as described above. The CD45+ live fraction was isolated by FACS, and approximately 1 × 105 cells were collected. For scRNA-seq of OT-1 T cells, tumours were isolated 5 days after i.t. injection of 4 × 106 T cells. Alive T cells were isolated from tumours by FACS for CD45+CD3+CD8+ markers. Dissociated cell concentrations were measured using NucleoCounter NC250 (Chemometec) following the manufacturer’s instructions. For scRNA-seq samples from experiments 3 and 4 (see below), a Chromium Next GEM Single Cell Fixed RNA Sample preparation kit was used according to the manufacturer’s protocol. In brief, 1 × 106 cells were fixed for 22 h at 4 °C, quenched and long-term stored at –80 °C according to 10x Genomics Fixation of Cells & Nuclei for Chromium Fixed RNA profiling (CG000478) using a Chromium Next GEM Single Cell Fixed RNA Sample preparation kit (PN-1000414, 10x Genomics). About 250,000 cells per sample were used for probe hybridization using a Chromium Fixed RNA Kit, Mouse Transcriptome, 4rxn × 4BC (PN-1000496, 10x Genomics), pooled equally and washed following the Pooled Wash Workflow as described in the Chromium Fixed RNA Profiling Reagent kit protocol (CG000527, 10x Genomics). For all the other scRNA-seq samples, a Chromium Next GEM Single cell 3′ kit with Dual Index was used according to the manufacturer’s instructions. GEMs were generated on Chromium X (10x Genomics) with a target of 10,000 cells recovered, and libraries prepared according to the manufacturer’s instructions (CG000527, 10x Genomics). Sequencing was performed on NovaSeq S4 lane PE150 (Illumina) with a target of 15,000 reads per cell.

    scRNA-seq analysis of CD45+ TME

    CD45+ immune cells were collected in four different 10x Genomics sequencing experiments. Experiment 1, Chromium Single Cell 3′ scRNA-seq samples were pre-processed using cellranger count (v.6.1.1) (YUMM3.3 samples: NTT/108155 and RTT/108157). Experiment 2, 3′ CellPlex multiplex experiment with 4 samples pre-processed using cellranger multi (v.6.1.1) (YUMM1.7OVA samples: NTT + ACT, RTT + ACT, RTT Ptgs1/2 KO + ACT, RTT CTRL ROSA26 + ACT). Experiments 3 and 4, Chromium Flex multiplex experiments with 4 samples each pre-processed using cellranger multi (v.7.1.0) and the built-in Probe Set (v.1.0.1 mm10-2020-A). Experiment 3, YUMM1.7OVA samples: RTT mCherry CTRL, RTT IRF3/7, RTT COX2i and RTT COX2i + 5-AZA, all ACT treated. Experiment 4, YUMM1.7OVA contained biological replicates of experiment 2 samples and untreated YUMM1.7OVA samples (noA): NTTnoA/271221, RTTnoA/271222, NTT/271223 ACT, RTT/271224 ACT. The prebuilt 10x Genomics mm10 reference refdata-gex-mm10-2020-A was used. Further processing was performed in R (v.4.2.2) with Seurat (v.4.3.0). For generating a CD45+ immune reference map, we integrated cells from the first three experiments as follows. The cellranger filtered feature–barcode matrices were used, retaining cells with more than 1,000 detected genes and less than 15% of mitochondrial and less than 40% of ribosomal RNA reads. An integrated feature–barcode matrix from the three experimental batches was generated accounting for the inclusion of a probe-based assay by keeping genes found in at least five cells in each experiment and excluding ribosomal and mitochondrial genes. Data were log-normalized, scaled (regressing out the difference between the G2M and S phase signature scores), dimensionality reduction was performed using principal component analysis on the top 3,000 most variable genes, and batch correction across batches was performed using Harmony71 (v.0.1.1). The 40 harmony embeddings were used for UMAP visualizations. The first 40 harmony dimensions were used to identify immune cell subclusters with a resolution of 0.5 that were further assigned to cell types using known markers and publicly available myeloid reference datasets21,72. Cells were scored for the expression of published signatures using the AddModuleScore function73. Wilcoxon rank-sum test implemented in Presto (v.1.0.0) was used to identify differentially expressed genes (DEGs). Seurat’s reference-based mapping was used to predict cell-type identity and map cells of the biological replicate experiment to our annotated reference set using the FindTransferAnchors and MapQuery functions after a quality control process retaining cells between 1,000 and 4,500 detected genes for 27,1222 and 27,1224 cells, respectively, and 1,300 and 8,000 detected genes for 27,1221 and 27,1223 cells, respectively, and limiting count tables to the gene universe of the reference. Depth-normalized counts for pseudobulk and GSEA functional analyses of this experiment were generated using cellranger aggr. Differences between ACT and untreated conditions (no ACT) from the replicate experiment (experiment 4) were explored on a pseudo-bulk level in an unsupervised clustering analysis with heatmap visualization. The fibroblast cluster was removed before further processing. Sum aggregation on the depth-normalized UMI counts was followed by variance stabilizing transformation, selection of the 300 most variable genes, standardization, k-means clustering (k = 3) and Enrichr analysis against the Reactome_2022 using Enrichr. The relative frequency bar plots depict the changes in the relative abundance of a cell type across different experimental conditions. For each condition, we calculated the normalized abundance of a specific cell type by comparing the absolute number of the cell type to the absolute number of all cells in the same condition. This normalization accounts for differences in total number of cells captured between conditions. We then calculated the relative cell abundance of the cell type in all conditions of the experiment. This was done by comparing the normalized abundance of the cell type to the sum of normalized abundances of the same cell type across conditions of the experiment. This step produces values between 0 and 1 for each condition for each cell type, with the sum of these values across all conditions of the experiment equalling 1 for each cell type.

    scRNA-seq analysis intratumoral CD8+ OT-1Luc T cells

    Single-cell gene expression of isolated NTT and RTT T cells was assayed in a Chromium Flex experiment, and read processing was performed using cellranger multi (v.7.1.0) using probeset (v.1.0.1 mm10-2020-A). Cellranger-filtered feature–barcode matrices were used and further filtered to retain cells with more than 800 detected genes, less than 10% of mitochondrial and less than 10% of ribosomal RNAs reads, and removal of cells of contaminant clusters was identified using SingleR and ImmGen reference (fibroblasts, MoMac populations). Data were log-normalized and scaled, and dimensionality reduction was performed using principal component analysis on the top 2,000 most variable genes. Harmony was used for the integration of cells from different samples, and 15 harmony embeddings were used for UMAP visualizations. Published tumour single-cell data were used for signature scoring29. Gene lists are provided in Supplementary Table 2.

    RNA velocity analysis

    To understand differentiation trajectories of myeloid cells within the TME, we performed RNA velocity analysis74 of the MoMac compartment. Loom files containing the splicing annotation were created for each sample using the velocyto run command from the package velocyto (0.17,17) with default parameters and with no masked intervals. The loom files were combined with the scRNA-seq object that had been filtered to keep the data for monocyte and macrophage populations (Monocyte_1, Monocyte_2, Infl_Mono, TAM_CCL6, TAM_Ctsk, TAM_C1q, TAM_H2-Ab1, TAM_Spp1 and TAM_cycling) and for each condition (NTT, RTT and RTT Ptgs1/2 KO). First-order and second-order moments were computed using scvelo (0.2.5) pp.moments (n_pcs = 30, n_neighbors = 30), and the dynamical model was run with default parameters. Python (v.3.8.12) was used.

    SCENIC analysis

    Gene regulatory networks for each cell population in each condition were calculated using SCENIC75. The motif database used was mm9-tss-centered-10kb-7species.mc9nr.feather. The co-expression network was calculated using GENIE3. The gene regulatory network was built using SCENIC wrapper functions.

    Analysis of publicly available myeloid datasets and inflammatory signatures

    For the melanoma and lung samples from a previously published23 dataset (Gene Expression Omnibus (GEO) identifier GSE154763), the raw counts were pre-processed as described in the publication, and clustering was calculated using a resolution of 0.8. The monocyte and inflammatory monocyte gene set was derived by using the wilcoxauc() function from presto and by selecting the genes with a log fold change > 0.6 (Supplementary Table 2). Then, the gene symbols were converted to human symbols. The human inflammatory monocyte gene set was used to calculate an enrichment score per cluster. In brief, the gene average expression was calculated for each cluster in the LUNG and MEL datasets on normalized data. Then, an enrichment score was calculated using GSVA with the following parameters: minSize = 5, maxSize = 500, kcdf = “Gaussian”. The projection of the signature on the UMAP embedding was done using the function AddModuleScore() and then plotting the resulting score using FeaturePlot() with min.cutoff = 0.3 for the inflammatory monocyte score and min.cutoff = 0.4 for the Monocyte_1 score. For another dataset43, the annotated seurat-object for myeloid populations corresponding to the original figure 4a was obtained, and gene sets were analysed as described above. For querying published inflammatory gene signatures, a previously published ISG+ DC signature37 was generated by taking the top DEGs in the cDC2 cluster37. The Bosteels Inf-cDC2 DC signature was previously generated37 and was obtained by re-analysing the scRNA-seq dataset (GEO identifier GSM4505993), in which the top 20 DEGs were taken in the identified inflammatory cDC2 cluster. All of them were subsequently scored in our dataset using the AddModuleScore73, and the resulting score was plotted using FeaturePlot(). Gene lists are provided in Supplementary Table 2.

    Single-cell spatial transcriptomics of human melanoma samples

    Single-cell spatial transcriptomics profiling was performed using the CosMx technology (Nanostring). Biopsy samples were obtained from patients with an age at diagnosis that ranged from 24 to 85 years with a median of 66 years; 34% were women and 66% were men. We obtained cell-segmented data for 74 FOVs (an area of 500 × 500 µm) from tissue microarray cores of 34 melanoma metastases, in total consisting of 980 genes × 171,536 cells. Tumour samples were obtained from 21 lymph nodes, 7 subcutaneous metastases, 1 lung metastasis and 1 brain metastasis and 4 not annotated, from 31 patients containing 72 FOVs. Two FOVs were from tonsils as control. Most tumour tissue were from patients who were treatment-naive at the time of surgery. Tissue collection was approved by the Regional Ethics committee at Lund University (numbers 191/2007 and 101/2013). Patients provided informed consent. The majority of tissue microarray cores contained tertiary lymphoid structures, and FOVs were preferentially directed to these regions. Low-quality FOVs, cells with <20 counts and potential multiplets of cells (area exceeding the sample geometric mean + 5 standard deviation) were discarded. Using Seurat, genes for which the mean expression was below 3× the median of the negative probe mean expression, and genes with the highest 99% quantile expression, MALAT1 and IGKC (due to potential spillover to neighbouring cells), were removed, which retained 641 genes. The data were normalized using SCTransform76, counts that were zero before SCTransform were restored, and counts were log-transformed as log2(counts+1). The top 30 principal components were used for UMAP reduction and clustering (k.param = 15, resolution = 0.5, Louvain algorithm). Resulting clusters were assigned to biological annotations using known marker genes, and annotations were mapped back to FOV coordinates. Expression of C1QC, CXCL9 or CXCL10 > 0 was considered as positive. Cell-type fractions were derived for each FOV. Pearson correlation values between cell-type fractions across FOVs were determined and displayed. In Fig. 2i, CXCL9+CXCL10+ macrophage/DCs (number 9 and number 10) were either CXCL9+ or CXCL10+. Macrophage/DCs (number 5) were negative for CXCL9, CXCL10 and C1qC.

    Generation of the TME-COX and TME-IRF3/7 signature

    For the TME-COX signature, the FindMarkers function was used in Seurat, with tresh.use = 0.25 and min.pct = 0.1, to compare RTT CTRL (ROSA26) and RTT Ptgs1/2 KO scRNA-seq samples. The top DEGs (log2 fold change ≤ 1.5, adjusted P value < 0.05) were used and converted to human orthologues using DIOPT77. For the TME-IRF3/7 signature, the FindMarkers function was used in Seurat, comparing RTT CTRL (mCherry) and RTT IRF3/7 and taking the top 40 DEGs.

    TME signatures in immunotherapy-treated human samples

    Gene expression data for patients receiving ICB were obtained from a previous study49 (NCBI BioProject accession number PRJEB23709). The TME-COX, TME-IRF3/7 and CD8+ T cell scores for each tumour sample were defined as the geometric mean of the expression values of each of the gene sets, respectively (Supplementary Table 4). The univariate Cox proportional hazards models, in which the TME-COX and TME-IRF3/7 scores were included as continuous variables, were used for testing the statistical association between gene signature expression and patient survival, separately for both signatures. The tumour samples were then divided into three groups on the basis of the signature score (bottom third, mid-third and top third) and Kaplan–Meier plots were generated for visualization. The association between signature expression and CD8+ T cell abundance was evaluated by calculating the Person’s correlation coefficient between the signature score and a CD8+ score for each signature separately. For this, all scores were normalized to a median of zero and standard deviation of one. The two overlapping genes were removed from the CD8+ signature before comparing it to TME-IRF3/7 signature expression. For evaluating the enrichment of TME-COX and TME-IRF37 gene signatures in responder and non-responder patients to TIL therapy (baseline) from a previous study43, mouse gene identifiers were first converted to human orthologues (with DIOPT v.9; best dcore = yes, best score reverse = yes, DIOPT score > 7) and single-cell level signature enrichment scores for the ‘humanized’ gene sets were calculated using AddModuleScore_UCell78.

    Analysis of transcriptomics data

    For plots shown in Fig. 3a, a cut-off of adjusted P value < 0.05 and log2 fold change > 2 and < –2 was used on DEGs expressed in YUMM1.7OVA NTT and RTT GFP+ cancer cells FACS-sorted out of tumours (Supplementary Table 3). Pathway enrichment analysis was performed using Enrichr79,80. For the plot in Extended Data Fig. 5i, upstream regulator analysis (Ingenuity)81 was used to identify upstream regulators using DEGs with an adjusted P value < 0.05.

    Quantification of PGE2 and IFNβ by ELISA

    For in vitro analysis of PGE2 production, 2 × 106 cells were seeded in 10 ml medium, and supernatants were collected after 48 h and kept at −70 °C until analysis. For IFNβ, 0.3 × 106 cells were seeded, and 1 ml of supernatant was collected from confluent cells in a 6-well plate after 48 h of culture and kept at –70 °C until analysis. For analysis of PGE2 and IFNβ from mouse tumours, whole tumours were isolated between days 4 and 10 after engraftment, accurately weighed and immediately snap-frozen in liquid nitrogen. They were stored at −70 °C until further processing. For PGE2 analysis, tumours were subsequently digested using a MACS dissociator according to the manufacturer’s protocol in PBS supplemented with 1 mM EDTA and 10 µM indomethacin. Lysate was further diluted in dissociation buffer depending on the tumour condition and weight (100 µl per mg of tumour) and further quantified using a PGE2 ELISA kit (Cayman) or a mouse IFNβ Quantikine ELISA kit (Biotechne) according to the manufacturer’s protocol. Values were normalized by taking into account dilution factors and tumour weight. For human IFNβ analysis from human cells, 1 × 106 A375, M249, LOX or NCI-H358 cells were injected into NSG mice and collected on day 21. Tumours were processed as described above and quantified using a Human IFNβ Quantikine ELISA kit (Biotechne) according to the manufacturer’s protocol.

    Eicosanoid analysis from tumours by HPLC–MS

    YUMM1.7OVA NTT and RTT tumours were isolated at day 10 after injection and weighed, and a solution of isopropanol and methanol (1:1, v/v) was added to the tissue for metabolite extraction. The material was subsequently homogenized and incubated for 1 h at −20 °C. The samples were then centrifuged at 14,000g for 3 min. A second extraction round was performed by adding 80% methanol and H2O (v/v) to the pellet and centrifuged, and both supernatants were combined. Finally, the samples were incubated for another 2 h at −20 °C, and after final centrifugation, the supernatants were stored at −70 °C until further analysis. Samples were subsequently measured on a ZIC-pHILIC column or a RP column. Metabolites were annotated using the compound discoverer 3.0 software (Thermo Fisher) using an internal database or the mzCloud database (at least 75% match on the basis of measured molecular weight and MS2 spectra). For filtering, a RSD of corrected quality control areas was used, being less than or equal to 25%. Group CV of at least 1 group is less than or equal to 40%.

    Western blotting

    Cells were lysed with RIPA buffer (Cell Signaling Technology) supplemented with complete Protease Inhibitor Cocktail (Sigma Aldrich) and HALT phosphatase inhibitor (Thermo Fisher Scientific). Lysates were sonicated and cleared by centrifugation at 14,000g for 10 min at 4 °C. Protein concentrations were quantified according to the manufacturer’s instructions using a BCA Protein Assay kit (Pierce, Thermo Fisher Scientific). Immunoblotting was conducted according to standard protocols. The primary antibodies used for immunoblotting were as follows: anti-vinculin (Sigma-Aldrich, 1:1,000), anti-COX2 (CST,1:1,000) and anti-H3 (acetyl K27) (Abcam, 1:5,000). The secondary antibodies used were as follows: anti-rabbit IgG HRP-linked (Cell Signaling Technology, 1:10,000) and anti-mouse IgG HRP-linked (Cell Signaling Technology, 1:10,000).

    Volumetric IF microscopy and image analysis

    Volumetric microscopy of mouse tumours was performed as previously described9. In brief, tumours were fixed in Antigenfix solution (Diapath) for 6–8 h, dehydrated in 30% sucrose overnight, embedded in TissueTek OCT freezing medium (Sakura Finetek) and stored at −80 °C. Using a Leica CM3050 S cryostat, consecutive sections of 50 µm thickness were generated, subsequently permeabilized, blocked and stained in 0.1 M Tris (Carl Roth) supplemented with 1% BSA, 0.3% Triton X-100 (Merck), normal mouse serum (Merck) and donkey serum (Merck). Stained sections were mounted in Mowiol (Merck) and imaged on an inverted TCS SP8 confocal microscope (Leica) using a HC PL APO CS2 ×20/0.75 NA objective. Images were acquired as tiled image stacks, covering whole tumour sections in the xy plane, with 2 µm z-spacing to provide 3D image volumes of at least 20 µm depth. For further analyses, images were adaptively deconvoluted using the Leica TCS SP8 LIGHTNING tool (v.3.5.7.23225) and analysed using Imaris 9.9 software (Oxford Instruments). The Imaris surface generation tool was used to reconstruct and visualize 3D objects for individual cells. Where indicated, signals outside rendered cells were masked to visualize intracellular proteins. For analysis of immune cell infiltration by histocytometry, statistics for object localizations were exported into Excel (v.16.88; Microsoft) and analysed using GraphPad Prism software (GraphPad). Quantification of the number of cells was performed relative to the volume of the imaged section. Interacting cells were described as being less than <5 µm apart from each other.

    Antibodies for immunofluorescence microscopy

    The following antibodies were used for staining of mouse tissues: anti-CD3 (BioLegend, clone 17A2), anti-CD103 (R&D Systems, goat polyclonal), anti-FSCN1 (Santa Cruz Biotechnology, clone 55-k2), anti-Ly6C (BioLegend, clone HK1.4) and anti-MHCII I-A/I-E (BioLegend, clone M5/114.15.2). All antibodies were either validated by the manufacturer or were previously reported for IF microscopy. The populations were defined as follows: T cells (CD3+), monocytes (Ly6C+CD103MHCII+), cDC1s (FSCN1CD103+MHCII+), CCR7+ cDC1 (FSCN1+CD103+MHCII+) and CCR7+ cDC2 (FSCN1+CD103MHCII+). Nur77–GFP was directly assessed by transferring Nur77–GFP reporter OT-1 T cells.

    Meta-analysis of NSAID immunotherapy cohorts

    The meta-analysis was performed in accordance with the updated Preferred Reporting Items for Systematic Reviews and Meta-analyses (PRISMA) reporting guidelines82. The literature search was conducted using the PubMed (MEDLINE) database and last updated on 31 December 2023. The full search strategy is available in Supplementary Table 6. The literature review included studies of (1) adult patients with (2) melanoma or NSCLC (3) undergoing FDA-approved immunotherapy, including anti-PD1, anti-PD-L1 or anti-CTLA4, (4) co-medication with NSAIDs and (5) available sufficient patients’ outcome data to calculate odds ratios for overall response rates or hazard ratios for progression-free and overall survival. Patients were not excluded when receiving concomitant chemotherapy and/or radiotherapy. Included studies report time of overall survival, time of progressions-free survival and overall response rates (defined as complete responses and partial responses divided by patient population). All studies published since 1 January 2011 (FDA approval of first immunotherapy, for example, ipilimumab) were included. Survival data are reported as univariate or multivariate hazard ratios; if both were available, multivariate analysis was prioritized. Odds ratios and hazard ratios with 95% CIs for overall response rates, progression-free and overall survival from included studies were utilized to calculate the pooled odds and hazard ratios. The heterogeneity of the pooled results was evaluated using Q-tests to assess between-study heterogeneity and quantified by the Higgins I2 test. If P was <0.10 for the Q-test or I2 was >50%, significant heterogeneity was assumed, and the random-effects model was used to summarize the data. Statistical analysis was performed using R software (v.4.3.2) with meta (General Package for Meta-Analysis, v.7.0-0).

