Tag: Enzyme mechanisms

Nucleosome flipping drives kinetic proofreading and processivity by SWR1

[ad_1]

Purification of wild-type SWR1

Recombinant SWR1 was produced as previously described^12,16 with minor modifications. Baculoviruses encoding SWR1 genes were initially amplified in Sf9 cells, before using the amplified baculoviruses to infect BTI-TN-5B1-4 (High Five) cells for expression, which were harvested after 72 h. Cells were lysed by sonication in 50 mM HEPES (pH 8.0), 0.5 M NaCl, 1 mM TCEP, 10% glycerol, 1 mM benzamidine-HCL supplemented with 1 protease inhibitor tablet and 10 µl of benzonase per litre of cell culture. Lysate was clarified by centrifugation at 30,000g for 60 min at 4 °C. The supernatant was filtered before being injected onto a StrepTrap HP (Cytiva) column. The column was washed with buffer A (25 mM HEPES (pH 7.5), 0.3 M NaCl, 1 mM TCEP and 10% glycerol) before being eluted with buffer A supplemented with 5 mM desthiobiotin. The eluted protein was combined and diluted 1:1 with buffer B (25 mM HEPES (pH 7.5), 0.1 M NaCl, 1 mM TCEP and 10% glycerol) to dilute the salt before being loaded onto a HiTrap Q HP (Cytiva) column. The protein was eluted with a linear gradient from buffer B to buffer C (25 mM HEPES (pH 7.5), 2 M NaCl, 1 mM TCEP and 10% glycerol). The relevant fractions were pooled and diluted again 1:1 with buffer B to reduce the salt before being injected onto a Heparin HP (Cytiva) column. Protein was eluted with a linear gradient from buffer B to buffer C. Finally, the protein was concentrated, snap frozen in liquid nitrogen and stored at −80 °C.

Purification of fluorescently labelled SWR1

To site specifically label the SWR1 complex, we made use of the ybbR-labelling approach^34,35. The 11-amino acid ybbR tag was fused to the N terminus of the Arp6 subunit of SWR1. The ybbR–Arp6 mutant was used in place of the wild-type Arp6 gene when assembling the SWR1 genes using the MultiBac system¹⁶. The SWR1(ybbR–Arp6) complex was expressed and purified in an analogous way to wild-type SWR1 with the ybbR-labelling reaction taking place after elution from the HiTrap Q HP column. The labelling reaction was carried out overnight at 4 °C. Typically, SWR1(ybbR–Arp6; approximately 1 µM) was labelled with CoA-Atto647N (approximately 10 µM) using recombinant Sfp transferase (approximately 0.2 µM) in buffer B supplemented with 10 mM MgCl₂. The labelled SWR1 complex was separated from free dye and Sfp transferase using a Heparin HP (Cytiva) column, eluting with a linear gradient from buffer B to buffer C. Finally, SWR1(Atto647N–Arp6) (referred to as SWR1(647N) in the text) was concentrated, snap frozen in liquid nitrogen and stored at −80 °C.

Purification of S. cerevisiae histones

All nucleosomes or hexasomes used in this study were composed of S. cerevisiae histones assembled on DNA containing the 601 Widom sequence.

S. cerevisiae octamers with and without Alexa Fluor 555 on H2A K119C were prepared as previously described¹⁶.

S. cerevisiae H2A–H2B, Htz1–H2B (with and without Alexa Fluor 555 on Htz1 K125C) or Htz1–H2B(3×Flag) histone dimers were expressed in E. coli and purified as soluble dimers. Cells were lysed by sonication in buffer D (20 mM Tris (pH 7.5), 0.5 M NaCl, 0.1 mM EDTA and 1 mM TCEP) plus protease inhibitor tablets (Roche; 2 tablets per 100 ml). Dimers were purified by loading the cleared lysate onto tandem HiTrap Q FF and HiTrap Heparin HP columns in buffer E (20 mM Tris (pH 7.5), 0.5 M NaCl, 1 mM EDTA and 1 mM TCEP). The HiTrap Q FF column was removed before elution from the HiTrap Heparin HP column via a gradient to buffer F (20 mM Tris (pH 7.5), 2 M NaCl, 1 mM EDTA and 1 mM TCEP), followed by gel filtration on a Superdex S200 in buffer F.