    Statistical analysis and reproducibility

    Statistical analyses were performed using GraphPad Prism (v.9.1.2 or newer) and Microsoft Excel (v.16.88). Normality of the data distribution was calculated using a D’Agostino and Pearson test or Shapiro–Wilk test. The number of samples (n) used per experiment and the statistical test used are indicated in the figure legends. All in vitro and in vivo experiments were repeated at least twice and always with multiple replicates, except for the following experiments that were performed only once: scRNA-seq involving pharmacological treatment of the YUMM1.7 RTT model, intratumorally injected T cells and the YUMM3.3 model. IF stainings for which representative images are shown were repeated at least twice, except for the NTT in Batf3–/– and Nur77 reporter experiment, which was performed once but with n = 3 tumours and was also confirmed with flow cytometry. Pharmacological combination treatments of the KPAR model were performed once. No statistical methods were used to determine sample size for in vivo experiments, and numbers were chosen on the basis of previous preliminary experiments. Scientists were not blinded to experimental groups, and experiments were repeated by different investigators. Mice were randomly assigned to treatment groups on the basis of tumour size at the day of treatment start or randomly allocated across separate cages when treatment had to be started at day 3. P values < 0.05 were considered significant.

    Reporting summary

    Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

    [ad_2]

    Source link

  • Ho, W. J., Jaffee, E. M. & Zheng, L. The tumour microenvironment in pancreatic cancer—clinical challenges and opportunities. Nat. Rev. Clin. Oncol. 17, 527–540 (2020).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Siegel, R. L., Miller, K. D., Fuchs, H. E. & Jemal, A. Cancer statistics, 2021. CA Cancer J. Clin. 71, 7–33 (2021).

    Article 
    PubMed 

    Google Scholar
     

  • Siegel, R. L., Giaquinto, A. N. & Jemal, A. Cancer statistics, 2024. CA Cancer J. Clin. 74, 12–49 (2024).

    Article 
    PubMed 

    Google Scholar
     

  • Kleeff, J. et al. Pancreatic cancer. Nat. Rev. Dis. Primers 2, 16022 (2016).

    Article 
    PubMed 

    Google Scholar
     

  • Cao, L. et al. Proteogenomic characterization of pancreatic ductal adenocarcinoma. Cell 184, 5031–5052 (2021).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Jiang, L. et al. Prospective observational study on biomarkers of response in pancreatic ductal adenocarcinoma. Nat. Med. 30, 749–761 (2024).

  • Hanahan, D. & Weinberg, R. A. Hallmarks of cancer: the next generation. Cell 144, 646–674 (2011).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Grünwald, B. T. et al. Spatially confined sub-tumor microenvironments in pancreatic cancer. Cell 184, 5577–5592 (2021).

    Article 
    PubMed 

    Google Scholar
     

  • Scott, J. D. & Pawson, T. Cell signaling in space and time: where proteins come together and when they’re apart. Science 326, 1220–1224 (2009).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Uhlén, M. et al. Tissue-based map of the human proteome. Science 347, 1260419 (2015).

    Article 
    PubMed 

    Google Scholar
     

  • Hunter, T. Tyrosine phosphorylation: thirty years and counting. Curr. Opin. Cell Biol. 21, 140–146 (2009).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Huang, P., Gao, W., Fu, C. & Tian, R. Functional and clinical proteomic exploration of pancreatic cancer. Mol. Cell. Proteom. 22, 100575 (2023).

    Article 
    CAS 

    Google Scholar
     

  • Tape, C. J. et al. Oncogenic KRAS regulates tumor cell signaling via stromal reciprocation. Cell 165, 910–920 (2016).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Shi, Y. et al. Targeting LIF-mediated paracrine interaction for pancreatic cancer therapy and monitoring. Nature 569, 131–135 (2019).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Pan, S., Chen, R., Aebersold, R. & Brentnall, T. A. Mass spectrometry based glycoproteomics—from a proteomics perspective. Mol. Cell. Proteom. 10, R110.003251 (2011).

    Article 

    Google Scholar
     

  • Türei, D. et al. Integrated intra- and intercellular signaling knowledge for multicellular omics analysis. Mol. Syst. Biol. 17, e9923 (2021).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Gukovsky, I., Li, N., Todoric, J., Gukovskaya, A. & Karin, M. Inflammation, autophagy, and obesity: common features in the pathogenesis of pancreatitis and pancreatic cancer. Gastroenterology 144, 1199–1209 (2013).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Peng, J. et al. Single-cell RNA-seq highlights intra-tumoral heterogeneity and malignant progression in pancreatic ductal adenocarcinoma. Cell Res. 29, 725–738 (2019).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • DeBerardinis, R. J., Lum, J. J., Hatzivassiliou, G. & Thompson, C. B. The biology of cancer: metabolic reprogramming fuels cell growth and proliferation. Cell Metab. 7, 11–20 (2008).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Olive, K. P. et al. Inhibition of Hedgehog signaling enhances delivery of chemotherapy in a mouse model of pancreatic cancer. Science 324, 1457–1461 (2009).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Del Rosario, A. M. & White, F. M. Quantifying oncogenic phosphotyrosine signaling networks through systems biology. Curr. Opin. Genet. Dev. 20, 23–30 (2010).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Lim, W. A. & Pawson, T. Phosphotyrosine signaling: evolving a new cellular communication system. Cell 142, 661–667 (2010).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Merilahti, J. A. M. & Elenius, K. Gamma-secretase-dependent signaling of receptor tyrosine kinases. Oncogene 38, 151–163 (2019).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Klein, T., Eckhard, U., Dufour, A., Solis, N. & Overall, C. M. Proteolytic cleavage-mechanisms, function, and “omic” approaches for a near-ubiquitous posttranslational modification. Chem. Rev. 118, 1137–1168 (2018).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Graham, D. K., DeRyckere, D., Davies, K. D. & Earp, H. S. The TAM family: phosphatidylserine sensing receptor tyrosine kinases gone awry in cancer. Nat. Rev. Cancer 14, 769–785 (2014).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Kariolis, M. S. et al. An engineered Axl ‘decoy receptor’ effectively silences the Gas6-Axl signaling axis. Nat. Chem. Biol. 10, 977–983 (2014).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Nieto, M. A., Huang, R. Y., Jackson, R. A. & Thiery, J. P. EMT: 2016. Cell 166, 21–45 (2016).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Chen, W. et al. Simple and integrated spintip-based technology applied for deep proteome profiling. Anal. Chem. 88, 4864–4871 (2016).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Erkan, M. et al. StellaTUM: current consensus and discussion on pancreatic stellate cell research. Gut 61, 172–178 (2012).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Rappsilber, J., Mann, M. & Ishihama, Y. Protocol for micro-purification, enrichment, pre-fractionation and storage of peptides for proteomics using StageTips. Nat. Protoc. 2, 1896–1906 (2007).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Huang, P. et al. Spatial proteome profiling by immunohistochemistry-based laser capture microdissection and data-independent acquisition proteomics. Anal. Chim. Acta 1127, 140–148 (2020).

    Article 
    PubMed 

    Google Scholar
     

  • Xu, R. et al. Spatial-resolution cell type proteome profiling of cancer tissue by fully integrated proteomics technology. Anal. Chem. 90, 5879–5886 (2018).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Bian, Y. et al. Ultra-deep tyrosine phosphoproteomics enabled by a phosphotyrosine superbinder. Nat. Chem. Biol. 12, 959–966 (2016).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Chu, B. et al. Photoaffinity-engineered protein scaffold for systematically exploring native phosphotyrosine signaling complexes in tumor samples. Proc. Natl Acad. Sci. USA 115, E8863–E8872 (2018).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Zhou, H. et al. Robust phosphoproteome enrichment using monodisperse microsphere-based immobilized titanium (IV) ion affinity chromatography. Nat. Protoc. 8, 461–480 (2013).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Tian, R. et al. Combinatorial proteomic analysis of intercellular signaling applied to the CD28 T-cell costimulatory receptor. Proc. Natl Acad. Sci. USA 112, E1594–E1603 (2015).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Huang, P., Li, H., Gao, W., Cai, Z. & Tian, R. A fully integrated spintip-based approach for sensitive and quantitative profiling of region-resolved in vivo brain glycoproteome. Anal. Chem. 91, 9181–9189 (2019).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Jedrychowski, M. P. et al. Detection and quantitation of circulating human irisin by tandem mass spectrometry. Cell Metab. 22, 734–740 (2015).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Bausch-Fluck, D. et al. The in silico human surfaceome. Proc. Natl Acad. Sci. USA 115, E10988–E10997 (2018).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Möller, S., Croning, M. D. & Apweiler, R. Evaluation of methods for the prediction of membrane spanning regions. Bioinformatics 17, 646–653 (2001).

    Article 
    PubMed 

    Google Scholar
     

  • Nielsen, H. Predicting secretory proteins with SignalP. Methods Mol. Biol. 1611, 59–73 (2017).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Käll, L., Krogh, A. & Sonnhammer, E. L. A combined transmembrane topology and signal peptide prediction method. J. Mol. Biol. 338, 1027–1036 (2004).

    Article 
    PubMed 

    Google Scholar
     

  • Ramilowski, J. A. et al. A draft network of ligand-receptor-mediated multicellular signalling in human. Nat. Commun. 6, 7866 (2015).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Graeber, T. G. & Eisenberg, D. Bioinformatic identification of potential autocrine signaling loops in cancers from gene expression profiles. Nat. Genet. 29, 295–300 (2001).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Sharman, J. L. et al. IUPHAR-DB: updated database content and new features. Nucleic Acids Res. 41, D1083–D1088 (2013).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Ben-Shlomo, I., Yu Hsu, S., Rauch, R., Kowalski, H. W. & Hsueh, A. J. Signaling receptome: a genomic and evolutionary perspective of plasma membrane receptors involved in signal transduction. Sci. STKE 2003, RE9 (2003).

    Article 
    PubMed 

    Google Scholar
     

  • Keshava Prasad, T. S. et al. Human Protein Reference Database—2009 update. Nucleic Acids Res. 37, D767–D772 (2009).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Szklarczyk, D. et al. The STRING database in 2021: customizable protein-protein networks, and functional characterization of user-uploaded gene/measurement sets. Nucleic Acids Res. 49, D605–D612 (2021).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Manning, G., Whyte, D. B., Martinez, R., Hunter, T. & Sudarsanam, S. The protein kinase complement of the human genome. Science 298, 1912–1934 (2002).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Lemmon, M. A. & Schlessinger, J. Cell signaling by receptor tyrosine kinases. Cell 141, 1117–1134 (2010).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Liu, B. A. et al. The human and mouse complement of SH2 domain proteins-establishing the boundaries of phosphotyrosine signaling. Mol. Cell 22, 851–868 (2006).

    Article 
    PubMed 

    Google Scholar
     

  • Wagner, M. J., Stacey, M. M., Liu, B. A. & Pawson, T. Molecular mechanisms of SH2- and PTB-domain-containing proteins in receptor tyrosine kinase signaling. Cold Spring Harb. Perspect. Biol. 5, a008987 (2013).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Uhlik, M. T. et al. Structural and evolutionary division of phosphotyrosine binding (PTB) domains. J. Mol. Biol. 345, 1–20 (2005).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Alonso, A. et al. Protein tyrosine phosphatases in the human genome. Cell 117, 699–711 (2004).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Pao, L. I., Badour, K., Siminovitch, K. A. & Neel, B. G. Nonreceptor protein-tyrosine phosphatases in immune cell signaling. Annu. Rev. Immunol. 25, 473–523 (2007).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Zielinska, D. F., Gnad, F., Wisniewski, J. R. & Mann, M. Precision mapping of an in vivo N-glycoproteome reveals rigid topological and sequence constraints. Cell 141, 897–907 (2010).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Tyanova, S., Temu, T. & Cox, J. The MaxQuant computational platform for mass spectrometry-based shotgun proteomics. Nat. Protoc. 11, 2301–2319 (2016).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Newman, A. M. et al. Determining cell type abundance and expression from bulk tissues with digital cytometry. Nat. Biotechnol. 37, 773–782 (2019).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Futschik, M. E. & Carlisle, B. Noise-robust soft clustering of gene expression time-course data. J. Bioinform. Comput. Biol. 3, 965–988 (2005).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Morello, A., Sadelain, M. & Adusumilli, P. S. Mesothelin-targeted CARs: driving T cells to solid tumors. Cancer Discov. 6, 133–146 (2016).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Liu, X. et al. A new panel of pancreatic cancer biomarkers discovered using a mass spectrometry-based pipeline. Br. J. Cancer 117, 1846–1854 (2017).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Fredriksson, L., Li, H. & Eriksson, U. The PDGF family: four gene products form five dimeric isoforms. Cytokine Growth Factor Rev. 15, 197–204 (2004).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Fu, C. et al. The transcription factor ZFHX3 is crucial for the angiogenic function of hypoxia-inducible factor 1α in liver cancer cells. J. Biol. Chem. 295, 7060–7074 (2020).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Zhu, S. et al. GDF15 promotes glioma stem cell-like phenotype via regulation of ERK1/2-c-Fos-LIF signaling. Cell Death Discov. 7, 3 (2021).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Bolte, S. & Cordelières, F. P. A guided tour into subcellular colocalization analysis in light microscopy. J. Microsc. 224, 213–232 (2006).

    Article 
    MathSciNet 
    CAS 
    PubMed 

    Google Scholar
     

  • Shi, X. et al. Integrated profiling of human pancreatic cancer organoids reveals chromatin accessibility features associated with drug sensitivity. Nat. Commun. 13, 2169 (2022).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Jaaks, P. et al. Effective drug combinations in breast, colon and pancreatic cancer cells. Nature 603, 166–173 (2022).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Liu, C. et al. Kindlin-2 enhances c-Myc translation through association with DDX3X to promote pancreatic ductal adenocarcinoma progression. Theranostics 13, 4333–4355 (2023).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Perez-Riverol, Y. et al. The PRIDE database resources in 2022: a hub for mass spectrometry-based proteomics evidences. Nucleic Acids Res. 50, D543–d552 (2022).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Matthews, M. L. et al. Chemoproteomic profiling and discovery of protein electrophiles in human cells. Nat. Chem. 9, 234–243 (2017).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Maurer, C. et al. Experimental microdissection enables functional harmonisation of pancreatic cancer subtypes. Gut 68, 1034–1043 (2019).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Elyada, E. et al. Cross-species single-cell analysis of pancreatic ductal adenocarcinoma reveals antigen-presenting cancer-associated fibroblasts. Cancer Discov. 9, 1102–1123 (2019).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Kim, J. et al. Detection of early pancreatic ductal adenocarcinoma with thrombospondin-2 and CA19-9 blood markers. Sci. Transl. Med. 9, eaah5583 (2017).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Cohen, J. D. et al. Detection and localization of surgically resectable cancers with a multi-analyte blood test. Science 359, 926–930 (2018).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Melo, S. A. et al. Glypican-1 identifies cancer exosomes and detects early pancreatic cancer. Nature 523, 177–182 (2015).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Seguin, L. et al. Galectin-3, a druggable vulnerability for KRAS-addicted cancers. Cancer Discov. 7, 1464–1479 (2017).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Jones, S. et al. Core signaling pathways in human pancreatic cancers revealed by global genomic analyses. Science 321, 1801–1806 (2008).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Makohon-Moore, A. & Iacobuzio-Donahue, C. A. Pancreatic cancer biology and genetics from an evolutionary perspective. Nat. Rev. Cancer 16, 553–565 (2016).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

[ad_2]

Source link

  • Colibactin-driven colon cancer requires adhesin-mediated epithelial binding

    Colibactin-driven colon cancer requires adhesin-mediated epithelial binding

    [ad_1]

  • Brennan, C. A. & Garrett, W. S. Fusobacterium nucleatum—symbiont, opportunist and oncobacterium. Nat. Rev. Microbiol. 17, 156–166 (2019).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Janney, A., Powrie, F. & Mann, E. H. Host-microbiota maladaptation in colorectal cancer. Nature 585, 509–517 (2020).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • O’Keefe, S. J. Diet, microorganisms and their metabolites, and colon cancer. Nat. Rev. Gastroenterol. Hepatol. 13, 691–706 (2016).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Tilg, H., Adolph, T. E., Gerner, R. R. & Moschen, A. R. The intestinal microbiota in colorectal cancer. Cancer Cell 33, 954–964 (2018).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Wong, S. H. & Yu, J. Gut microbiota in colorectal cancer: mechanisms of action and clinical applications. Nat. Rev. Gastroenterol. Hepatol. 16, 690–704 (2019).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Pleguezuelos-Manzano, C. et al. Mutational signature in colorectal cancer caused by genotoxic pks+ E. coli. Nature 580, 269–273 (2020).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Slowicka, K. et al. Zeb2 drives invasive and microbiota-dependent colon carcinoma. Nat. Cancer 1, 620–634 (2020).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Morgan, E. et al. Global burden of colorectal cancer in 2020 and 2040: incidence and mortality estimates from GLOBOCAN. Gut 72, 338–344 (2023).

    Article 
    PubMed 

    Google Scholar
     

  • Keum, N. & Giovannucci, E. Global burden of colorectal cancer: emerging trends, risk factors and prevention strategies. Nat. Rev. Gastroenterol. Hepatol. 16, 713–732 (2019).

    Article 
    PubMed 

    Google Scholar
     

  • GBD 2019 Colorectal Cancer Collaborators. The global, regional, and national burden of colorectal cancer and its attributable risk factors in 195 countries and territories, 1990–2017: a systematic analysis for the Global Burden of Disease Study 2017. Lancet Gastroenterol. Hepatol. 4, 913–933 (2019).

    Article 

    Google Scholar
     

  • Zepeda-Rivera, M. et al. A distinct Fusobacterium nucleatum clade dominates the colorectal cancer niche. Nature https://doi.org/10.1038/s41586-024-07182-w (2024).

  • Buc, E. et al. High prevalence of mucosa-associated E. coli producing cyclomodulin and genotoxin in colon cancer. PLoS ONE 8, e56964 (2013).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Arthur, J. C. et al. Microbial genomic analysis reveals the essential role of inflammation in bacteria-induced colorectal cancer. Nat. Commun. 5, 4724 (2014).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Dejea, C. M. et al. Patients with familial adenomatous polyposis harbor colonic biofilms containing tumorigenic bacteria. Science 359, 592–597 (2018).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Nougayrede, J. P. et al. Escherichia coli induces DNA double-strand breaks in eukaryotic cells. Science 313, 848–851 (2006).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Cuevas-Ramos, G. et al. Escherichia coli induces DNA damage in vivo and triggers genomic instability in mammalian cells. Proc. Natl Acad. Sci. USA 107, 11537–11542 (2010).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Rosendahl Huber, A. et al. Improved detection of colibactin-induced mutations by genotoxic E. coli in organoids and colorectal cancer. Cancer Cell 42, 487–496 (2024).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Cougnoux, A. et al. Bacterial genotoxin colibactin promotes colon tumour growth by inducing a senescence-associated secretory phenotype. Gut 63, 1932–1942 (2014).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Brugiroux, S. et al. Genome-guided design of a defined mouse microbiota that confers colonization resistance against Salmonella enterica serovar Typhimurium. Nat. Microbiol. 2, 16215 (2016).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Bonnet, M. et al. Colonization of the human gut by E. coli and colorectal cancer risk. Clin. Cancer Res. 20, 859–867 (2014).

    Article 
    PubMed 

    Google Scholar
     

  • Arthur, J. C. et al. Intestinal inflammation targets cancer-inducing activity of the microbiota. Science 338, 120–123 (2012).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Tomkovich, S. et al. Locoregional effects of microbiota in a preclinical model of colon carcinogenesis. Cancer Res. 77, 2620–2632 (2017).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Salesse, L. et al. Colibactin-producing Escherichia coli induce the formation of invasive carcinomas in a chronic inflammation-associated mouse model. Cancers 13, 2060 (2021).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Lucas, C. et al. Autophagy of intestinal epithelial cells inhibits colorectal carcinogenesis induced by colibactin-producing Escherichia coli in ApcMin/+ mice. Gastroenterology 158, 1373–1388 (2020).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Li, Z. R. et al. Divergent biosynthesis yields a cytotoxic aminomalonate-containing precolibactin. Nat. Chem. Biol. 12, 773–775 (2016).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Wernke, K. M. et al. Structure and bioactivity of colibactin. Bioorg. Med. Chem. Lett. 30, 127280 (2020).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Conover, M. S. et al. Inflammation-induced adhesin-receptor interaction provides a fitness advantage to uropathogenic E. coli during chronic infection. Cell Host Microbe 20, 482–492 (2016).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Jones, C. H. et al. FimH adhesin of type 1 pili is assembled into a fibrillar tip structure in the Enterobacteriaceae. Proc. Natl Acad. Sci. USA 92, 2081–2085 (1995).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Kalas, V. et al. Structure-based discovery of glycomimetic FmlH ligands as inhibitors of bacterial adhesion during urinary tract infection. Proc. Natl Acad. Sci. USA 115, E2819–E2828 (2018).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Maddirala, A. R. et al. Biphenyl Gal and GalNAc FmlH lectin antagonists of uropathogenic E. coli (UPEC): optimization through iterative rational drug design. J. Med. Chem. 62, 467–479 (2019).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Stentebjerg-Olesen, B., Chakraborty, T. & Klemm, P. Type 1 fimbriation and phase switching in a natural Escherichia coli fimB null strain, Nissle 1917. J. Bacteriol. 181, 7470–7478 (1999).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Dreux, N. et al. Point mutations in FimH adhesin of Crohn’s disease-associated adherent-invasive Escherichia coli enhance intestinal inflammatory response. PLoS Pathog. 9, e1003141 (2013).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Iebba, V. et al. Microevolution in fimH gene of mucosa-associated Escherichia coli strains isolated from pediatric patients with inflammatory bowel disease. Infect. Immun. 80, 1408–1417 (2012).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Schwartz, D. J. et al. Positively selected FimH residues enhance virulence during urinary tract infection by altering FimH conformation. Proc. Natl Acad. Sci. USA 110, 15530–15537 (2013).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Reinisch, W. et al. Safety, pharmacokinetic, and pharmacodynamic study of sibofimloc, a novel FimH blocker in patients with active Crohn’s disease. J. Gastroenterol. Hepatol. 37, 832–840 (2022).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Chevalier, G. et al. Blockage of bacterial FimH prevents mucosal inflammation associated with Crohn’s disease. Microbiome 9, 176 (2021).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Reuter, C., Alzheimer, M., Walles, H. & Oelschlaeger, T. A. An adherent mucus layer attenuates the genotoxic effect of colibactin. Cell Microbiol. https://doi.org/10.1111/cmi.12812 (2018).

  • Zhao, Z., Xu, S., Zhang, W., Wu, D. & Yang, G. Probiotic Escherichia coli NISSLE 1917 for inflammatory bowel disease applications. Food Funct. 13, 5914–5924 (2022).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Olier, M. et al. Genotoxicity of Escherichia coli Nissle 1917 strain cannot be dissociated from its probiotic activity. Gut Microbes 3, 501–509 (2012).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Giaffer, M. H., Holdsworth, C. D. & Duerden, B. I. Virulence properties of Escherichia coli strains isolated from patients with inflammatory bowel disease. Gut 33, 646–650 (1992).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Darfeuille-Michaud, A. et al. Presence of adherent Escherichia coli strains in ileal mucosa of patients with Crohn’s disease. Gastroenterology 115, 1405–1413 (1998).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Harnack, C. et al. Short-term mucosal disruption enables colibactin-producing E. coli to cause long-term perturbation of colonic homeostasis. Gut Microbes 15, 2233689 (2023).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • van der Post, S. et al. Structural weakening of the colonic mucus barrier is an early event in ulcerative colitis pathogenesis. Gut 68, 2142–2151 (2019).

    Article 
    PubMed 

    Google Scholar
     

  • Desai, M. S. et al. A dietary fiber-deprived gut microbiota degrades the colonic mucus barrier and enhances pathogen susceptibility. Cell 167, 1339–1353 (2016).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Dalmasso, G. et al. Colibactin-producing Escherichia coli enhance resistance to chemotherapeutic drugs by promoting epithelial to mesenchymal transition and cancer stem cell emergence. Gut Microbes 16, 2310215 (2024).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • de Oliveira Alves, N. et al. The colibactin-producing Escherichia coli alters the tumor microenvironment to immunosuppressive lipid overload facilitating colorectal cancer progression and chemoresistance. Gut Microbes 16, 2320291 (2024).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Volpe, M. R. et al. A small molecule inhibitor prevents gut bacterial genotoxin production. Nat. Chem. Biol. 19, 159–167 (2023).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Blanco-Miguez, A. et al. Targeted depletion of pks+ bacteria from a fecal microbiota using specific antibodies. mSystems 8, e0007923 (2023).

    Article 
    PubMed 

    Google Scholar
     

  • Gencay, Y. E. et al. Engineered phage with antibacterial CRISPR-Cas selectively reduce E. coli burden in mice. Nat. Biotechnol. https://doi.org/10.1038/s41587-023-01759-y (2023).

  • Spaulding, C. N. et al. Selective depletion of uropathogenic E. coli from the gut by a FimH antagonist. Nature 546, 528–532 (2017).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Greene, S. E., Hibbing, M. E., Janetka, J., Chen, S. L. & Hultgren, S. J. Human urine decreases function and expression of type 1 pili in uropathogenic Escherichia coli. mBio 6, e00820 (2015).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Datsenko, K. A. & Wanner, B. L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl Acad. Sci. USA 97, 6640–6645 (2000).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Ramesh, P., Kirov, A. B., Huels, D. J. & Medema, J. P. Isolation, propagation, and clonogenicity of intestinal stem cells. Methods Mol. Biol. 2002, 61–73 (2019).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Ewels, P., Magnusson, M., Lundin, S. & Kaller, M. MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics 32, 3047–3048 (2016).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Andrews, S. FastQC: a quality control tool for high throughput sequence data (2010).

  • Bolger, A. M., Lohse, M. & Usadel, B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30, 2114–2120 (2014).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Dobin, A. et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15–21 (2013).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Danecek, P. et al. Twelve years of SAMtools and BCFtools. Gigascience 10, giab008 (2021).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Liao, Y., Smyth, G. K. & Shi, W. The Subread aligner: fast, accurate and scalable read mapping by seed-and-vote. Nucleic Acids Res. 41, e108 (2013).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Love MI, A. S., Kim, V. & Huber, W. RNA-seq workflow: gene-level exploratory analysis and differential expression. F1000Research 4, 1070 (2016).

    Article 

    Google Scholar
     

  • Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15, 550 (2014).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Korotkevich, G. et al. Fast gene set enrichment analysis. Preprint at bioRxiv https://doi.org/10.1101/060012 (2019).

  • Stephens, M. False discovery rates: a new deal. Biostatistics 18, 275–294 (2017).

    MathSciNet 
    PubMed 

    Google Scholar
     

  • Hanzelmann, S., Castelo, R. & Guinney, J. GSVA: gene set variation analysis for microarray and RNA-seq data. BMC Bioinform. 14, 7 (2013).

    Article 

    Google Scholar
     

  • Kolde, R. Pheatmap: pretty heatmaps (2012).

  • Thakur, S. D., Obradovic, M., Dillon, J. R., Ng, S. H. & Wilson, H. L. Development of flow cytometry based adherence assay for Neisseria gonorrhoeae using 5′-carboxyfluorosceinsuccidyl ester. BMC Microbiol. 19, 67 (2019).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Martin, H. M. et al. Enhanced Escherichia coli adherence and invasion in Crohn’s disease and colon cancer. Gastroenterology 127, 80–93 (2004).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Wirth, T. et al. Sex and virulence in Escherichia coli: an evolutionary perspective. Mol. Microbiol. 60, 1136–1151 (2006).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Vizcaino, M. I., Engel, P., Trautman, E. & Crawford, J. M. Comparative metabolomics and structural characterizations illuminate colibactin pathway-dependent small molecules. J. Am. Chem. Soc. 136, 9244–9247 (2014).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • [ad_2]

    Source link

  • Tumour evolution and microenvironment interactions in 2D and 3D space

    Tumour evolution and microenvironment interactions in 2D and 3D space

    [ad_1]

    Experimental methods

    Specimens and sample processing

    All samples were collected with informed consent at the Washington University School of Medicine in St Louis. Samples from BRCA, PDAC, CRC, CHOL, RCC and UCEC were collected during surgical resection and verified by standard pathology (institutional review board protocols 201108117, 201411135 and 202106166). After verification, a 1.5 × 1.5 × 0.5 cm3 portion of the tumour was removed, photographed, weighed and measured. Each portion was then subdivided into 6–9 pieces and then further subdivided into 4 transverse-cut pieces. These four pieces were then each respectively placed into formalin, snap-frozen in liquid nitrogen, DMEM and snap-frozen before embedding in OCT. The purpose of choosing grid processing over punch sampling was utility-based, as it minimized remaining tissue. Relevant protocols can be found at protocols.io (https://doi.org/10.17504/protocols.io.bszynf7w)46.

    ST preparation and sequencing

    OCT-embedded tissue or FFPE tissue samples were sectioned and placed on a Visium Spatial Gene Expression Slide following the Visium Spatial Protocols–Tissue Preparation guide. Samples used for serial sections were sectioned and collected with an interval range from 5 to 100 μm. When doing serial sectioning, the first section was named as U1, followed by U2, U3, and so on. Selected sections were loaded onto Visium slides and the distance between each section was recorded. For OCT-embedded samples, detailed methods have been described in a previous publication10. In brief, fresh tissue samples were coated with room temperature OCT without any bubbles. After RNA quality check using a Tapestation and a morphology check using H&E staining for the OCT-embedded tissue samples, blocks were scored into a suitable size that fit the capture areas and then sectioned into 10-μm sections. Sections were then fixed in methanol, stained with H&E and imaged at ×20 magnification using the bright-field imaging setting on a Leica DMi8 microscope. Tissue samples were then permeabilized for 18 min and ST libraries were constructed following the Visium Spatial Gene Expression Reagent kits user guide CG000239 Rev A (10x Genomics). cDNA was reverse transcribed from the poly-adenylated messenger RNA, which was captured using primers on the slides. Next, the second strand was synthesized and denatured from the first strand. Free cDNA was then transferred from slides to tubes for further amplification and library construction. Libraries were sequenced on a S4 flow cell of an Illumina NovaSeq-6000 system. For FFPE samples, detailed methods have been described in a previous publication47. In brief, quality control was done by evaluating DV200 of RNA extracted from FFPE tissue sections per the Qiagen RNeasy FFPE Kit protocol, then followed by performing the Tissue Adhesion Test described in the 10x Genomics protocol. Sections (5 μm) were placed on a Visium Spatial Gene Expression Slide according to the Visium Spatial Protocols–Tissue Preparation guide (10x Genomics, CG000408 Rev A). After overnight drying, slides were incubated at 60 °C for 2 h. Deparaffinization was then performed following the protocol for Visium Spatial for FFPE–Deparaffinization, H&E staining, Imaging and Decrosslinking (10x Genomics, CG000409 Rev A). Sections were stained with H&E and imaged at ×20 magnification using the bright-field imaging setting on a Leica DMi8 microscope. Afterwards, decrosslinking was performed immediately for H&E stained sections. Next, human whole transcriptome probe panels were added to the tissue. After these probe pairs hybridized to their target genes and ligated to one another, the ligation products were released following RNase treatment and permeabilization. The ligated probes were then hybridized to the spatially barcoded oligonucleotides on the capture area. ST libraries were generated from the probes and sequenced on a S4 flow cell of an Illumina NovaSeq 6000 system. Relevant protocols can be found at protocols.io (https://doi.org/10.17504/protocols.io.x54v9d3opg3e/v1 and https://doi.org/10.17504/protocols.io.kxygx95ezg8j/v1)48,49.

    CODEX preparation and imaging

    Carrier-free monoclonal or polyclonal anti-human antibodies were purchased (Supplementary Table 3) and verified using immunofluorescence (IF) staining in multiple channels. After screening, antibodies were conjugated using an Akoya Antibody Conjugation kit (Akoya Biosciences, SKU 7000009) with a barcode (Akoya Biosciences) assigned according to the IF staining results. Several common markers were directly purchased through Akoya Biosciences. CODEX staining and imaging were performed according to the manufacturer’s instructions (CODEX user manual, Rev C). In brief, 5-μm FFPE sections were placed on coverslips coated with APTES (Sigma, 440140) and baked at 60 °C overnight before deparaffinization. The next day, tissues were incubated in xylene, rehydrated in ethanol and washed in ddH2O before antigen retrieval with TE buffer, pH 9 (Genemed, 10-0046) in boiling water for 10 min in a rice cooker. The tissue samples were then blocked using blocking buffer (CODEX staining kit, SKU 7000008) and stained with the marker antibody panel to a volume of 200 µl for 3 h at room temperature in a humidified chamber. The dilution factor for each antibody is provided in the CODEX cycle information sheet (Supplementary Table 3). Imaging of the CODEX multicycle experiment was performed using a Keyence fluorescence microscope (model BZ-X810) equipped with a Nikon CFI Plan Apo λ ×20/0.75 objective, a CODEX instrument (Akoya Biosciences) and a CODEX instrument manager (Akoya Biosciences). The raw images were then stitched and processed using the CODEX processor (Akoya Biosciences). After multiplex imaging was completed, H&E staining was performed on the same tissue. Staining quality for each antibody in CODEX is shown as a single channel in green with DAPI in blue in Supplementary Figs. 10 and 11.

    Single-nucleus suspension preparation

    Approximately 20–30 mg of flash-frozen or cryopulverized or 200 µm of OCT sections of tissue from each sample were retrieved and aliquoted for nucleus preparation for use in a Next GEM Single Cell Multiome ATAC + Gene Expression kit or a Next GEM Single Cell 3′ Kit v.3.1 kit. Samples were resuspended in lysis buffer (10 mM Tris-HCl (pH 7.4) (Thermo, 15567027), 10 mM NaCl (Thermo, AM9759), 3 mM MgCl2 (Thermo, AM9530G), 0.10% NP-40 substitute (% v/v) (Sigma, 74385-1L), 1 mM DTT (Sigma, 646563), 1% stock BSA solution (% v/v) (MACS, 130-091-376), nuclease-free water (Invitrogen, AM9937), plus 0.1 U µl–1 RNase inhibitor), resuspended and homogenized through douncing, and filtered through a 40-μm cell strainer (pluriSelect), then diluted with wash buffer (2% BSA, 1× PBS and RNase inhibitor). The filtrate was collected, then centrifuged at 500g for 6 min at 4 °C. The nuclear pellet was then resuspended in BSA wash buffer with RNase inhibitor, stained with 7AAD, and nuclei were purified and sorted by FACS. Relevant protocols can be found at protocols.io (https://doi.org/10.17504/protocols.io.14egn7w6zv5d/v1, https://doi.org/10.17504/protocols.io.261gednx7v47/v1)50,51.

    Single-cell suspension preparation

    Approximately 15–100 mg of each tumour was cut into small pieces using a blade. Enzymes and reagents from a Human Tumour Dissociation kit (Miltenyi Biotec, 130-095-929) were added to the tumour tissue along with 1.75 ml of DMEM. The resulting suspension was loaded into a gentleMACS C-tube (Miltenyi Biotec, 130-093-237) and subjected to the gentleMACS Octo Dissociator with Heaters (Miltenyi Biotec, 130-096-427). After 30–60 min on the heated dissociation programme (37h_TDK_1), samples were removed from the dissociator and filtered through a 40-μm mini strainer (PluriSelect, no. 43-10040-60) or a 40-μm nylon mesh (Fisher Scientific, 22-363-547) into a 15-ml conical tube on ice. The sample was then spun down at 400g for 5 min at 4 °C. After removing the supernatant, when a red pellet was visible, the cell pellet was resuspended using 200 μl to 3 ml ACK lysis solution (Thermo Fisher, A1049201) for 1–5 min. To quench the reaction, 10 ml PBS (Corning; 21-040-CM) with 0.5% BSA (Miltenyi Biotec; 130-091-376) was added and spun down at 400g for 5 min at 4 °C. After removing the supernatant, the cells were resuspended in 1 ml PBS with 0.5% BSA, and live and dead cells were visualized using trypan blue. Finally, the sample was spun down at 400g for 5 min at 4 °C and resuspended in 500 μl to 1 ml PBS with 0.5% BSA to a final concentration of 700–1,500 cells per μl. The protocol is available at protocols.io (https://doi.org/10.17504/protocols.io.bsnqnddw)52.

    Single-nucleus library preparation and sequencing

    Nuclei and cells and barcoded beads were isolated in oil droplets using a 10x Genomics Chromium instrument. Single-nucleus suspensions were counted and adjusted to a range of 500–1,800 nuclei per µl using a haemocytometer. Reverse transcription was subsequently performed to incorporate cell and transcript-specific barcodes. All snRNA-seq samples were run using a Chromium Next GEM Single Cell 3′ Library and Gel Bead kit v.3.1 (10x Genomics). For the multiome kit, Chromium Next GEM Single Cell Multiome ATAC + Gene Expression was used (10x Genomics). Nuclei were then subjected to downstream protocols by 10x (Next GEM Single Cell Multiome ATAC + Gene Expression: https://cdn.10xgenomics.com/image/upload/v1666737555/support-documents/CG000338_ChromiumNextGEM_Multiome_ATAC_GEX_User_Guide_RevF.pdf. Next GEM Single Cell 3′ Kit v3.1: https://support.10xgenomics.com/single-cell-gene-expression/library-prep/doc/user-guide-chromium-single-cell-3-reagent-kits-user-guide-v31-chemistry-dual-index). Single-cell suspensions were subject to the Next GEM Single Cell 3′ Kit v.3.1 protocol. Barcoded libraries were then pooled and sequenced on an Illumina NovaSeq 6000 system with associated flow cells.

    Genomic DNA extraction

    Tumour tissue samples were obtained from surgically resected specimens. After a piece was removed for fresh single-cell preparation, the remaining sample was snap-frozen in liquid nitrogen and stored at −80 °C. Before bulk DNA extraction, samples were cryopulverized (Covaris) and aliquoted for bulk extraction. Genomic DNA was extracted from tissue samples with either a DNeasy Blood and Tissue kit (Qiagen, 69504) or a QIAamp DNA Mini kit (Qiagen, 51304). Genomic germline DNA was purified from cryopreserved peripheral blood mononuclear cells using a QIAamp DNA Mini kit (Qiagen, 51304) according to the manufacturer’s instructions (Qiagen). The DNA quantity was assessed by fluorometry using a Qubit dsDNA HS assay (Q32854) according to the manufacturer’s instructions (Thermo Fisher Scientific). Protocols are available at protocols.io (https://doi.org/10.17504/protocols.io.bsnhndb6)53.

    WES analysis

    About 100–250 ng of genomic DNA was fragmented on a Covaris LE220 instrument targeting 250-bp inserts. Automated dual-indexed libraries were constructed using a KAPA Hyper library prep kit (Roche) on a SciClone NGS platform (Perkin Elmer). Up to ten libraries were pooled at an equimolar ratio by mass before the hybrid capture targeting a 5-µg library pool. The library pools were hybridized using xGen Exome Research Panel v.1.0 reagent (IDT Technologies), which spans a 39-Mb target region (19,396 genes) of the human genome. The libraries were hybridized for 16–18 h at 65 °C followed by a stringent wash to remove spuriously hybridized library fragments. Enriched library fragments were eluted and PCR cycle optimization was performed to prevent overamplification. The enriched libraries were amplified using KAPA HiFi master mix (Roche) before sequencing. The concentration of each captured library pool was determined through qPCR using a KAPA library Quantification kit according to the manufacturer’s protocol (Roche) to produce cluster counts appropriate for the Illumina NovaSeq-6000 instrument. Next, 2 × 150 paired-end reads were generated targeting 12 Gb of sequence to achieve around 100× coverage per library.

    Xenium library preparation and imaging

    Paraffin blocks (FFPE blocks) were sectioned at 5 μm and placed on Xenium slides following the FFPE Tissue Preparation guide (10x Genomics, CG000578, Rev B). Those slides underwent a series of xylene and ethanol washes for deparaffinization and decrosslinking, using the FFPE tissue enhancer as outlined (10x Genomics, CG000580, Rev B). Overnight in situ probe hybridization was performed using 379 probes from the Xenium Human Multi-Tissue Panel (10x Genomics, 1000626) plus an additional 100 custom probes (Supplementary Table 6). After hybridization probes were ligated, the sample underwent rolling circle amplification, and the background was quenched using an autofluorescence mixture. Nuclei were stained with DAPI to improve sample tracking and approximate cell boundaries (10x Genomics, CG000582, Rev D). These samples, along with buffers and decoding consumables, were loaded into a Xenium analyzer (10x Genomics, 1000481). The run was initialized using the guidance provided (10x Genomics, CG000584, Rev C). These fluorescent reporters hybridized to targeted complementary regions of the barcoded circularized cDNA were imaged. H&E staining was performed on the same region after the run was complete.

    Analytical methods

    Quantification and statistical analysis

    All data analyses were conducted in R and Python environments. Details of specific functions and libraries are provided in the relevant methods sections above. Significance was determined using the Wilcoxon rank-sum test, proportion test, hypergeometric test or Pearson correlation test, as appropriate. P values < 0.05 were considered significant. Details of statistical tests are provided in the figure legends and the relevant methods sections.

    WES data processing

    FASTQ files were preprocessed using trimGalore (v.0.6.7; with parameters: –length 36 and all other parameters set to default; https://github.com/FelixKrueger/TrimGalore). FASTQ files were then aligned to the GDC’s GRCh38 human reference genome (GRCh38.d1.vd1) using BWA-mem (v.0.7.17) with parameter -M and all others set to default. The output SAM file was converted to a BAM file using the samtools (https://github.com/samtools/samtools; v.1.14) view with parameters -Shb, and all others set to default. BAM files were sorted and duplicates were marked using Picard (v.2.6.26) SortSam tool with the following parameters: CREATE_INDEX=true, SORT_ORDER=coordinate, VALIDATION_STRINGENCY=STRICT, and all others set to default; and MarkDuplicates with parameter REMOVE_DUPLICATES=true, and all others set to default. The final BAM files were then indexed using the samtools (v.1.14) index with all parameters set to default.

    Mutation calling using WES

    Somatic mutations were called from WES data using the Somaticwrapper pipeline (v.2.2; https://github.com/ding-lab/somaticwrapper), which includes four different callers: Strelka (v.2.9.10)54, MUTECT (v.1.1.7)55, VarScan (v.2.3.8)56 and Pindel (v.0.2.5)57. We kept exonic single nucleotide variants (SNVs) called by any two callers among MUTECT (v.1.1.7), VarScan (v.2.3.8) and Strelka (v.2.9.10) and insertions and deletions (indels) called by any two callers among VarScan (v.2.3.8), Strelka (v.2.9.10) and Pindel (v.0.2.5). For the merged SNVs and indels, we applied a 14× and 8× minimal coverage cut-off for tumour and normal tissue, respectively. We also filtered SNVs and indels by a minimal VAF of 0.05 in tumours and a maximal VAF of 0.02 in normal samples. We also filtered any SNV within 10 bp of an indel found in the same tumour sample. Finally, we rescued the rare mutations with VAFs within 0.015 and 0.05 based on an established gene consensus list58,59. In a downstream step, we used Somaticwrapper to combine adjacent SNVs into double-nucleotide polymorphisms using COCOON (https://github.com/ding-lab/COCOONS), as reported in a previous study60.

    Mutation mapping to snRNA-seq and ST data

    We applied an in-house tool called scVarScan that can identify reads supporting the reference allele and variant allele covering the variant site in each cell by tracing cell and molecular barcode information in a snRNA-seq and single-cell RNA sequencing (scRNA-seq) or Visium bam file. The tool is freely available at GitHub (https://github.com/ding-lab/10Xmapping). For mapping, we used high-confidence somatic mutations from WES data produced by Somaticwrapper (described above). Visium reads were prefiltered with the flag ‘xf:i:25’ for reads contributing to unique molecular identifier counts.

    Spatial mutation VAF statistical test

    For each ST section, we applied two sets of statistical tests to all WES-based somatic mutations mapped to ST. First, for each mutation with greater than 30 reads of coverage on ST across all spots, the VAF was calculated for all tumour region spots and all non-tumour region spots as the number of variant reads across all spots divided by the number of total reads across all spots. A binomial test was then done using VAF of non-tumour spots as the background: binom.test(alterative=“greater”). Then, a proportion test was done between the VAFs in different spatial subclones with prop.test(alternative=“two.sided”). Finally, multiple testing correction was done on both sets of tests with the function p.adjust().

    CNV calling using WES

    Somatic CNVs were called using GATK (v.4.1.9.0)61. Specifically, the hg38 human reference genome (NCI GDC data portal) was binned into target intervals using the PreprocessIntervals function, with the bin length set to 1,000 bp and using the interval-merging-rule of OVERLAPPING_ONLY. A panel of normals was then generated using each normal sample as input and the GATK functions CollectReadCounts with the argument –interval-merging-rule OVERLAPPING_ONLY, followed by CreateReadCountPanelOfNormals with the argument –minimum-interval-median-percentile 5.0. For tumour samples, reads that overlapped the target interval were counted using the GATK function CollectReadCounts. Tumour read counts were then standardized and denoised using the GATK function DenoiseReadCounts, with the panel of normals specified by –count-panel-of-normals. Allelic counts for tumours were generated for variants present in the af-only-gnomad.hg38.vcf according to GATK best practices (variants further filtered to 0.2 > af > 0.01 and entries marked with ‘PASS’) using the GATK function CollectAllelicCounts. Segments were then modelled using the GATK function ModelSegments, with the denoised copy ratio and tumour allelic counts used as inputs. Copy ratios for segments were then called on the segment regions using the GATK function CallCopyRatioSegments.

    Bedtools62 intersection was used to map copy number ratios from segments to genes and to assign the called amplifications or deletions. For genes overlapping multiple segments, a custom Python script was used to call that gene as amplified, neutral or deleted based on a weighted copy number ratio calculated from the copy ratios of each overlapped segment, the lengths of the overlaps and the z score threshold used by the CallCopyRatioSegments function. If the resulting z score cut-off value was within the range of the default z score thresholds used by CallCopyRatioSegments (v.0.9,1.1), then the bounds of the default z score threshold were used instead (replicating the logic of the CallCopyRatioSegments function).

    ST data processing

    For each sample, we obtained the unfiltered feature–barcode matrix per sample by passing the demultiplexed FASTQ files and associated H&E image to Space Ranger (v.1.3.0, v.2.0.0 and v2.1.0 ‘count’ command using default parameters with reorient-images enabled) and the prebuilt GRCh38 genome reference 2020-A (GRCh38 and Ensembl 98). Seurat was used for all subsequent analyses. We constructed a Seurat object using the Load10X_Spatial function for every slide. Each slide was then scaled and normalized with the SCTransform function to correct for batch effects. Any merged analysis or subsequent subsetting of cells and samples for a sample with several slides underwent the same scaling and normalization method. Spots were clustered using the original Louvain algorithm, and the top 30 principal component analysis dimensions using the FindNeighbors and FindClusters functions as described in the ‘Analysis, visualization, and integration of spatial datasets with Seurat’ vignette from Seurat (https://satijalab.org/seurat/articles/spatial_vignette.html).

    InferCNV and CalicoST for CNV calling on Visium ST data

    To detect large-scale chromosomal CNVs using scRNA-seq, snRNA-seq and Visium data, InferCNV (v.1.10.1) was used with default parameters recommended for 10x Genomics data (https://github.com/broadinstitute/inferCNV). InferCNV was run at the sample level and only with post-quality control filtered data using the raw counts matrix. For snRNA-seq and scRNA-seq data, all non-malignant cells were used as a reference with the annotation ‘non-tumour’ and all malignant cells had the same annotation ‘tumour’, with the following parameters: analysis_mode=“subclusters”, –cluster_by_groups=T, –denoise=T, and –HMM=T. For Visium ST data, 200 spots annotated as ‘non-malignant’ with the lowest ESTIMATE purity score were used as a reference, and ‘malignant’ spots had their microregion ID as annotation, with the following parameters: window_length=151, analysis_mode=“sample”, –cluster_by_groups=T, –denoise=T, and –HMM=T. CalicoST (https://github.com/raphael-group/CalicoST)63 was run on Visium ST data with the same input annotation (microregion ID). All spots from the same microregions were treated as the smallest unit of analysis. CalicoST was then run with default parameters with results manually inspected.

    Copy number profile similarity score calculation

    To determine the similarity between two spatial CNV profiles, we use a modified Jaccard similarity score. A CNV profile was defined as a set of genomic windows with annotation copy number neutral (0), amplification (1) or deletion (−1). Two CNV profiles were then compared, and overlapping genomic windows were broken down so that both profiles had the same sets of windows (with the function reduced from the package GenomicRanges v.1.46.1). Then, the CNV similarity score (Sim) was defined as follows:

    $${{\rm{Sim}}}_{A,B}=\frac{\sum _{i}{\rm{size}}\left({w}_{i}\right)\times ({{\rm{CNV}}}_{A,i}\times {{\rm{CNV}}}_{B,i})}{\sum _{i}{\rm{size}}\left({w}_{i}\right)}$$

    where \({w}_{i}\) denotes the size of the genomic window i, \({{\rm{CNV}}}_{A,i}\) denotes the CNV annotation (0, 1 or –1) for profile A in genomic window i, and \({{\rm{CNV}}}_{B,i}\) denotes the CNV annotation for profile B in genomic window i across all genomic windows where either A or B is not CNV neutral.

    To determine the similarity between a spatial CNV profile and WES-based CNV (related to Extended Data Fig. 5a), we used a similarity score averaging the sensitivity (fraction of WES-based CNVs also detected in spatial CNVs) and specificity (fraction of spatial CNVs agreeing with WES-based CNVs). Specifically,

    $${{\rm{Sim}}}_{A,E}=\left(\frac{\sum _{a}{w}_{a}\times ({{\rm{CNV}}}_{A,a}\times {{\rm{CNV}}}_{E,a})}{\sum _{a}{w}_{a}}+\frac{\sum _{e}{w}_{e}\times ({{\rm{CNV}}}_{A,e}\times {{\rm{CNV}}}_{E,e})}{\sum _{e}{w}_{e}}\right)/2$$

    where \({w}_{a}\) denotes the size of the genomic window a from spatial CNV, \({w}_{e}\) denotes the size of the genomic window e from a WES-based CNV, \({{CNV}}_{A,a}\) denotes the CNV annotation (0, 1 or –1) for profile A in genomic window a.

    Spatial subclone identification based on CNV profile similarity

    In the OCT workflow (Supplementary Fig. 1a), CalicoST simultaneously identified CNVs and groups microregions into spatial subclones. In the FFPE workflow, confident spatial CNV events in each microregion were first selected by comparing them with matching WES. Then, a pairwise CNV similarity score was calculated across all tumour microregions. Finally, microregions were clustered with CNV similarity scores using the function hclust (d = 1-CNV similarity, method=“ward.D2”), and divided into clusters with function cutree (h = 0.8 × max(hclust$height)). Final subclone assignments were manually reviewed to avoid overclustering and to eliminate small outlier CNV profiles.

    Tumour microregion annotation and layer determination

    Using Visium ST, tumour microregions were determined through a multistep process using H&E. Each ST spot was assigned as either stroma or tumour by manually reviewing the morphology on H&E stained sections. If at least 50% of the pixels within a spot covered malignant cell morphology, the spot was labelled as tumour. Otherwise, it was labelled as stroma. Next, we defined distinct tumour microregions using a set of three rules. The first rule specified that tumour spots immediately adjacent to one another are initially marked as a single tumour microregion. The second rule states that if two distinct tumour regions together occupied at least 50% of one single spot, the spot is assigned to the distinct tumour region with the higher percentage occupied. Finally, the third rule specified that if there was a clear morphological difference of the tumour spots within one tumour microregion, the microregion must be separated into distinct microregions, one per clear morphology.

    Afterwards, we ran the Morph toolset (https://github.com/ding-lab/morph), which uses mathematical morphology to refine the tumour microregions. That is, if the total number of spots in a microregion is less than or equal to three, then we labelled all such spots as stroma. Last, Morph assigned the layer (for example, T1) of each spot of a tumour microregion by a sequence of mathematical morphology operations described in the Spot-depth correlation analysis method, which denotes the depth of a given spot inside a microregion.

    Average spot area and microregion size calculation

    To calculate the area each spot takes, we used the spot size (55 µm) and centre-to-centre distance between each spot (100 µm) provided by 10x Genomics (http://kb.10xgenomics.com/hc/en-us/articles/360035487572-What-is-the-spatial-resolution-and-configuration-of-the-capture-area-of-the-Visium-v1-Gene-Expression-Slide-). As illustrated in Supplementary Fig. 6, the Visium spots form a hexagonal lattice that covers the sample. The repeating unit of this lattice is a trapezoid shape centred at each spot’s centre that is composed of eight equilateral triangles. Each triangle has a side of 50 µm (half of the spot the centre-to-centre distance). Using the area equation of equilateral triangles and multiplying it by 8, we obtained the area of each trapezoid as 8,660 µm2, which is the average area occupied by each spot. To calculate the microregion size, we multiplied the spot count by 8,660 and divided by 106 to obtain the size in mm2.

    Micoregion density estimation

    We estimated microregion density per section by following the formula: density per µm2 = n microregion per section size (in spots) then divided by 8,660 µm per spot. Then density per mm2 = density per µm2 × 106 (n microregion per mm2).

    Cell-type annotation

    Cell-type assignment was done based on the following known markers: B cell, CD79A, CD79B, CD19, MS4A1, IGHD, CD22 and CD52; cDC1, CADM1, XCR1, CLEC9A, RAB32 and C1orf54; cDC2, CD1C, FCER1A, CLEC10A and CD1E; mregDC, LAMP3, CCR7, FSCN1, CD83 and CCL22; pDC, IL3RA, BCL11A, CLEC4C and NRP1; macrophage, CX3CR1, CD80, CD86, CD163 and MSR1; mast cell, HPGD, TPSB2, HDC, SLC18A2, CPA3 and SLC8A3; endothelial, EMCN, FLT1, PECAM1, VWF, PTPRB, ACTA2 and ANGPT2; fibroblast, COL1A1, COL3A1, COL5A1, LUM and MMP2; pericyte, RGS5, PLXDC1, FN1 and MCAM; NK cell, FCGR3A, GZMA and NCAM1; plasma cell, CD38, SDC1, IGHG1, IGKC and MZB1; T cell, IL7R, CD4, CD8A, CD8B, CD3G, CD3D and CD3E; and regulatory T cell, IL2RA, CTLA4, FOXP3, TNFRSF18 and IKZF2. Normal epithelial cells in the breast were annotated with the following markers: LumSec, GABRP, ELF5, CL28, KRT15, BARX2 and HS3ST4; LumHR, ANKRD30A, ERBB4, AFF3, TTC6, ESR1, NEK10 and XBP1; and basal, SAMD5, FBXO32, TP63, RBBP8 and KLHL13. Normal epithelial cells in the liver were annotated with the following markers: hepatocyte, ALB, CYP3A7, HMGCS1, ACSS2 and AKR1C1; cholangiocyte, SOX9, CFTR and PKD2. Normal epithelial cells in the pancreas, including ductal, acinar, islet-α, islet-β and islet-γ cells, were annotated with singleR (v.1.8.1) using reference data BaronPancreasData(‘human’).

    Spot-depth correlation analysis

    We identified a correlation between gene expression and spot depth in its tumour microregion. First, each spot was assigned a depth defined as the distance to the closest TME-facing spot in its tumour microregion. This depth was quantified in several layers through an iterative process whereby all the malignant spots immediately adjacent to non-malignant spots were considered layer 1, and then all malignant spots immediately adjacent to layer 1 were considered layer 2, and the process was repeated until all spots were assigned with a layer number. If a spot’s layer was larger than the smallest distance between the spot and any Visium border (including the edge of the Visium capture window, edge of the tissue section and any empty spots inside the section), then we excluded such spots, as we only knew the upper bound of the depth of this spot. Additionally, tumour microregions with fewer than 3 layers or 50 spots were excluded from the analysis. The distance between layers was taken as the centre-to-centre distance of Visium spots (100 µm).

    To give the same weight to bigger and smaller regions, the depth of each spot was further normalized by the maximum depth of the microregion this spot belonged. Then, we performed partial correlation tests independently between gene expression (at least 1 transcript detected from the gene in more than 50% of all spots) and normalized depth of each spot, with tumour purity as a covariate as follows:

    $${\rm{Expression}}={\rm{rho}}\times ({\rm{layer}}\;{\rm{fraction}})+b\times {\rm{purity}}$$

    where layer fraction is the layer number divided by the total number of layers in a tumour to normalize for large and small microregions, rho is the layer correlation coefficient, and b is the correlation coefficient for covariant purity. Purity was inferred with deconvolution when there was matching snRNA-seq data (deconvoluted tumour fraction per spot by RCTD), or with ESTIMATE (that is, tumour purity estimate score per spot) otherwise. Each gene was checked against a set of snRNA-seq-derived non-malignant gene lists to ensure that the change in fraction did not derive from a shift in cell type composition. Finally, we performed multiple-testing adjustments for all tests done in each ST section.

    Spot-depth GSEA pathway enrichment analysis

    To summarize biological programs enriched in the centre and periphery of tumour microregions across sections, we first obtained the cohort-level average layer correlation coefficient. If a test was not significant (P ≥ 0.05), rho was assigned to be 0 to indicate no correlation. If a test was not performed on a section (<50% of the spots have at least one transcript), rho was also assigned as 0. When a case had multiple sections, we first took the average rho across sections to avoid bias towards tumours with more sections. Then, the average of rho was calculated for each cohort (all samples or samples from each cancer type).

    In the same fashion, rank statistics were calculated for each test as –log10(P value) × rho for tests with P < 0.05. For tests with P ≥ 0.05 or genes not tested, the rank statistic was 0. We then calculated average rank statistics per case, followed by the average per cancer type. Finally, with the full list of rank statistics calculated for all genes tested, we used the function GSEA (parameters: pvalueCutoff=0.5; package: clusterProfiler v.3.18.1) to obtain the normalized enrichment score of Hallmark pathways (package: msigdbr 7.5.1) from the MSigDB64. Finally, only pathways with P < 0.1 were kept in the final results.

    Tumour intrinsic and non-tumour gene categorization

    We use differential expression and per cent expression filters, comparing expression among cell types in the matching snRNA-seq data to further characterize genes identified in the centre and periphery enriched analysis. The steps implemented in this workflow generated four categories: tumour-specific, stromal-specific, tumour-enriched and stromal-enriched (Supplementary Fig. 8a,b). Genes that did not pass the significant cutoff in any differential expression analysis were labelled separately as not DEG.

    To distinguish these four groups, we first performed differential gene analysis of cell types in the matching snRNA-seq data, filtered by a conventional significance cut-off (log2(fold change) > 0.5, adjusted P < 0.05, Bonferroni correction), to obtain DEGs (Supplementary Fig. 8a). Given the heterogeneity in tumours, certain tumour-specific genes might only exist in a subpopulation of tumours. Therefore, we first subclustered the tumour populations (using the Subcluster function in Seurat with a resolution of 0.5) to obtain tumour subclusters. We then compared each subcluster with all other non-tumour cells. A gene was considered a tumour DEG if at least one tumour subcluster showed significant expression compared with the non-tumour cells and vice versa for non-tumour DEGs (Supplementary Fig. 8a,b).

    For candidate tumour or stromal-specific genes, a DEG was designated as tumour-specific if it met both of the following criteria: (1) it is a DEG when compared with all non-tumour cell types from at least one tumour subcluster; and (2) its expression was <15% in all non-tumour cell types (Supplementary Fig. 8c).

    The reverse applied to candidate stromal-specific DEGs. If a DEG did not meet both of these requirements to be tumour or stromal specific, it was designated as either tumour-enriched or stromal-enriched based on whether the expression level was higher in tumour or stromal cell types (Supplementary Fig. 8a).

    Spatial subclone-specific treatment response analysis

    We focused on ten cases (comprising four BRCA, two CRC and four PDAC samples) with multiple spatial subclones for this analysis. To obtain subclone-specific DEGs, we used FindMarkers from the function in Seurat with the ‘wilcox’ test option DEGs between each subclone and TME. We then applied the cut-off for adjusted P < 0.01, average log2(fold change) > 1 and per cent expression in at least one cell type > 0.4 to select significant DEGs. To infer treatment response, we used the perturbation database LINCS L1000 (ref. 65), specifically the LINCS_L1000_Chem_Pert_down dataset from Enrichr66, to evaluate the gene set overlap between upregulated DEGs in spatial subclones and downregulated genes after compound treatment. To make the plot in Supplementary Fig. 4, we sorted the data by ‘Odd.Ratio’ and selected top compounds from each subclone. The corresponding compound metadata, including mechanism of action, was obtained from CLUE (clue.io, ‘Expanded CMap LINCS Resource 2020 Release’) to add annotation on the heatmap.

    Organ-specific gene blacklist for non-malignant cell types

    To distinguish transcripts originating from cancerous versus non-malignant stromal or immune cells, we used merged snRNA-seq data per organ (breast, kidney, liver and pancreas) for cell-type marker analysis. This analysis used the FindAllMarkers function in Seurat with the ‘wilcox’ test option. Subsequently, we refined the gene list by applying filters such as average log2(fold change) > 2, per cent expression in at least one cell type > 0.4 and adjusted P values < 0.01 to ensure robust marker selection for each cell type. The resultant gene list is available in Supplementary Table 5. This list was instrumental in excluding non-cancerous cell genes from analyses pertaining to cancer-specific expression patterns, such as pairwise microregion similarity analysis. Of note, during the analysis, we observed a notable mapping of various epithelial cell types in the snRNA-seq reference dataset for BRCA when using the RCTD deconvolution method. This observation probably stems from the diverse BRCA subtypes present in the cohort. To address this, we opted to combine all epithelial cell types into a single category during the identification of cell-type markers and excluded them from the blacklist. For tumours originating from organs other than the four mentioned above, we aggregated all genes present in the blacklist across organs to form a comprehensive multiorgan blacklist, which aided in filtering out non-cancerous transcripts.

    Microregion transcriptional profile analysis

    For overall tumour heterogeneity, we selected Morph-identified spots then ran ROGUE (v.1.0)67 to measure heterogeneity as 1-ROGUE. We then compared the transcriptional profiles of microregions by selecting the top 500 most variable features after excluding stroma regions in ST samples following Morph processing. Our initial evaluation involved conducting Pearson correlation tests for each pair of microregions, using a range of the top 250–1,500 most variable genes with increments of 250 (that is, 250, 500, 750, …, 1,500). We observed consistent correlations for nearly all values beyond using more than 500, which led us to select the top 500 genes for this analysis. This choice reduced the risk of selecting too few variable genes (for example, <250 most variable genes) while also avoiding the inclusion of numerous genes with minimal effect on the transcriptional profile. GSEA analysis was done using the function GSEA (parameters: pvalueCutoff = 0.5; package: clusterProfiler v.3.18.1) to obtain the normalized enrichment score of Hallmark pathways (package: msigdbr v.7.5.1) from the MSigDB64.

    Module score calculation

    Module scores on top of each heatmap in Extended Data Fig. 6 were calculated with the AddModuleScore function from Seurat68 using the genes listed in each heatmap. This score represents the average expression levels of a gene set. The score was calculated for each spot and a box plot was used to show the distribution of module scores in each microregion.

    ST cell-type decomposition

    Cell-type composition per spot was deconvolved using RCTD18 with default parameters and doublet_mode = ‘multi’. The reference for each run was the cell types manually annotated from the Seurat object of the matching snRNA-seq or Multiome sample. To quantify spatial distribution of each cell type, cell type fraction of 6 layers (T3 and above, T2, T1, E1, E2, E3 and above) from each tumour microregion is calculated and averaged in each sample. To compare differential TME infiltration between spatial subclones, cell type fraction from all spots between spatial subclones was compared with pairwise Wilcoxon rank-sum test and FDR adjustment.

    Spatial cell–cell interaction at tumour boundary

    We evaluated the spatial-based cell–cell interaction (CCI) in the ST sample using COMMOT69 with CellChat database and distance threshold of 1,000 µm, following the same threshold used in the original publication for Visium. The median sender and receiver signals for each interaction family were compared between all tumour boundary spots (including tumour boundary layer and TME boundary layer) and all non-boundary spots (Wilcoxon rank-sum test) on a sample. Interaction pathways with signal difference great than 0.1 and FDR less than 0.05 are considered significantly boundary-enriched. Boundary DEGs were identified with FindMarkers function on three sets of comparisons: boundary/tumour, boundary/TME and boundary/all non-boundary. A boundary DEG has adjusted P value 0.25 in boundary/non-boundary test, and log2(fold change) > 0 in the other two tests.

    Serial section alignment and branching factor calculation

    We applied PASTE2 (ref. 70), the updated ST-based alignment tool PASTE70, to enable partial image alignment. Serial sections of the same tumour piece were aligned pairwise with default settings. Each Visium data point in every ST section received new coordinates, denoted as x′ and y′, based on the alignment results. We then identified the nearest spot on each adjacent section for every spot, connecting them along the z axis. This process facilitated the linking of spots across all sections on the z axis. To assess whether one microregion was connected to another in an adjacent section, we first removed stromal spots and then counted the connected spots. If any microregion on one section connected to the next section with more than three shared spots, then we considered these two microregions, located on different sections, as connected in 3D space and forming the same tumour volume. This connection was labelled as volume 1, volume 2, and so forth in the figures (Fig. 5d,e and Extended Data Fig. 9a–d).

    We used two geometric metrics to describe tumour volume: connectivity and loop. For connectivity (degree), this metric quantifies the number of connections from an individual microregion to adjacent sections. For example, if microregion 2 in section 2 connects to 3 microregions in section 1 and 2 in section 3, its connectivity is 5. The maximum connectivity of a tumour volume is the highest connectivity among its microregions. For loop, this metric was calculated as the total number of connections minus the total number of microregions plus one, identifying intricate loop structures within the tumour volume.

    Registration of Visium, CODEX and H&E serial sections

    Before registration, imaging data underwent the following transformations. Multiplex images were converted to greyscale images of DAPI intensity. The image was then downscaled by a factor of 5 before key point selection. H&E images (also downsampled by a factor of 5) were used for keypoint selection with Visium data.

    For registration, we used BigWarp71, which was packaged in the Fiji/ImageJ software application. To register each collection of serial images, we used the first serial section as the fixed image and the second image as the moving image. After the second image was warped to the first image, the second image was used as the fixed image for the transformation of the third image. Key point registration proceeded in this fashion for all images in the serial section experiment. A total of 4–20 key points were selected per image transformation. Once key points were selected, a moving field was exported from BigWarp for each image transformation. This dense displacement field was then upscaled by a factor of 5 so it could be used to warp the full-resolution imaging data. The full-resolution dense displacement field was then used to register its corresponding multiplex or Visium data. The code used for registration is available at GitHub (https://github.com/ding-lab/mushroom/tree/subclone_submission).

    Neighbourhood identification input preprocessing

    Once imaging data were registered, they were processed in the following manner before model input.

    For Visium ST data, genes were limited to genes expressed in a minimum of 5% of spots across all serial sections and expression counts were log2 transformed. CODEX, Visium ST and H&E data were normalized by subtracting the mean expression and dividing by the standard deviation for each gene.

    Expression profiles for each patch were generated differently for image-native data (CODEX and H&E) and point-based data (Visium). Expressions for CODEX and H&E patches were calculated as the average pixel intensities for each image channel over all pixels within the patch bounds. Visium patches were calculated in largely the same manner; however, the expression profile of each spot within the patch was linearly weighted by its distance to the centre of the patch. This differential weight helped to account for variation expression due to the number of spots that fall within patch boundaries.

    Neighbourhood identification model architecture

    The neighbourhood annotation model consisted of an autoencoder with a vision transformer (ViT) backbone (Supplementary Fig. 7). In brief, an autoencoder is an unsupervised training method for which an encoder (embedding component) and a decoder (reconstruction component) work together to learn how input data are generated. Specifically, the network derives an approximation, Q, to the true posterior generating function, P, for the output, given the input. The autoencoder used was asymmetric, meaning that the encoder and decoder were not inverse copies of one another. The encoder consisted of a ViT with a similar architecture to previously described architectures72,73 (Supplementary Table 4).

    ViTs work on image tokens as input. In brief, image tokens are n-dimensional representations of patches of the input image. During training, image tiles were sampled from a uniform distribution across the set of input sections (Supplementary Fig. 7a). The sampled tile was then split into patches, for which the number of patches was determined by two hyperparameters: patch height (ph) and patch width (pw). Each patch was then flattened to a 1 × (ph × pw × c) vector, where c is the number of channels in the image (in the case of spatial transcriptomics data, c is the number of genes). The unrolled patches were then concatenated into a n × (ph × pw × c) matrix, where n is the number of patches in the image tile. Each row in this matrix is a token that represents a patch in the image tile. The tokens were then projected by a linear layer to shape n × d, where d is the dimension of the transformer blocks.

    After this, a slide token was concatenated to patch tokens. The slide token (representing the slide from which the image tile was selected) was indexed from a trainable embedding of size n_slides × d, where n_slides is the number of slides in the serial section experiment. The motivation for the slide token is that as it is passed through the transformer blocks, along with the patch tokens, information can be shared across all tokens, allowing the slide token to learn to attend to useful representations of the patches. This feature allowed the model to be more robust to batch effects between serial sections. Following the addition of the slide token, positional embeddings were added to all tokens and passed through the transformer blocks comprising the ViT encoder. All variables above and details of the transformer architecture are available in Supplementary Table 4.

    Once passed through the encoder, patches were represented as an embedding of size n × d. The next step of the architecture was neighbourhood assignment. Neighbourhoods were assigned to patches in a hierarchical manner, meaning that a patch was classified into several neighbourhoods that differed in level of specificity. For each level of the neighbourhood hierarchy, the subsequent levels comprised partitions of the previous levels’ neighbourhoods, that is, except for the first level, each neighbourhood was a subset of a neighbourhood in a previous level of the hierarchy. For this analysis, the model generated three levels of neighbourhoods, each with the capacity to discover up to n = 8 (level 1), n = 32 (level 2) and n = 64 (level 3) neighbourhoods, respectively. For this analysis, all neighbourhoods shown are neighbourhoods annotated at hierarchy level 3. The model contained three codebooks (one for each level) that are of size n_NBHDs × d, where n_NBHDs is the number of possible neighbourhoods that can be assigned for the given level. The patch embeddings output by the ViT encoder were projected by three independent blocks of linear layers (one for each level) that output each patch’s probability of assignment to a given neighbourhood. These probabilities were then used to retrieve neighbourhood embeddings from the codebook corresponding to the neighbourhood level. Three linear blocks (one for each level) were then used to independently reconstruct patch embeddings at each level to each patch’s original pixel values. The code used for training the model is available at GitHub (https://github.com/ding-lab/mushroom/tree/subclone_submission).

    Model loss function

    The overall loss function has two main contributions: mean squared error (MSE) on the reconstruction of the input patches, and cross-entropy loss on the encoded distribution and the normal distribution with 0 mean and 1.0 variance.

    During training, the autoencoder was simultaneously trying to optimize two main tasks: the reconstruction of the expression profile of each image patch embedding and the alignment of neighbourhood labels between adjacent sections. These two competing objectives forced the model to learn representative expression patterns while also keeping neighbourhoods aligned between input sections, which helped to combat neighbourhood differences due to batch effects. Differences in patch expression were quantified by MSE, whereas neighbourhood adjacency was enforced by minimizing the cross-entropy of patches adjacent to each other in the z direction during training.

    The overall loss function is defined below:

    $${{\bf{L}}}_{{\rm{o}}{\rm{v}}{\rm{e}}{\rm{r}}{\rm{a}}{\rm{l}}{\rm{l}}}={\lambda }_{{\rm{N}}{\rm{B}}{\rm{H}}{\rm{D}}}{{\bf{L}}}_{{\rm{N}}{\rm{B}}{\rm{H}}{\rm{D}}}+{\lambda }_{{\rm{M}}{\rm{S}}{\rm{E}}}{{\bf{L}}}_{{\rm{M}}{\rm{S}}{\rm{E}}}$$

    Where λNBHD (maximum of 0.01) and λMSE (set to 1.0) are scalers for the neighbourhood loss (LNBHD) and reconstruction loss (LMSE), respectively. During training, λNBHD for was linearly increased from 0 to its maximum value.

    Model training and inference

    Two separate runs of the model were trained for HT397B1 (six H&E, four CODEX and two Visium ST slides) and HT268B1 (four Visium ST slides). Training hyperparameters, such as batch size and number of training steps, are provided in Supplementary Table 4. For HT268B1, only one instance was trained because only one data type was present. For HT397B1, three model instances were trained (one for each data type) and were subsequently merged following the procedure described in the section ‘3D neighbourhood construction and integration’.

    Following training, the model inference was performed on overlapping image tiles for each slide using a sliding window of size 8 and a stride of 2 (that is, 2 overlapping patches between image tiles). The 2 × 2 centre patches of each tile were extracted and retiled to match the original slide orientation. Each reconstructed ‘patch embedding image’ was at a resolution of 50 pixels µm–1 (that is, each neighbourhood patch represents an area that is 50 µm wide) with the exception of Visium ST, for which the patch resolution was 100 pixels µm–1.

    3D neighbourhood construction and integration

    After the assignment of neighbourhoods for each section, slides were interpolated to generate a 3D neighbourhood volume. For this, we used linear interpolation of neighbourhood assignment probabilities with the torchio library74.

    Following interpolation, we also integrated neighbourhood volumes for HT397B1, for which multiple data-type-specific volumes were generated using a graph-based clustering approach. In brief, all overlapping neighbourhood voxel annotations were identified. A graph was then constructed, whereby nodes represented each neighbourhood partition combination, and edges are the distance (in the expression profile) between these partition combinations. This graph was then clustered with the Leiden graph clustering algorithm to identify integrated neighbourhoods. Hyperparameters for the above clustering process are provided in Supplementary Table 4. 3D neighbourhoods were displayed using the open-source visualization tool Napari (https://github.com/napari/napari).

    Analysis and quantification of 3D neighbourhoods

    Neighbourhoods were then assigned to Visium ST spots in the following manner. Each spot was assigned the neighbourhood label of the neighbourhood overlapping its spot centroid.

    To focus on neighbourhoods most related to the TME biology, we filtered out neighbourhoods with >50% overlap with copy number annotated subclones. Additionally, we excluded neighbourhoods that mapped to fewer than ten total spots across all ST sections for a sample.

    The subclone boundary region for tumour clones was defined as the union of the outermost layer of subclone annotated spots and the spots one layer expanded out from them, representing an area roughly 100–150 µm at the tumour–TME interface. Subclone-specific fractions were calculated as the neighbourhood overlaps with the outermost layer of each subclone.

    In HT397B1, DEGs were calculated for all neighbourhoods, not only those filtered for subclone overlap and spot count. The top 50 DEGs for neighbourhoods 4 and 6 were grouped into three categories: shared, unique to neighbourhood 4 and unique to neighbourhood 6. For the display in Fig. 5, the top 10 for each group were selected for display based on the following sorting criteria. The mean expression delta between neighbourhoods 4 and 6 was calculated for each gene by subtracting the mean expression in neighbourhood 6 from neighbourhood 4. Shared DEGs were ordered in ascending fashion based on the absolute expression delta of each gene. Genes unique to neighbourhood 4 and neighbourhood 6 were ordered by mean expression delta in descending and ascending fashion, respectively.

    Cell-type annotation of CODEX imaging data

    Our workflow for cell annotation consisted of four main steps: (1) image format conversion, (2) cell segmentation, (3) spatial feature generation and (4) cell-type classification. First, we converted image output by the CODEX platform (.qptiff) to the popular open-source OME-TIFF format. During this process, we also produced a separate image for each sample, as multiple sections of tissue are sometimes included on the same imaging run. We then used the Mesmer pre-trained nuclei + membrane segmentation model in the DeepCell framework75 to segment nuclei and whole cells. DAPI was used as the nuclei intensity image, and the channels pan-cytokeratin, HLA-DR, SMA, CD4, CD45, Hep-Par-1, CD31, E-cadherin, CD68 and CD3e were, for those present in a given image, mean-averaged to a single channel and used as the membrane intensity image.

    We then use a gating procedure to identify cell types. First, to combat differences in protein intensity distributions between imaging runs and tissue types, thresholds were manually set for all protein channels used during cell typing for each image by visual inspection. Above this intensity threshold, a pixel was considered positive for a given marker, and below it, a pixel was considered negative. We then used the cell segmentation boundaries from the previous step to calculate the fraction of positive pixels for all cell typing markers in each cell. The result of this process is a feature matrix (num cells × num proteins) representing positive marker fractions for each cell typing protein in every cell. A cell was considered positive for a marker if >5% of its pixels were positive for that marker. Cells were then labelled with a gating strategy specific to each sample. During gating, each cell was subjected to a series of AND gates, whereby if a cell passed all criteria for a given step, it was annotated as the cell type specified for that step, whereas if it failed the criteria it was passed on to the next downstream step in the gating strategy. The gating strategies used for the samples in this paper are presented in Supplementary Table 4.

    The following labels were the set of all possible cell type annotations: epithelial, CD4 T cell, CD8 T cell, regulatory T cell, T cell, macrophage, macrophage-M2, B cell, dendritic, immune, endothelial, fibroblast and hepatocyte. For some images, not all proteins required to gate a specific cell type were present. For example, CD4 was not in every image panel and available to use in the annotation of CD4 T cells. In these instances, the gating strategy was constructed such that cells can be labelled as more general cell types if specific proteins are not present (that is, labelled more broadly as T cell instead of CD4 T cell). If a cell was negative for all steps in the gating strategy, it was annotated as ‘unlabelled’. The code for image format conversion and cell segmentation can be found at GitHub (https://github.com/estorrs/multiplex-imaging-pipeline).

    Distance to tumour boundary quantification on CODEX

    After registration, Visium spots labelled as tumours were mapped to CODEX slides using the coordinates of the aligned images. The coordinates of the centre of each spot in the CODEX-aligned slide were the same as its Visium counterpart. Each spot in the CODEX-aligned slide occupied the area of a circle with a radius of 150 pixels. The Euclidean distance transforms in the CODEX-aligned slide were then calculated for each pixel using Python’s scipy.ndimage.distance_transform_edt. Both the distances from the microregions and within the microregions were calculated.

    3D tumour volume reconstruction and location quantification

    The surface mesh visualizations of the tumour volumes for HT397B1 and HT268B1 were generated using the following steps: (1) tumour neighbourhood selection, (2) mesh construction and (3) mesh colouring. First, integrated neighbourhoods with tumour metrics (described below) exceeding a given threshold were considered to be part of the tumour volume. In HT268B1, the metric used to quantify epithelial character was the fraction of subclone annotated Visium ST spots per neighbourhood. Neighbourhoods with >60% subclone spots were considered tumour. In HT397B1, we instead used the fraction of CODEX-annotated epithelial cells, as CODEX sections outnumbered the Visium ST sections for that sample. Neighbourhoods with >60% fraction of epithelial cells were considered tumour.

    A new volume was then constructed whereby neighbourhoods classified as tumour neighbourhoods using the above criteria were considered tumour-positive voxels, and all other voxels were tumour-negative. This 3D tumour mask was then smoothed with a Gaussian kernel (sigma = 1.0). The resulting values were then used as input for the marching cubes algorithm76,77 to generate a surface mesh for the tumour volume. We used the scikit-image implementation (skimage.measure.marching_cubes) of the marching cubes algorithm with default parameters.

    To colour the surface mesh, we generated 3D feature volumes (described below), and then coloured points on the surface mesh based on the voxel value at the corresponding location in the feature volume. A feature volume is a volume whereby each voxel in the volume describes some feature from the serial section dataset (for example, expression of a given gene, fraction of cells, and so on). Feature volumes used in this analysis were constructed in the following manner. First, in the serial sections for which a feature was applicable, the feature was binned at the same resolution as the 3D neighbourhoods (50 µm in this case). The binned feature was then interpolated in the z direction to fill in gaps between sections. The resulting volume was of the same shape as the integrated neighbourhood volume, for which the value of each voxel was the aggregated feature count for the voxel. For HT268B1, the features used were logged expression of TYMP1 and IGLC2. For HT397B1, we used fibroblast and immune cell fraction. Cells were annotated as described in the section ‘Cell-type annotation of CODEX imaging data’. The surface mesh was visualized using Napari (https://github.com/napari/napari) and contrast was adjusted on a volume-to-volume basis. We also visualized the HT397B1 tissue volume with the Imaris platform, for which we generated surfaces from the following CODEX markers: pan-cytokeratin (epithelial), CD45 (immune) and SMA (stromal).

    Xenium probe design

    Custom Xenium gene and mutation probes were designed using Xenium Panel Designer (https://cloud.10xgenomics.com/xenium-panel-designer) following instructions outlined in the ‘Getting Started with Xenium Panel Design’ instructions (https://www.10xgenomics.com/support/in-situ-gene-expression/documentation/steps/panel-design/xenium-panel-getting-started#design-tool). In brief, 21-bp sequences flanking the targeted transcribed variant site were curated from the Ensembl canonical transcript (Ensembl v.100). All four possible ligation junctions (two for the WT allele and two for the variant allele, three in the case of deletions—two for the WT allele and one for the variant allele) were then evaluated. Variant sites for which only non-preferred junctions (CG, GT, GG and GC) were available were excluded. The two bases of the ligation junction sequence were the last base of the RBD5 (RNA binding domain) and the first base of the RBD3 probe. Preferred junctions were always prioritized over neutral junctions unless a neutral junction was necessary to avoid hairpins, homopolymer regions, dimers or an unfavourable annealing temperature. Probe lengths for RBD5 and RBD3 were then adjusted from the 21-bp starting length to target a temperature between 50 °C and 70 °C per probe (overall target 68 °C and 82 °C). Variant sites with probes predicted to form dimers or hairpins by IDT’s oligo analyzer were excluded. Variant sites with homopolymer regions of five consecutive bases or more in either the RBD5 or RBD3 probes were excluded.

    Spatial expression deconvolution

    Here we used both deconvolution results and cell-type-specific expressions in the snRNA-seq data to deconvolve the Visium ST expression data (Supplementary Fig. 9). In brief, for a given Gene1, we first calculated the average expression of Gene1 per cell type in matched snRNA-seq data, subsequently filtering out the expression of such genes in cell types having <5% of the highest average expression, and then dividing each cell-type average expression from the sum of all average expressions, thereby creating the expression contribution per cell type matrix (Q). Then for a given spot, the contribution per cell type was multiplied by cell type proportion from the cell type devolution result (for example, RCTD), then normalized to 1 to give a final expression contribution matrix (WN). For instance, in Supplementary Fig. 9a, Gene1 has 40%, 30% and 30% contributions from respective cell types A, B and C based on the filtered snRNA-seq expression. For Spot1, as there is only 1 cell type, B, in the spot, 40% × 1/40% × 1 gives the final 100% contribution of Gene1 to cell type B in Spot1. Spot2 contains 50% A and B cell types, respectively, the normalized cell type contribution in spot 2 is therefore 50% × 40%/(50% × 40% + 50% × 30%) ≈ 57.1% for the cell type A, and 50%  × 30%/(50% × 40% + 50% × 30%) ≈ 42.9% for the cell type B. The final deconvolved expression was obtained by multiplying the original expression per spot (5 and 20 in Spot1 and Spot2) with the respective cell-type-based contribution to obtain the final deconvoluted expression values of Spot1 – cell type B = 5, Spot2 – cell type A ≈ 10.42, and Spot2 – cell type B ≈ 8.58.

    Reporting summary

    Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

    [ad_2]

    Source link

  • Transgelin 2 guards T cell lipid metabolism and antitumour function

    Transgelin 2 guards T cell lipid metabolism and antitumour function

    [ad_1]

  • Lim, S. A., Su, W., Chapman, N. M. & Chi, H. Lipid metabolism in T cell signaling and function. Nat. Chem. Biol. 18, 470–481 (2022).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Zhang, Y. et al. Enhancing CD8+ T cell fatty acid catabolism within a metabolically challenging tumor microenvironment increases the efficacy of melanoma immunotherapy. Cancer Cell 32, 377–391.e9 (2017).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Nava Lauson, C. B. et al. Linoleic acid potentiates CD8+ T cell metabolic fitness and antitumor immunity. Cell Metab. 35, 633–650.e639 (2023).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Pan, Y. et al. Survival of tissue-resident memory T cells requires exogenous lipid uptake and metabolism. Nature 543, 252–256 (2017).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Lin, R. et al. Fatty acid oxidation controls CD8+ tissue-resident memory T-cell survival in gastric adenocarcinoma. Cancer Immunol. Res. 8, 479–492 (2020).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Reinfeld, B. I. et al. Cell-programmed nutrient partitioning in the tumour microenvironment. Nature 593, 282–288 (2021).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Long, L. et al. CRISPR screens unveil signal hubs for nutrient licensing of T cell immunity. Nature 600, 308–313 (2021).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Fox, C. J., Hammerman, P. S. & Thompson, C. B. Fuel feeds function: energy metabolism and the T-cell response. Nat. Rev. Immunol. 5, 844–852 (2005).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Byersdorfer, C. A. et al. Effector T cells require fatty acid metabolism during murine graft-versus-host disease. Blood 122, 3230–3237 (2013).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Pearce, E. L. et al. Enhancing CD8 T-cell memory by modulating fatty acid metabolism. Nature 460, 103–107 (2009).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Jin, R. et al. Role of FABP5 in T cell lipid metabolism and function in the tumor microenvironment. Cancers 15, 657 (2023).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Liu, F. et al. Identification of FABP5 as an immunometabolic marker in human hepatocellular carcinoma. J. Immunother. Cancer 8, e000501 (2020).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Matulonis, U. A. et al. Ovarian cancer. Nat. Rev. Dis. Primers 2, 16061 (2016).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Matulonis, U. A. et al. Antitumor activity and safety of pembrolizumab in patients with advanced recurrent ovarian cancer: results from the phase II KEYNOTE-100 study. Ann. Oncol. 30, 1080–1087 (2019).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Kandalaft, L. E., Dangaj Laniti, D. & Coukos, G. Immunobiology of high-grade serous ovarian cancer: lessons for clinical translation. Nat. Rev. Cancer 22, 640–656 (2022).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Song, M. et al. IRE1α–XBP1 controls T cell function in ovarian cancer by regulating mitochondrial activity. Nature 562, 423–428 (2018).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Cao, Y. et al. ER stress-induced mediator C/EBP homologous protein thwarts effector T cell activity in tumors through T-bet repression. Nat. Commun. 10, 1280 (2019).

    Article 
    ADS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Anadon, C. M. et al. Ovarian cancer immunogenicity is governed by a narrow subset of progenitor tissue-resident memory T cells. Cancer Cell 40, 545–557.e13 (2022).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Bowtell, D. D. The genesis and evolution of high-grade serous ovarian cancer. Nat. Rev. Cancer 10, 803–808 (2010).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Digre, A. & Lindskog, C. The Human Protein Atlas—spatial localization of the human proteome in health and disease. Protein Sci. 30, 218–233 (2021).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Conejo-Garcia, J. R. et al. Tumor-infiltrating dendritic cell precursors recruited by a β-defensin contribute to vasculogenesis under the influence of Vegf-A. Nat. Med. 10, 950–958 (2004).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Chae, C. S. et al. Tumor-derived lysophosphatidic acid blunts protective type-I interferon responses in ovarian cancer. Cancer Discov. 12, 1904–1921 (2022).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Cubillos-Ruiz, J. R. et al. Reprogramming tumor-associated dendritic cells in vivo using miRNA mimetics triggers protective immunity against ovarian cancer. Cancer Res. 72, 1683–1693 (2012).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Cubillos-Ruiz, J. R. et al. Polyethylenimine-based siRNA nanocomplexes reprogram tumor-associated dendritic cells via TLR5 to elicit therapeutic antitumor immunity. J. Clin. Invest. 119, 2231–2244 (2009).

    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Cubillos-Ruiz, J. R. et al. ER stress sensor XBP1 controls anti-tumor immunity by disrupting dendritic cell homeostasis. Cell 161, 1527–1538 (2015).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Scarlett, U. K. et al. Ovarian cancer progression is controlled by phenotypic changes in dendritic cells. J. Exp. Med. 209, 495–506 (2012).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Szklarczyk, D. et al. The STRING database in 2021: customizable protein-protein networks, and functional characterization of user-uploaded gene/measurement sets. Nucleic Acids Res. 49, D605–D612 (2021).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Wan, C. H. et al. Panorama of ancient metazoan macromolecular complexes. Nature 525, 339–344 (2015).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Yin, L. M., Ulloa, L. & Yang, Y. Q. Transgelin-2: biochemical and clinical implications in cancer and asthma. Trends Biochem. Sci. 44, 885–896 (2019).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Jo, S., Kim, H. R., Mun, Y. & Jun, C. D. Transgelin-2 in immunity: Its implication in cell therapy. J. Leukoc. Biol. 104, 903–910 (2018).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Ortega, F. J. et al. Cytoskeletal transgelin 2 contributes to gender-dependent adipose tissue expandability and immune function. FASEB J. 33, 9656–9671 (2019).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Na, B. R. et al. TAGLN2 regulates T cell activation by stabilizing the actin cytoskeleton at the immunological synapse. J. Cell Biol. 209, 143–162 (2015).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Armstrong, E. H., Goswami, D., Griffin, P. R., Noy, N. & Ortlund, E. A. Structural basis for ligand regulation of the fatty acid-binding protein 5, peroxisome proliferator-activated receptor β/δ (FABP5-PPARβ/δ) signaling pathway. J. Biol. Chem. 289, 14941–14954 (2014).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Furuhashi, M. & Hotamisligil, G. S. Fatty acid-binding proteins: role in metabolic diseases and potential as drug targets. Nat. Rev. Drug Discovery 7, 489–503 (2008).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Fung, H. Y., Teryek, M., Lemenze, A. D. & Bergsbaken, T. CD103 fate mapping reveals that intestinal CD103 tissue-resident memory T cells are the primary responders to secondary infection. Sci. Immunol. 7, eabl9925 (2022).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Giles, J. R. et al. Shared and distinct biological circuits in effector, memory and exhausted CD8+ T cells revealed by temporal single-cell transcriptomics and epigenetics. Nat. Immunol. 23, 1600–1613 (2022).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Tirosh, I. et al. Dissecting the multicellular ecosystem of metastatic melanoma by single-cell RNA-seq. Science 352, 189–196 (2016).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Scott, A. C. et al. TOX is a critical regulator of tumour-specific T cell differentiation. Nature 571, 270–274 (2019).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Hetz, C., Zhang, K. & Kaufman, R. J. Mechanisms, regulation and functions of the unfolded protein response. Nat. Rev. Mol. Cell Biol. 21, 421–438 (2020).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Chen, X. & Cubillos-Ruiz, J. R. Endoplasmic reticulum stress signals in the tumour and its microenvironment. Nat. Rev. Cancer 21, 71–88 (2021).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Yoshida, H., Matsui, T., Yamamoto, A., Okada, T. & Mori, K. XBP1 mRNA is induced by ATF6 and spliced by IRE1 in response to ER stress to produce a highly active transcription factor. Cell 107, 881–891 (2001).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Logue, S. E. et al. Inhibition of IRE1 RNase activity modulates the tumor cell secretome and enhances response to chemotherapy. Nat. Commun. 9, 3267 (2018).

    Article 
    ADS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Morita, S. et al. Targeting ABL-IRE1α signaling spares ER-stressed pancreatic β cells to reverse autoimmune diabetes. Cell Metab. 25, 1207 (2017).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Di Conza, G., Ho, P. C., Cubillos-Ruiz, J. R. & Huang, S. C. Control of immune cell function by the unfolded protein response. Nat. Rev. Immunol. 23, 546–562 (2023).

    Article 
    PubMed 

    Google Scholar
     

  • Kim, H. R. et al. An essential role for TAGLN2 in phagocytosis of lipopolysaccharide-activated macrophages. Sci. Rep. 7, 8731 (2017).

    Article 
    ADS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Iyer, S. et al. Genetically defined syngeneic mouse models of ovarian cancer as tools for the discovery of combination immunotherapy. Cancer Discov. 11, 384–407 (2021).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Zhang, K. Y. et al. Longitudinal single-cell RNA-seq analysis reveals stress-promoted chemoresistance in metastatic ovarian cancer. Sci. Adv. 8, eabm1831 (2022).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Snaebjornsson, M. T., Janaki-Raman, S. & Schulze, A. Greasing the wheels of the cancer machine: the role of lipid metabolism in cancer. Cell Metab. 31, 62–76 (2020).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Shender, V. O. et al. Proteome–metabolome profiling of ovarian cancer ascites reveals novel components involved in intercellular communication. Mol. Cell. Proteomics 13, 3558–3571 (2014).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Perales-Puchalt, A. et al. Follicle-stimulating hormone receptor is expressed by most ovarian cancer subtypes and is a safe and effective immunotherapeutic target. Clin. Cancer Res. 23, 441–453 (2017).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Paffenholz, S. V. et al. Senescence induction dictates response to chemo- and immunotherapy in preclinical models of ovarian cancer. Proc. Natl Acad. Sci. USA 119, e2117754119 (2022).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Pramanik, J. et al. Genome-wide analyses reveal the IRE1a-XBP1 pathway promotes T helper cell differentiation by resolving secretory stress and accelerating proliferation. Genome Med. 10, 76 (2018).

  • Bogdan, D. M. et al. FABP5 deletion in nociceptors augments endocannabinoid signaling and suppresses TRPV1 sensitization and inflammatory pain. Sci. Rep. 12, 9241 (2022).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Lee, A. H., Scapa, E. F., Cohen, D. E. & Glimcher, L. H. Regulation of hepatic lipogenesis by the transcription factor XBP1. Science 320, 1492–1496 (2008).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Iwawaki, T., Akai, R., Yamanaka, S. & Kohno, K. Function of IRE1 alpha in the placenta is essential for placental development and embryonic viability. Proc. Natl Acad. Sci. USA 106, 16657–16662 (2009).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Chopra, S. et al. IRE1α–XBP1 signaling in leukocytes controls prostaglandin biosynthesis and pain. Science 365, eaau6499 (2019).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • de Boer, J. et al. Transgenic mice with hematopoietic and lymphoid specific expression of Cre. Eur. J. Immunol. 33, 314–325 (2003).

    Article 
    PubMed 

    Google Scholar
     

  • Roby, K. F. et al. Development of a syngeneic mouse model for events related to ovarian cancer. Carcinogenesis 21, 585–591 (2000).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Ichikawa, T. et al. Chemical fixation creates nanoscale clusters on the cell surface by aggregating membrane proteins. Commun. Biol. 5, 487 (2022).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Bolte, S. & Cordelieres, F. P. A guided tour into subcellular colocalization analysis in light microscopy. J. Microsc. 224, 213–232 (2006).

    Article 
    MathSciNet 
    CAS 
    PubMed 

    Google Scholar
     

  • Hao, Y. et al. Integrated analysis of multimodal single-cell data. Cell 184, 3573–3587.e29 (2021).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Xu, J. et al. Single-cell RNA sequencing reveals the tissue architecture in human high-grade serous ovarian cancer. Clin. Cancer Res. 28, 3590–3602 (2022).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Satija, R., Farrell, J. A., Gennert, D., Schier, A. F. & Regev, A. Spatial reconstruction of single-cell gene expression data. Nat. Biotechnol. 33, 495–502 (2015).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Zheng, L. et al. Pan-cancer single-cell landscape of tumor-infiltrating T cells. Science 374, abe6474 (2021).

    Article 
    PubMed 

    Google Scholar
     

  • Andreatta, M. et al. Interpretation of T cell states from single-cell transcriptomics data using reference atlases. Nat. Commun. 12, 2965 (2021).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Chu, Y. et al. Pan-cancer T cell atlas links a cellular stress response state to immunotherapy resistance. Nat. Med. 29, 1550–1562 (2023).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Khan, O. et al. TOX transcriptionally and epigenetically programs CD8+ T cell exhaustion. Nature 571, 211–218 (2019).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Wu, T. et al. clusterProfiler 4.0: a universal enrichment tool for interpreting omics data. Innovation 2, 100141 (2021).

    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • [ad_2]

    Source link

  • Neuronal substance P drives metastasis through an extracellular RNA–TLR7 axis

    [ad_1]

  • Ayala, G. E. et al. Cancer-related axonogenesis and neurogenesis in prostate cancer. Clin. Cancer Res. 14, 7593–7603 (2008).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Huang, D. et al. Nerve fibers in breast cancer tissues indicate aggressive tumor progression. Medicine 93, e172 (2014).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Oertel, H. Innervation and tumour growth: a preliminary report. Can. Med. Assoc. J. 18, 135–139 (1928).

    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Renz, B. W. et al. β2 adrenergic-neurotrophin feedforward loop promotes pancreatic cancer. Cancer Cell 34, 863–867 (2018).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Latil, A. et al. Quantification of expression of netrins, slits and their receptors in human prostate tumors. Int. J. Cancer 103, 306–315 (2003).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Osswald, M. et al. Brain tumour cells interconnect to a functional and resistant network. Nature 528, 93–98 (2015).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Venkatesh, H. S. et al. Neuronal activity promotes glioma growth through neuroligin-3 secretion. Cell 161, 803–816 (2015).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Venkatesh, H. S. et al. Electrical and synaptic integration of glioma into neural circuits. Nature 573, 539–545 (2019).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Zhao, C. M. et al. Denervation suppresses gastric tumorigenesis. Sci. Transl. Med. 6, 250ra115 (2014).

    Article 
    ADS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Magnon, C. et al. Autonomic nerve development contributes to prostate cancer progression. Science 341, 1236361 (2013).

    Article 
    PubMed 

    Google Scholar
     

  • Balood, M. et al. Nociceptor neurons affect cancer immunosurveillance. Nature 611, 405–412 (2022).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Globig, A. M. et al. The β1-adrenergic receptor links sympathetic nerves to T cell exhaustion. Nature 622, 383–392 (2023).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Gerendai, I. et al. Transneuronal labelling of nerve cells in the CNS of female rat from the mammary gland by viral tracing technique. Neuroscience 108, 103–118 (2001).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Hebb, C. & Linzell, J. L. Innervation of the mammary gland. A histochemical study in the rabbit. Histochem. J. 2, 491–505 (1970).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Tavora, B. et al. Tumoural activation of TLR3–SLIT2 axis in endothelium drives metastasis. Nature 586, 299–304 (2020).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Brose, K. et al. Slit proteins bind Robo receptors and have an evolutionarily conserved role in repulsive axon guidance. Cell 96, 795–806 (1999).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Nguyen-Ngoc, K. V. et al. ECM microenvironment regulates collective migration and local dissemination in normal and malignant mammary epithelium. Proc. Natl Acad. Sci. USA 109, E2595–E2604 (2012).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Aslakson, C. J. & Miller, F. R. Selective events in the metastatic process defined by analysis of the sequential dissemination of subpopulations of a mouse mammary tumor. Cancer Res. 52, 1399–1405 (1992).

    CAS 
    PubMed 

    Google Scholar
     

  • Bujak, J. K., Kosmala, D., Szopa, I. M., Majchrzak, K. & Bednarczyk, P. Inflammation, cancer and immunity-implication of TRPV1 channel. Front. Oncol. 9, 1087 (2019).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Liebig, C., Ayala, G., Wilks, J. A., Berger, D. H. & Albo, D. Perineural invasion in cancer: a review of the literature. Cancer 115, 3379–3391 (2009).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Kastin, A. Handbook of Biologically Active Peptides (Academic, 2013).

  • Otsuka, M. & Konishi, S. Release of substance P-like immunoreactivity from isolated spinal cord of newborn rat. Nature 264, 83–84 (1976).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Eshete, F. & Fields, R. D. Spike frequency decoding and autonomous activation of Ca2+-calmodulin-dependent protein kinase II in dorsal root ganglion neurons. J. Neurosci. 21, 6694–6705 (2001).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Nishikawa, S. et al. Two histidine residues are essential for ribonuclease T1 activity as is the case for ribonuclease A. Biochemistry 26, 8620–8624 (1987).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Robertson, H. D., Webster, R. E. & Zinder, N. D. Purification and properties of ribonuclease III from Escherichia coli. J. Biol. Chem. 243, 82–91 (1968).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Bremnes, R. M., Sirera, R. & Camps, C. Circulating tumour-derived DNA and RNA markers in blood: a tool for early detection, diagnostics, and follow-up? Lung Cancer 49, 1–12 (2005).

    Article 
    PubMed 

    Google Scholar
     

  • Huang, W. et al. Site-specific RNase A activity was dramatically reduced in serum from multiple types of cancer patients. PLoS ONE 9, e96490 (2014).

    Article 
    ADS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • De Lamirande, G. Action of deoxyribonuclease and ribonuclease on the growth of Ehrlich ascites carcinoma in mice. Nature 192, 52–54 (1961).

    Article 
    ADS 
    PubMed 

    Google Scholar
     

  • Ledoux, L. Action of ribonuclease on two solid tumours in vivo. Nature 176, 36–37 (1955).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Lund, J. M. et al. Recognition of single-stranded RNA viruses by Toll-like receptor 7. Proc. Natl Acad. Sci. USA 101, 5598–5603 (2004).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Kawasaki, T. & Kawai, T. Toll-like receptor signaling pathways. Front. Immunol. 5, 461 (2014).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Ojaniemi, M. et al. Phosphatidylinositol 3-kinase is involved in Toll-like receptor 4-mediated cytokine expression in mouse macrophages. Eur. J. Immunol. 33, 597–605 (2003).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Ha, T. et al. TLR2 ligands induce cardioprotection against ischaemia/reperfusion injury through a PI3K/Akt-dependent mechanism. Cardiovasc. Res. 87, 694–703 (2010).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Hesketh, P. J. et al. The oral neurokinin-1 antagonist aprepitant for the prevention of chemotherapy-induced nausea and vomiting: a multinational, randomized, double-blind, placebo-controlled trial in patients receiving high-dose cisplatin-the Aprepitant Protocol 052 Study Group. J. Clin. Oncol. 21, 4112–4119 (2003).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Rosso, M., Robles-Frias, M. J., Covenas, R., Salinas-Martin, M. V. & Munoz, M. The NK-1 receptor is expressed in human primary gastric and colon adenocarcinomas and is involved in the antitumor action of L-733,060 and the mitogenic action of substance P on human gastrointestinal cancer cell lines. Tumour Biol. 29, 245–254 (2008).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Munoz, M. & Rosso, M. The NK-1 receptor antagonist aprepitant as a broad spectrum antitumor drug. Invest. N. Drugs 28, 187–193 (2010).

    Article 
    CAS 

    Google Scholar
     

  • Nagakawa, O. et al. Effect of prostatic neuropeptides on invasion and migration of PC-3 prostate cancer cells. Cancer Lett. 133, 27–33 (1998).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Nizam, E. & Erin, N. Differential consequences of neurokinin receptor 1 and 2 antagonists in metastatic breast carcinoma cells; effects independent of substance P. Biomed. Pharmacother. 108, 263–270 (2018).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Le, T. T. et al. Sensory nerves enhance triple-negative breast cancer invasion and metastasis via the axon guidance molecule PlexinB3. NPJ Breast Cancer 8, 116 (2022).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Austin, M., Elliott, L., Nicolaou, N., Grabowska, A. & Hulse, R. P. Breast cancer induced nociceptor aberrant growth and collateral sensory axonal branching. Oncotarget 8, 76606–76621 (2017).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Jurcak, N. R. et al. Axon guidance molecules promote perineural invasion and metastasis of orthotopic pancreatic tumors in mice. Gastroenterology 157, 838–850 (2019).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Kamiya, A. et al. Genetic manipulation of autonomic nerve fiber innervation and activity and its effect on breast cancer progression. Nat. Neurosci. 22, 1289–1305 (2019).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Zahalka, A. H. et al. Adrenergic nerves activate an angio-metabolic switch in prostate cancer. Science 358, 321–326 (2017).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Partecke, L. I. et al. Subdiaphragmatic vagotomy promotes tumor growth and reduces survival via TNFα in a murine pancreatic cancer model. Oncotarget 8, 22501–22512 (2017).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Renz, B. W. et al. Cholinergic signaling via muscarinic receptors directly and indirectly suppresses pancreatic tumorigenesis and cancer stemness. Cancer Discov. 8, 1458–1473 (2018).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Boilly, B., Faulkner, S., Jobling, P. & Hondermarck, H. Nerve dependence: from regeneration to cancer. Cancer Cell 31, 342–354 (2017).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Amit, M. et al. Loss of p53 drives neuron reprogramming in head and neck cancer. Nature 578, 449–454 (2020).

  • Kalinichenko, V. V., Mokyr, M. B., Graf, L. H. Jr, Cohen, R. L. & Chambers, D. A. Norepinephrine-mediated inhibition of antitumor cytotoxic T lymphocyte generation involves a β-adrenergic receptor mechanism and decreased TNF-α gene expression. J. Immunol. 163, 2492–2499 (1999).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Mohammadpour, H. et al. β2 adrenergic receptor-mediated signaling regulates the immunosuppressive potential of myeloid-derived suppressor cells. J. Clin. Invest. 129, 5537–5552 (2019).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Benci, J. L. et al. Opposing functions of interferon coordinate adaptive and innate immune responses to cancer immune checkpoint blockade. Cell 178, 933–948 (2019).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Cao, Y. Q. et al. Primary afferent tachykinins are required to experience moderate to intense pain. Nature 392, 390–394 (1998).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Wang, Y. et al. Ephrin-B2 controls VEGF-induced angiogenesis and lymphangiogenesis. Nature 465, 483–486 (2010).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Guy, C. T., Cardiff, R. D. & Muller, W. J. Induction of mammary tumors by expression of polyomavirus middle T oncogene: a transgenic mouse model for metastatic disease. Mol. Cell. Biol. 12, 954–961 (1992).

    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Maroulakou, I. G., Anver, M., Garrett, L. & Green, J. E. Prostate and mammary adenocarcinoma in transgenic mice carrying a rat C3(1) simian virus 40 large tumor antigen fusion gene. Proc. Natl Acad. Sci. USA 91, 11236–11240 (1994).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Hale, J. J. et al. Structural optimization affording 2-(R)-(1-(R)-3, 5-bis(trifluoromethyl)phenylethoxy)-3-(S)-(4-fluoro)phenyl-4- (3-oxo-1,2,4-triazol-5-yl)methylmorpholine, a potent, orally active, long-acting morpholine acetal human NK-1 receptor antagonist. J. Med. Chem. 41, 4607–4614 (1998).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Padmanaban, V. et al. Organotypic culture assays for murine and human primary and metastatic-site tumors. Nat. Protoc. 15, 2413–2442 (2020).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Young, L., Sung, J., Stacey, G. & Masters, J. R. Detection of Mycoplasma in cell cultures. Nat. Protoc. 5, 929–934 (2010).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Foty, R. A simple hanging drop cell culture protocol for generation of 3D spheroids. J. Vis. Exp. https://doi.org/10.3791/2720 (2011).

  • Heil, F. et al. Species-specific recognition of single-stranded RNA via Toll-like receptor 7 and 8. Science 303, 1526–1529 (2004).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Alexopoulou, L., Holt, A. C., Medzhitov, R. & Flavell, R. A. Recognition of double-stranded RNA and activation of NF-κB by Toll-like receptor 3. Nature 413, 732–738 (2001).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Hemmi, H. et al. Small anti-viral compounds activate immune cells via the TLR7 MyD88-dependent signaling pathway. Nat. Immunol. 3, 196–200 (2002).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Jurk, M. et al. Human TLR7 or TLR8 independently confer responsiveness to the antiviral compound R-848. Nat. Immunol. 3, 499 (2002).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Maira, S. M. et al. Identification and characterization of NVP-BKM120, an orally available pan-class I PI3-kinase inhibitor. Mol. Cancer Ther. 11, 317–328 (2012).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Davies, B. R. et al. Preclinical pharmacology of AZD5363, an inhibitor of AKT: pharmacodynamics, antitumor activity, and correlation of monotherapy activity with genetic background. Mol. Cancer Ther. 11, 873–887 (2012).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Folkes, A. J. et al. The identification of 2-(1H-indazol-4-yl)-6-(4-methanesulfonyl-piperazin-1-ylmethyl)-4-morpholin-4-yl-thieno[3,2-d]pyrimidine (GDC-0941) as a potent, selective, orally bioavailable inhibitor of class I PI3 kinase for the treatment of cancer. J. Med. Chem. 51, 5522–5532 (2008).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Padmanaban, V. et al. E-cadherin is required for metastasis in multiple models of breast cancer. Nature 573, 439–444 (2019).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Krause, S., Brock, A. & Ingber, D. E. Intraductal injection for localized drug delivery to the mouse mammary gland. J. Vis. Exp. https://doi.org/10.3791/50692 (2013).

  • Jancso, G., Kiraly, E., Such, G., Joo, F. & Nagy, A. Neurotoxic effect of capsaicin in mammals. Acta Physiol. Hung. 69, 295–313 (1987).

    CAS 
    PubMed 

    Google Scholar
     

  • Chi, J. et al. Three-dimensional adipose tissue imaging reveals regional variation in beige fat biogenesis and PRDM16-dependent sympathetic neurite density. Cell Metab. 27, 226–236 (2018).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Luppi, P. H., Fort, P. & Jouvet, M. Iontophoretic application of unconjugated cholera toxin B subunit (CTb) combined with immunohistochemistry of neurochemical substances: a method for transmitter identification of retrogradely labeled neurons. Brain Res. 534, 209–224 (1990).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Gee, K. R. et al. Chemical and physiological characterization of fluo-4 Ca2+-indicator dyes. Cell Calcium 27, 97–106 (2000).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Curtis, C. et al. The genomic and transcriptomic architecture of 2,000 breast tumours reveals novel subgroups. Nature 486, 346–352 (2012).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • [ad_2]

    Source link

  • Histone serotonylation regulates ependymoma tumorigenesis

    [ad_1]

  • Mancusi, R. & Monje, M. The neuroscience of cancer. Nature 618, 467–479 (2023).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Winkler, F. et al. Cancer neuroscience: state of the field, emerging directions. Cell 186, 1689–1707 (2023).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Hanahan, D. Hallmarks of cancer: new dimensions. Cancer Discov. 12, 31–46 (2022).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Mack, S. C. et al. Epigenomic alterations define lethal CIMP-positive ependymomas of infancy. Nature 506, 445–450 (2014).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Zhao, S. et al. Epigenetic alterations of repeated relapses in patient-matched childhood ependymomas. Nat. Commun. 13, 6689 (2022).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Ng, C. H. et al. A multi-institutional retrospective pooled outcome analysis of molecularly annotated pediatric supratentorial ZFTA-fused ependymoma. Neurooncol. Adv. 5, vdad057 (2023).

    PubMed 
    PubMed Central 

    Google Scholar
     

  • Pajtler, K. W. et al. Molecular classification of ependymal tumors across all CNS compartments, histopathological grades, and age groups. Cancer Cell 27, 728–743 (2015).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Parker, M. et al. C11orf95–RELA fusions drive oncogenic NF-κB signalling in ependymoma. Nature 506, 451–455 (2014).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Grobner, S. N. et al. The landscape of genomic alterations across childhood cancers. Nature 555, 321–327 (2018).

    Article 
    ADS 
    PubMed 

    Google Scholar
     

  • Mack, S. C. et al. Therapeutic targeting of ependymoma as informed by oncogenic enhancer profiling. Nature 553, 101–105 (2018).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Arabzade, A. et al. ZFTA-RELA dictates oncogenic transcriptional programs to drive aggressive supratentorial ependymoma. Cancer Discov. 11, 2200–2215 (2021).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Kupp, R. et al. ZFTA translocations constitute ependymoma chromatin remodeling and transcription factors. Cancer Discov. 11, 2216–2229 (2021).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Ozawa, T. et al. A de novo mouse model of C11orf95–RELA fusion-driven ependymoma identifies driver functions in addition to NF-κB. Cell Rep. 23, 3787–3797 (2018).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Ozawa, T. et al. C11orf95–RELA fusion drives aberrant gene expression through the unique epigenetic regulation for ependymoma formation. Acta Neuropathol. Commun. 9, 36 (2021).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Farrelly, L. A. et al. Histone serotonylation is a permissive modification that enhances TFIID binding to H3K4me3. Nature 567, 535–539 (2019).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Sardar, D. et al. Induction of astrocytic Slc22a3 regulates sensory processing through histone serotonylation. Science 380, eade0027 (2023).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Chen, P. et al. Olfactory sensory experience regulates gliomagenesis via neuronal IGF1. Nature 606, 550–556 (2022).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Curry, R. N. et al. Glioma epileptiform activity and progression are driven by IGSF3-mediated potassium dysregulation. Neuron 111, 682–695 (2023).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Huang-Hobbs, E. et al. Remote neuronal activity drives glioma progression through SEMA4F. Nature 619, 844–850 (2023).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Krishna, S. et al. Glioblastoma remodelling of human neural circuits decreases survival. Nature 617, 599–607 (2023).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Pan, Y. et al. NF1 mutation drives neuronal activity-dependent initiation of optic glioma. Nature 594, 277–282 (2021).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Venkatesh, H. S. et al. Neuronal activity promotes glioma growth through neuroligin-3 secretion. Cell 161, 803–816 (2015).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Yu, K. et al. PIK3CA variants selectively initiate brain hyperactivity during gliomagenesis. Nature 578, 166–171 (2020).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Venkataramani, V. et al. Glutamatergic synaptic input to glioma cells drives brain tumour progression. Nature 573, 532–538 (2019).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Venkatesh, H. S. et al. Electrical and synaptic integration of glioma into neural circuits. Nature 573, 539–545 (2019).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Roth, B. L. DREADDs for neuroscientists. Neuron 89, 683–694 (2016).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Luo, M., Zhou, J. & Liu, Z. Reward processing by the dorsal raphe nucleus: 5-HT and beyond. Learn. Mem. 22, 452–460 (2015).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Steinbusch, H. W. M., Dolatkhah, M. A. & Hopkins, D. A. Anatomical and neurochemical organization of the serotonergic system in the mammalian brain and in particular the involvement of the dorsal raphe nucleus in relation to neurological diseases. Prog. Brain Res. 261, 41–81 (2021).

    Article 
    PubMed 

    Google Scholar
     

  • Baraban, S. C., Hollopeter, G., Erickson, J. C., Schwartzkroin, P. A. & Palmiter, R. D. Knock-out mice reveal a critical antiepileptic role for neuropeptide Y. J. Neurosci. 17, 8927–8936 (1997).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Levine, A. S. & Morley, J. E. Neuropeptide Y: a potent inducer of consummatory behavior in rats. Peptides 5, 1025–1029 (1984).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Powell, K. L. et al. Gene therapy mediated seizure suppression in genetic generalised epilepsy: neuropeptide Y overexpression in a rat model. Neurobiol. Dis. 113, 23–32 (2018).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Stanley, B. G. & Leibowitz, S. F. Neuropeptide Y: stimulation of feeding and drinking by injection into the paraventricular nucleus. Life Sci. 35, 2635–2642 (1984).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Yu, J. et al. Neuron-derived neuropeptide Y fine-tunes the splenic immune responses. Neuron 110, 1327–1339 e1326 (2022).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Zukowska-Grojec, Z. et al. Neuropeptide Y: a novel angiogenic factor from the sympathetic nerves and endothelium. Circ. Res. 83, 187–195 (1998).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Sanchez, M. L., Rodriguez, F. D. & Covenas, R. Neuropeptide Y peptide family and cancer: antitumor therapeutic strategies. Int. J. Mol. Sci. 24, 9962 (2023).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Wu, Y., Berisha, A. & Borniger, J. C. Neuropeptides in cancer: friend and foe? Adv. Biol. 6, e2200111 (2022).

    Article 

    Google Scholar
     

  • Celada, P., Puig, M. V. & Artigas, F. Serotonin modulation of cortical neurons and networks. Front. Integr. Neurosci. 7, 25 (2013).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Ferezou, I. et al. 5-HT3 receptors mediate serotonergic fast synaptic excitation of neocortical vasoactive intestinal peptide/cholecystokinin interneurons. J. Neurosci. 22, 7389–7397 (2002).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Gellman, R. L. & Aghajanian, G. K. Pyramidal cells in piriform cortex receive a convergence of inputs from monoamine activated GABAergic interneurons. Brain Res. 600, 63–73 (1993).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Zhou, F. M. & Hablitz, J. J. Activation of serotonin receptors modulates synaptic transmission in rat cerebral cortex. J. Neurophysiol. 82, 2989–2999 (1999).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Li, X. et al. MEK Is a key regulator of gliogenesis in the developing brain. Neuron 75, 1035–1050 (2012).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Cheng, Y. T. et al. Inhibitory input directs astrocyte morphogenesis through glial GABABR. Nature 617, 369–376 (2023).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • LoTurco, J. J., Owens, D. F., Heath, M. J., Davis, M. B. & Kriegstein, A. R. GABA and glutamate depolarize cortical progenitor cells and inhibit DNA synthesis. Neuron 15, 1287–1298 (1995).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Morel, L., Higashimori, H., Tolman, M. & Yang, Y. VGluT1+ neuronal glutamatergic signaling regulates postnatal developmental maturation of cortical protoplasmic astroglia. J. Neurosci. 34, 10950–10962 (2014).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Tozuka, Y., Fukuda, S., Namba, T., Seki, T. & Hisatsune, T. GABAergic excitation promotes neuronal differentiation in adult hippocampal progenitor cells. Neuron 47, 803–815 (2005).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • DeMorrow, S. et al. Neuropeptide Y inhibits cholangiocarcinoma cell growth and invasion. Am. J. Physiol. Cell Physiol. 300, C1078–C1089 (2011).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Kitlinska, J. et al. Differential effects of neuropeptide Y on the growth and vascularization of neural crest-derived tumors. Cancer Res. 65, 1719–1728 (2005).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Lv, X. et al. Neuropeptide Y1 receptor inhibits cell growth through inactivating mitogen-activated protein kinase signal pathway in human hepatocellular carcinoma. Med. Oncol. 33, 70 (2016).

    Article 
    PubMed 

    Google Scholar
     

  • Yu, G., Wang, L. G., Han, Y. & He, Q. Y. clusterProfiler: an R package for comparing biological themes among gene clusters. OMICS 16, 284–287 (2012).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Sardar, D. et al. Sox9 directs divergent epigenomic states in brain tumor subtypes. Proc. Natl Acad. Sci. USA 119, e2202015119 (2022).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Sengupta, A. & Holmes, A. A discrete dorsal raphe to basal amygdala 5-HT circuit calibrates aversive memory. Neuron 103, 489–505 (2019).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Langmead, B. & Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat. Methods 9, 357–359 (2012).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Li, H. et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics 25, 2078–2079 (2009).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Ramirez, F. et al. deepTools2: a next generation web server for deep-sequencing data analysis. Nucleic Acids Res. 44, W160–W165 (2016).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Zhang, Y. et al. Model-based analysis of ChIP-Seq (MACS). Genome Biol. 9, R137 (2008).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Loven, J. et al. Selective inhibition of tumor oncogenes by disruption of super-enhancers. Cell 153, 320–334 (2013).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Heinz, S. et al. Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities. Mol. Cell 38, 576–589 (2010).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Chen, F. & LoTurco, J. A method for stable transgenesis of radial glia lineage in rat neocortex by piggyBac mediated transposition. J. Neurosci. Methods 207, 172–180 (2012).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Tsang, Y. H. et al. Functional annotation of rare gene aberration drivers of pancreatic cancer. Nat. Commun. 7, 10500 (2016).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Dobin, A. et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15–21 (2013).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Lawrence, M. et al. Software for computing and annotating genomic ranges. PLoS Comput. Biol. 9, e1003118 (2013).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15, 550 (2014).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • [ad_2]

    Source link

  • PGE2 limits effector expansion of tumour-infiltrating stem-like CD8+ T cells

    [ad_1]

    Mice

    All mice used in this study were on a C57BL/6J genetic background and purchased from the Jackson Laboratory (JAX). OT-I × CD45.1 mice were generated by crossing OT-I mice (JAX, 003831) to CD45.1 (JAX, 002014) mice. Ptger2−/−Ptger4fl/fl mice were generated by crossing Ptger2−/− mice (JAX, 004376) to Ptger4fl/fl mice (JAX, 028102) and further crossed to Cd4cre mice (JAX, 022071) to generate Cd4crePtger2−/−Ptger4fl/fl mice or crossed to Gzmbcre mice (JAX, 003734) to generate GzmbcrePtger2−/−Ptger4fl/fl mice. Unless stated otherwise, mice were on a CD45.2/CD45.2 background. For some experiments, Cd4crePtger2−/−Ptger4fl/fl mice and Ptger2−/−Ptger4fl/fl mice were crossed to OT-I mice to generate Cd4crePtger2−/−Ptger4fl/fl OT-I mice and Ptger2−/−Ptger4fl/fl OT-I mice and used on a CD45.1/CD45.2 or CD45.1/CD45.1 background. WT or Rag1−/− mice (JAX, 002216) on a CD45.2/CD45.2 background were used as recipients in adoptive transfer experiments. In all experiments, mice at 6–12 weeks of age were sex-matched and randomly assigned to control or treatment groups. Mouse experiments with Ptgs1/Ptgs2−/− BRAFV600E tumours and T cell depletion were conducted without blinding; all other experiments were performed in a blinded manner. No statistical methods were used to predetermine sample sizes. Mice were killed by cervical dislocation under anaesthesia. All mice were maintained and bred at the Klinikum rechts der Isar, TUM, or at the Klinikum der Universität München, LMU, under specific-pathogen-free, controlled conditions with a 12-h light–dark cycle, ambient temperature of 24 °C and humidity maintained at 55%, and in accordance with the guidelines of the Federation of European Laboratory Animal Science Associations. All animal experiments were performed in accordance with the guidelines of the district government of upper Bavaria (Department 5–Environment, Health and Consumer Protection).

    Cell lines

    Control and Ptgs1/Ptgs2−/− BRAFV600E melanoma cells were generated using the CRISPR–Cas9 system as previously described14. BRAFV600E-OVA and Ptgs1/Ptgs2−/− BRAFV600E-OVA cells were generated by lentiviral transduction. In brief, OVA cDNA was subcloned into a pHIV-7 transfer vector carrying both the phosphoglycerate kinase (PGK) promoter and IRES-puromycin-resistance sequence. The production of third-generation self-inactivating lentiviral vectors, pseudotyped with VSV.G, was carried out as previously described44. Specifically, packaging cells were transfected and, after 2 days, cell supernatants were collected, filtered and used to transduce tumour cell lines in the presence of 8 µg ml–1 polybrene (Merck). After the incubation period, medium was exchanged for fresh medium, and target cells were passaged at least three times after transduction and selected using puromycin. MC38 cells were provided by A. Krüger, Institute of Experimental Oncology, TUM, and MC38-OVA and Panc02 cells were provided by V. Buchholz, Institute for Medical Microbiology, Immunology and Hygiene, TUM.

    BRAFV600E, Ptgs1/Ptgs2−/− BRAFV600E, BRAFV600E-OVA and Ptgs1/Ptgs2−/− BRAFV600E-OVA cells were cultured in complete RPMI medium (RPMI 1640 medium (Thermo Fisher Scientific) supplemented with 10% FCS (Merck), 50 µM β-mercaptoethanol (Thermo Fisher Scientific), 50 U ml–1 penicillin (Thermo Fisher Scientific), 50 µg ml–1 streptomycin (Thermo Fisher Scientific) and 2 mM l-glutamine (Thermo Fisher Scientific). D4M.3A-pOVA cells were generated as previously described45 and cultured in DMEM-F12 medium (Thermo Fisher Scientific). MC38, MC38-OVA and Panc02 cells were cultured in DMEM (Thermo Fisher Scientific), with both media supplemented with 10% FCS, 50 µM β-mercaptoethanol, 50 U ml–1 penicillin, 50 mg ml–1 streptomycin, 2 mM l-glutamine, 1× MEM non-essential amino acids solution (Thermo Fisher Scientific) and 1 mM sodium pyruvate (Thermo Fisher Scientific). To generate tumour cell conditioned medium (CM), 5 × 106 tumour cells were cultured in 20 ml complete RPMI medium for 48 h and the supernatant was collected, filtered and stored at −20 °C until further use. All cell lines were routinely tested for mycoplasma contamination in-house by PCR. For Ptgs1/Ptgs2−/− BRAFV600E cells, the absence of PGE2 production was routinely confirmed by PGE2 ELISA (Cayman Chemical). No further cell line authentications were conducted in the laboratory.

    Tumour cell injections

    Tumour cell lines were detached by trypsinization (Thermo Fisher Scientific) and washed three times in sterile PBS (Thermo Fisher Scientific). Unless stated otherwise, 2 × 106 cells were injected s.c. in 100 µl sterile PBS into the flank of each recipient mouse. Tumour growth was measured using a digital calliper. Tumour diameters stated in the figures refer to the average values of the longest diameter and its perpendicular for each tumour. A maximal tumour diameter of 15 mm served as the humane end point and was not exceeded in any of the experiments.

    CD4+ and CD8+ T cell depletion in vivo

    To deplete CD4+ and CD8+ T cells, mice received intraperitoneal (i.p.) injections of 100 µl anti-mouse CD4 (100 µg per mouse, GK1.5, BioXCell) or anti-mouse CD8β (100 µg per mouse, 53-5.8, BioXCell) antibodies every 5 days, beginning on day 1 following tumour cell inoculation.

    FTY720 treatment in vivo

    FTY720 treatment was performed by injecting mice i.p. with 100 µl of FTY720 (20 µg per mouse, Merck) on day 1 or day 6 after tumour cell transplantation. Injection with 100 µl sterile isotonic NaCl served as control.

    IL-2 receptor blockade in vivo

    For blockade of IL-2Rβ and IL-2Rγc, mice received i.p. injections of 150 µl anti-mouse CD122 (300 µg per mouse, TM-Beta 1, BioXCell) and anti-mouse CD132 (300 µg per mouse, 3E12, BioXCell) antibodies on days 6 and 7 after tumour cell transplantation. Injections with 150 µl sterile isotonic NaCl served as control.

    Processing of tumour tissue and lymphoid organs

    Tumours, tdLNs or spleens of tumour-bearing mice were excised at the indicated time points after cell transplantation. Tumour or organ weight was determined using a microscale. For subsequent analyses by flow cytometry or cell sorting, tumour samples were mechanically dissociated and incubated with collagenase IV (200 U ml–1, Thermo Fisher Scientific) and DNase I (100 µg ml–1, Merck) for 40 min at 37 °C and filtered through a 70 µm and a 30 µm cell strainer (Miltenyi) to generate single-cell suspensions. Spleens were passed through a 70 µm cell strainer, followed by red blood cell lysis and a second filtration step using a 30 µm cell strainer. LNs were passed through a 30 µm cell strainer. For the isolation of migratory cDC1s, LNs were processed as described for tumour samples.

    Antibodies and reagents for flow cytometry and cell sorting

    The following antibodies and staining reagents were used for flow cytometry or cell sorting: fixable viability dye eFluor 450 (dilution: 1:500; Thermo Fisher Scientific); fixable viability dye APC-eF780 (1:1,000; Thermo Fisher Scientific); viability dye SYTOX-blue (1:2,000; Thermo Fisher Scientific); APC anti-CD3 (1:100; clone 17A2, Thermo Fisher Scientific); PE anti-CD4 (1:200; GK1.5, Biolegend); AF647 anti-CD4 (1:200; GK1.5, Biolegend); PerCP/Cy5.5 anti-CD4 (1:200; GK1.5, Biolegend); BV421 anti-CD8α (1:200; 53-6.7, Biolegend); FITC anti-CD8α (1:200; 53-6.7, Biolegend); PE-Dazzle594 anti-CD8α (1:200; 53-6.7, Biolegend); PE-Cy7 anti-CD8α (1:200; 53-6.7, Biolegend); BV605 anti-CD11b (1:200; M1/70, Biolegend); PE-Cy7 anti-CD11c (1:200; N418, Biolegend); BV570 anti-mouse/human-CD44 (1:100; IM7, Biolegend); BV711 anti-mouse/human-CD44 (1:100; IM7, Biolegend); FITC anti-mouse/human-CD44 (1:100; IM7, Biolegend); PerCP-Cy5.5 anti-mouse/human-CD44 (1:100; IM7, Biolegend); AF647 anti-CD45.1 (1:100; A20, Biolegend); PE anti-CD45.1 (1:100; A20, Biolegend); PE-Dazzle594 anti-CD45.1 (1:100; A20, Biolegend); PerCP/Cy5.5 anti-CD45.1 (1:100; A20, Biolegend); BV510 anti-CD45.2 (1:100; 104, Biolegend); FITC anti-CD45.2 (1:100; 104, Biolegend); PerCP-Cy5.5 anti-CD45.2 (1:100; 104, Biolegend); FITC anti-CD62L (1:100; MEL-14, Biolegend); PE-Dazzle594 anti-CD62L (1:100; MEL-14, Biolegend); FITC anti-CD103 (1:100; M290, BD Biosciences); APC anti-CD132/IL2Rγc (1:100; TUGm2, Biolegend); PE-Dazzle594 anti-CD186/CXCR6 (1:200; SA051D1, Biolegend); PE anti-CX3CR1 (1:100; SA011F11, Biolegend); BV605 anti-CD279/PD-1 (1:100; 29 F.1A12, Biolegend); BV421 anti-CD366/TIM-3 (1:200; RMT3-23, Biolegend); PerCP/Cy5.5 anti-TCRβ (1:100; H57-597, Biolegend); AF700 anti-I-A/I-E (1:500; MHC class II) (M5/114.15.2, Biolegend); PE anti-H-2Kb bound to SIINFEKL (1:100; 25-D1.16, Biolegend); APC anti-human GZMB (1:200; GB12, Thermo Fisher Scientific); FITC anti-Ki-67 (1:100; SolA-15, Thermo Fisher Scientific); AF700 anti-Ki-67 (1:100; SolA-15, Thermo Fisher Scientific); PE anti-TCF1/TCF7 (1:40; S33-966, BD Biosciences); AF488 anti-human pSTAT5 (0.03 µg per test, 47/Stat5(pY694); BD Biosciences); eF660 anti-TOX (1:100; TXRX10, Thermo Fisher Scientific); eFluor660 Rat-IgG2a-κ isotype-control (1:100; eBR2a, Thermo Fisher Scientific); APC mouse-IgG1κ isotype-control (1:200; P3.6.2.8.1, Thermo Fisher Scientific); AF488 mouse-IgG1κ isotype-control (0.03 µg per test; MOPC-21, Biolegend); and rabbit-anti-mouse-TCF1/TCF7 (1:100; C.725.7, Thermo Fisher Scientific). These were followed by AF647 donkey-anti-rabbit IgG (1:200; Poly4064, Biolegend) or DL488 donkey-anti-rabbit IgG (1:200; Poly4064, Biolegend). Unless stated otherwise, all antibodies were anti-mouse antibodies.

    Flow cytometry and cell sorting

    For staining of surface markers and viability dyes, cells were stained for 15 min at 4 °C in FACS buffer (PBS with 1% FCS and 2 mM EDTA). Staining of SIINFEKL–MHC class I complexes on cDC1s for analysis of OVA cross-presentation was performed for 40 min. For intracellular staining of GZMB, TCF1, Ki-67 and TOX, cells were fixed and permeabilized using the True-Nuclear Transcription Factor Buffer Set (Biolegend) according to the manufacturer’s protocol. Intracellular staining was performed overnight in permeabilization buffer at 4 °C. For intracellular staining of pSTAT5, cells were fixed and permeabilized using BD Cytofix (BD Biosciences) and BD Phosflow Perm Buffer III (BD Biosciences) according to the manufacturer’s instructions (protocols II and III, BD Biosciences). For the detection of EdU incorporation, EdU was added to the culture at a final concentration of 15 µM for the last 3 h of the experiment, and analysis was performed using an EdU Proliferation kit (iFluor 488, Abcam) according to the manufacturer’s protocol.

    Flow cytometry analyses were performed using a LSR Fortessa Cell Analyzer (BD Biosciences, BD FACSDiva software v.8.0.1 and v.9.0.1), a SP6800 Spectral Cell Analyzer (Sony Biotechnologies, spectral analyser software v.2.0.2.14140) or a SA3800 Spectral Cell Analyzer (Sony Biotechnologies, spectral analyser software v.2.0.5.54250). For flow cytometric quantification of cell numbers, CountBright Absolute Counting Beads (Thermo Fisher Scientific) were added to samples before analyses. For some experiments, CD8+ TILs (live CD45+CD3+CD8+ cells), stem-like Cd4crePtger2−/−Ptger4fl/fl OT-I TILs (live CD45.1+CD8+CD44+TIM-3CXCR6) or differentiated effector Cd4crePtger2−/−Ptger4fl/fl OT-I TILs (live CD45.1+CD8+CD44+TIM-3+CXCR6+) were sorted using a FACS Aria III Cell Sorter (BD Biosciences, BD FACSDiva software v.9.0.1). Naive OT-I T cells (CD45.1+CD8+CD62L+CD44) used in adoptive transfer experiments were sorted from blood using a SH800S Cell Sorter (Sony Biotechnologies, cell sorter software v.2.1.6). All flow cytometric data were analysed using FlowJo (BD Biosciences, v.00.8.1 and v.10.8.2).

    Adoptive T cell transfer

    For adoptive T cell transfer of naive T cells, 1 × 103 congenically marked naive CD8+ T cells from OT-I, Ptger2−/−Ptger4fl/fl OT-I or Cd4crePtger2−/−Ptger4fl/fl OT-I donor mice were injected i.v. in sterile PBS into sex-matched recipient WT mice 6 h before tumour cell transplantation s.c. For adoptive transfer of CRISPR-Cas9-edited T cells, 1 × 103 cells congenically marked OT-I T cells from in vitro T cell cultures were injected i.v. into recipient mice at day 2 after tumour cell transplantation s.c. For re-transfer of CD8+ TILs, 7 × 103 congenically marked stem-like (TIM-3CXCR6) or differentiated effector (TIM-3+CXCR6+) Cd4crePtger2−/−Ptger4fl/fl OT-I TILs were sorted from MC38-OVA tumours from WT mice and injected i.v. in sterile PBS into sex-matched recipient Rag1−/− mice inoculated with MC38-OVA tumour cells 2 days before T cell re-transfer.

    Generation of repetitively activated antigen-experienced TCF1+CD8+ T cells

    TCF1+CD8+ T cells were differentiated from splenic naive CD8+ T cells by repetitive activation as previously described35, with minor modifications. In brief, 1 × 106 naive CD8+ T cells were seeded in complete RPMI medium supplemented with 1× MEM non-essential amino acids solution and 1 mM sodium pyruvate. Low-dose IL-2 (85 U ml–1) and mouse anti-CD3/CD28 microbeads were added to the culture while maintaining a CD8+ T cell concentration of 1 × 106 cells per ml for multiple (re-)activation cycles over a course of 4 days, followed by purification of live cells by gradient centrifugation (Pancoll).

    T cell effector differentiation

    Effector differentiation of TCF1+CD8+ T cells was performed as previously described35, with minor modifications. In brief, cells were cultured with mouse anti-CD3/CD28 microbeads in the presence of high-dose IL-2 (350 U ml–1). Where indicated, PGE2 (100 ng ml–1, unless indicated otherwise in the figure legend; Thermo Fisher Scientific), tumour cell CM, IL-7 (10 ng ml–1, Miltenyi), IL-12 (10 ng ml–1, Biolegend) or IL-15/15Rα (1 ng ml–1, Thermo Fisher Scientific) was added to the culture. To assess T cell expansion, the numbers of live CD45+CD3+CD8+ T cells were quantified by flow cytometry 72 h after the incubation period.

    Gene deletion by CRISPR–Cas9–gRNA complex electroporation

    Cd4crePtger2−/−Ptger4fl/fl OT-I T cells were purified from spleen and cultured in complete RPMI supplemented with IL-2 (10 U ml–1) and IL-7 (5 ng ml–1) in the presence of mouse anti-CD3/CD28 microbeads. After 24 h, anti-CD3/CD28 microbeads were removed by magnetic separation and cells were electroporated (4D-Nucleofector, Lonza; pulse program CM137)46 in P3 electroporation buffer supplemented with the Cas9 electroporation enhancer (IDT), Cas9 protein (IDT) and Cd122-targeting or non-targeting gRNAs. gRNAs were generated by hybridizing trRNA (IDT) with Cd122-targeting (sequences TATGTCAAGGAGGTCCACGG and CTGGGAACGACCCGAGGATC, generated using CHOPCHOP; ref. 47) or non-targeting crRNA (IDT) (GCCTGCCCTAAACCCCGGAA; ref. 48) as mock control. Cells were rested in complete RPMI supplemented with IL-7 (5 ng ml–1, Miltenyi) at 37 °C for 48 h and validated for specific knockout by CD122 surface staining before injection into recipient mice.

    Analysis of IL-2Rγc expression and IL-2 signalling

    TCF1+CD8+ T cells from in vitro cultures were rested for 20 h in complete RPMI supplemented with low-dose IL-2 and purified by gradient centrifugation. Cells were stimulated with mouse anti-CD3/CD28 microbeads and low-dose IL-2 for 24 h in the absence or presence of PGE2 (100 ng ml–1). After 24 h, IL-2Rγc chain expression was analysed by flow cytometry. For analysis of IL-2-induced STAT5 signalling, anti-CD3/CD28 microbeads were removed by magnetic separation, cells were rested for 30 min at 37 °C in complete RPMI and stimulated for 30 min with different concentrations of IL-2 (10–100 U ml–1, as indicated). After the incubation period, fixation buffer was directly added to the culture to terminate the signalling process and cells were stained for flow cytometry analysis.

    PGE2 measurements

    Tumours and organs of tumour-bearing mice were excised 11 days after tumour cell transplantation, directly frozen in liquid nitrogen and stored at −80 °C until further processing. Samples were homogenized in homogenization buffer (0.1 M PBS, 1 mM EDTA and 10 µM indomethacin (Merck), pH 7.4) using a gentleMACS Dissociator (Miltenyi) followed by a freeze–thaw cycle. PGE2 concentrations were measured by ELISA (Cayman Chemical) according to the manufacturer’s protocol.

    RNA isolation and quantitative real-time PCR

    RNA was isolated using an Arcturus PicoPure RNA isolation kit (Thermo Fisher Scientific) and cDNA was generated using a SensiFAST cDNA synthesis kit (Bioline). Quantitative real-time PCR was carried out on a LightCycler 480 (Roche, LightCycler 480 software v.1.5.1) using a TAKYON No ROX SYBR MasterMix dTTP Blue kit (Eurogentec) according to the manufacturer’s protocol. Ptger4 expression was determined using the ΔCt method, with Hprt serving as reference gene. Primer sequences were from a previous study38. All primers were purchased from Eurofins.

    scRNA-seq and scTCR-seq

    CD8+ TILs were sorted from BRAFV600E tumours 11 days after tumour cell transplantation. A combination of cell hashing and DNA barcoding during library preparation was used for sample multiplexing, which enabled the simultaneous sequencing of four biological replicates from each group. For cell hashing, unique TotalSeq-C anti-mouse hashtag antibodies were used for hashing of cells from each experimental group as follows: WT: hashtag 1; Ptger2−/−Ptger4fl/fl: hashtag 2; Cd4crePtger2−/−Ptger4fl/fl: hashtag 3; and GzmbcrePtger2−/−Ptger4fl/fl: hashtag 4 (1:250 each, Biolegend). Hashtagged cells from one tumour-bearing mouse of each group were pooled and loaded on a Chromium Next GEM Chip (10x Genomics). RNA-seq libraries were generated using Chromium Next GEM Single Cell 5′ Reagent kits v.2 User Guide with Feature Barcode technology for Cell Surface Protein (Rev D) according to the manufacturer’s protocol (10x Genomics). Quality control was carried out using a High Sensitivity DNA kit (Agilent), a Bioanalyzer 2100 and a Qubit dsDNA HS Assay kit (Thermo Fisher Scientific). For sequencing, libraries were pooled and analysed by paired-end sequencing (2 × 150 bp) on a NovaSeq6000 platform using S4 v.1.5 (300 cycles) sequencing kits (Illumina). Libraries were sequenced to a depth of at least 2 × 104 reads per cell for gene expression libraries and 5 × 103 reads per cell for T cell receptor libraries.

    Initial scRNA-seq analyses were performed for all samples from the groups Ptger2−/−Ptger4fl/fl, Cd4crePtger2−/−Ptger4fl/fl and GzmbcrePtger2−/−Ptger4fl/fl, with data from the WT group being added at a later stage for validation of Ptger2 and Ptger4 read coverage (see below). Alignment of gene expression libraries and demultiplexing were performed using cellranger multi (Cell Ranger (v.6.1.1)49; 10x Genomics) against the pre-built mouse reference v2020-A (10x Genomics, mm10/GRCm38, annotation from GENCODE Release M23) with the number of expected cells equals 21.000 as input argument. The BAM files were converted to FASTQ files using the tool bamtofastq with the argument –reads-per-fastq set to the total number of reads in the BAM file plus 10,000. After that, gene expression and TCR analysis were combined by running cellranger multi separately for each demultiplexed sample, disabling library concordance reinforcement. The algorithm was forced to find the number of cells identified in the first step of demultiplexing, and sample-specific FASTQ files were used as input for the gene expression analysis pipeline. The pre-built Ensembl GRCm38 Mouse V(D)J Reference v.5.0.0 was used for TCR analysis.

    The initial downstream analysis was performed in R (v.4.0.4) with the R package Seurat (v.4.0.1)50. Only cells with more than 1,000 genes detected, less than 10% of mitochondrial genes and with UMI counts less than 3 standard deviations above the mean were kept. The data were filtered for genes detected in at least three cells in one of the samples. Filtered read counts from each sample were normalized independently using sctransform (v.0.3.2)51 with the glmGamPoi method52. Anchors between cells from different replicates were identified on the top 1,000 highly variable genes using canonical correlation analysis and 30 canonical vectors. Data integration was performed on first 20 PC analysis (PCA) dimensions. PCA was calculated for the integrated data on the top 1,000 highly variable genes and both k-nearest neighbour graph and UMAP were computed on the 30 nearest neighbours and first 20 PCA dimensions. Louvain clusters were identified using the shared nearest neighbour modularity optimization-based algorithm at resolutions 0.9, 0.65 and 0.9 for the groups Ptger2−/−Ptger4fl/fl, Cd4crePtger2−/−Ptger4fl/fl and GzmbcrePtger2−/−Ptger4fl/fl, respectively. Contaminating myeloid cells were identified based on the average cluster expression of the marker genes Cd14, Lyz2, Fcgr3, Ms4a7, Fcer1g, Cst3, H2-Aa, Ly6d, Ms4a1 and Ly6d. Cycling cells were identified based on expression of Cdk1, Mcm2, Pclaf, H2afz, Birc5 and Mki67.

    The integrative analysis between groups was performed in R (v.4.2.1) with the R package Seurat (v.4.1.1)50. After general data pre-processing and regression of contaminating cells as mentioned above, filtered read counts from each sample were normalized independently using sctransform (v.0.3.2)51 with glmGamPoi method52. Anchors between cells from all groups and all their replicates were identified using a more conservative approach, which led to weaker batch correction. For that purpose, reciprocal PCA was applied on the top 1,000 highly variable genes of each sample and anchors were picked using the first 20 dimensions and 1 neighbour only. PCA was performed on the integrated data on the top 1,000 highly variable genes. A k-nearest neighbour graph and UMAP (spread of 0.4, minimum distance of 0.01) were computed on the first 20 PCs and 30 nearest neighbours. A resolution of 0.6 was used for Louvain clusters identification using the shared nearest neighbour modularity optimization-based algorithm. DEGs between two groups were identified using the Wilcoxon rank-sum test and Bonferroni correction. Gene set expression scores at single-cell level were calculated using the AddModuleScore function, including only the detected genes. Similarity scores with reference datasets were calculated using the R package SingleR (v.1.10.0)53 with the top 200 DEGs. The processed transcriptome profiles of naive CD8+ T cells, memory stem cell CD8+ T cells and central memory CD8+ T cells were from a previous study54. For tumour antigen-specific CD8+ T cells in tdLNs, tumour-infiltrating stem-like CD8+ T cells and their naive counterparts, data from a previous study3 were processed using the R package DESeq2 (v.1.36)55. Gene set expression scores at the single-cell level were calculated using the AddModuleScore function, including only the detected genes. The effector T cell gene signature was from a previous study56 (M3013: KAECH_NAIVE_VS_DAY8_EFF_CD8_TCELL_DN). The CD8+ T cell proliferation signature was obtained from MSigDB (GO:2000566). Transcriptional trajectories were inferred using the R package slingshot (v.2.4.0)57 over the UMAP calculated on the integrated data, approximating the curves by 150 points. The pseudotime was calculated as a weighted average across lineages, weighted by the assignment weight.

    TCR analysis of clonotype was performed using the R package scRepertoire (v.1.6.0)58. Clonotypes were called based on a combination of VDJC genes comprising the TCR and the nucleotide sequence of the CDR3 region. Whenever the clonotype distribution is shown for individual groups, the cell number was downsampled, so that cluster 1 from all groups had the same maximum size. TF activity was inferred using the weighted mean method of decoupleR (v.2.2.2)59 and TF–target interactions available through dorothea (v.1.8.0)60, with confidence levels A to C. Normalization to Ptger2−/−Ptger4fl/fl was achieved by subtracting its scores from the scores of the other groups. The top 100 variable TFs between clusters within each group were used to draw a network graph with tidygraph (v.1.2.1)61 based on common targets with same defined mode of regulation as defined on the database. Only TFs with at least two common targets were kept for visualization. Louvain clusters were identified using igraph (v.1.3.2)62 at a resolution of 0.5.

    For addition of scRNA-seq data from the WT group, samples were pre-processed as described above and mapped to a reference formed by the integrated data of the Ptger2−/−Ptger4fl/fl, Cd4crePtger2−/−Ptger4fl/fl and GzmbcrePtger2−/−Ptger4fl/fl groups using the R package Seurat (v.4.1.1)50. For that purpose, anchors between cells from the reference and the WT groups along with all replicates were identified using reciprocal PCA on top 1,000 highly variable genes. Anchors were picked using the first 20 dimensions and 1 neighbour only. Annotations were transferred using the function TransferData, and data were integrated using IntegrateEmbeddings. Cells from the added group were then projected onto the coordinates of the reference UMAP calling ProjectUMAP with 30 nearest neighbours. Read coverage was estimated using deepTools (v.3.5.4)63 with bamCoverage and a bin size of 10 bp and normalization by bins per million mapped reads. For coverage analysis on Tcf7/TCF1+ and Tcf7/TCF1 clusters, BAM files were split by cell barcodes from clusters 1–2 or clusters 3–8 using samtools (v.1.13)64 before coverage estimation. Read coverage on gene tracks was visualized using the R package trackViewer (v.1.32.1)65.

    RNA-seq

    In vitro generated, repetitively activated TCF1+CD8+ T cells were incubated in the presence or absence of PGE2 (100 ng ml–1) for 1 h at 37 °C followed by stimulation with IL-2 or IL-2 plus mouse anti-CD3/CD28 microbeads for an additional 4 h. Total RNA was isolated using Total RNA Miniprep (Monarch). Library preparation was carried out using a NEB Next UltraRNA Library Prep kit with i7 and i5 index reads of 8 bp each for mRNA library preparation and poly A enrichment. Sequencing was performed on a NovaSeq6000 PE150 platform in paired-end mode (read 1: 151 bp, read 2: 151 bp), using S4 (v.1.5) (300 cycles) sequencing kits (Illumina). Reads were aligned to the mouse reference genome (GRCm38/mm10, NCBI) using the Hisat2 (v.2.0.5) mapping tool. To quantify gene expression levels, featureCounts (v.1.5.0-p3) was used to count the reads mapped to each gene, followed by the calculation of fragments per kilobase of transcript sequence per million mapped reads based on gene length and read count. DEGs were identified using the DESeq2 R package (v.1.20.0). Adjusted P values were obtained using Wald test with multiple testing by the Benjamini–Hochberg method, and genes identified by DESeq2 with adjusted P values < 0.05 and fold change ≥ 2 were assigned as DEGs. Volcano plots were visualized using the ggplot2 R package ggplot2 (v.3.4.2), and PCA was conducted using the prcomp function in R and visualized using the R packages ggplot2 and ggrepel (v.0.9.3). DEGs obtained from comparing the groups ‘anti-CD3/CD28 +IL-2’ and ‘PGE2-treated + anti-CD3/CD28 +IL-2’ were ordered based on their log2 fold change values and subjected to GSEA using GSEA (v.4.3.2) probing for hallmark genes from mh.all.v2023.1.Mm (MSigDB). The PreRanked tool from GSEA (v.4.3.2) was used to determine the NES and significance by adjusted P values.

    Statistical analyses

    The GraphPad Prism software (v.9.5.0 and v.9.5.1) was used for statistical analyses. Affinity Designer (v.1.10.6) (Serif) was used to visualize data. Paired or unpaired two-tailed Student’s t-test, one-way ANOVA or two-way ANOVA was used to assess statistical significance, as indicated in in the figure legends. Data are shown as the mean ± s.d., mean ± s.e.m. or box and whiskers plots, as indicated in the figure legends.

    Reporting summary

    Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

    [ad_2]

    Source link