S. cerevisiae histone H3(Q120M, K121P and K125Q) and histone H4 were co-expressed in E. coli and purified as soluble tetramers. Cells were lysed by sonication in buffer D plus protease inhibitor tablets (Roche; 2 tablets per 100 ml). Tetramers were purified using a HiTrap Heparin HP column in buffer E and eluted via a gradient to buffer F, followed by gel filtration on a Superdex S200 in buffer F.

Preparation of nucleosomes

Biotinylated DNA containing the Widom 601 sequence was generated as previously described¹². Salt gradient dialysis of the S. cerevisiae octamers with DNA was carried out to form a ‘core’ nucleosome. A biotinylated DNA overhang was ligated to the core nucleosome as previously described¹². This resulted in nucleosomes with one long overhang of 113 bp and a short overhang of 2 bp, which we refer to as 113N2 (‘N’ representing the Widom 601 nucleosome positioning sequence). The biotin was present on the long 113-bp linker. For nucleosomes where the DNA was labelled, the fluorophore was attached at the end of the 2-bp short overhang.

Preparation of hexasomes

To facilitate the formation of yeast hexasomes, three amino acid substitutions were introduced into the S. cerevisiae H3 histone (Q120M, K121P and K125Q)³⁶. These substitutions (MPQ) are the corresponding amino acids found in human and Xenopus laevis H3.

To form hexasomes, S. cerevisiae H2A–H2B dimers were mixed with S. cerevisiae H3(MPQ)–H4 tetramers. The amount of H2A–H2B dimers used was limited to 0.6× the amount of tetramers to ensure only partial H2A–H2B occupancy. Hexasomes were assembled onto the same DNA that was used for nucleosomes by salt gradient dialysis to generate ‘core’ hexasomes. Core hexasomes were separated from tetrasomes, nucleosomes and free DNA using a MonoQ column, loaded in buffer G (20 mM Tris (pH 7.5), 1 mM EDTA, 1 mM TCEP and 200 mM NaCl) eluting with a gradient into buffer H (as buffer G with 2 M NaCl). The fractions were immediately diluted into 4× volume of 20 mM Tris (pH 7.5) to reduce the salt concentration. A biotinylated DNA overhang was ligated to the core hexasome in the same way as was used for nucleosomes. This resulted in a hexasome with one long overhang of 113 bp and a short overhang of 2 bp, which we refer to as 113H2 (‘H’ representing a hexasome assembled on the Widom 601 sequence). The biotin was present on the long 113-bp linker. For hexasomes where the DNA was labelled, the fluorophore was attached at the end of the 2-bp short overhang.

As is the case for hexasomes prepared with X. laevis histones³⁷, yeast hexasomes prepared in this way exploit the inherent asymmetry of the Widom 601 sequence. Because of this asymmetry, the H2A–H2B dimer present in a hexasome is preferentially located on the ‘TA-rich’ side of the Widom 601 sequence, leaving the vacant site on the ‘TA-poor’ side. We orientated our Widom 601 sequence with the TA-rich side closest to the 2-bp short overhang. This resulted in the vacant H2A–H2B site being located next to the 113-bp linker.

Preparation of heterotypic nucleosomes

Core hexasomes, prepared as described above, were mixed with S. cerevisiae Htz1–H2B dimers to form heterotypic nucleosomes. Htz1–H2B dimers were added at an amount equal to 0.3× the amount of hexasome present. Core heterotypic nucleosomes were then purified in the same way as canonical nucleosomes. A biotinylated DNA overhang was ligated to the core heterotypic nucleosomes as described above. Resulting heterotypic nucleosomes contain the Htz1–H2B dimer next to the long 113-bp overhang and the conical H2A–H2B dimer next to the short 2-bp overhang.

Bulk histone exchange assay

SWR1 (100 nM; wild type or SWR1(647N)), 200 nM nucleosomes and 400 nM Htz1–H2B(3×Flag) were mixed in exchange buffer (25 mM Tris-HCl (pH 7.8), 100 mM KCl, 0.2 mM EDTA and 2 mM MgCl₂), with or without 1 mM ATP. The exchange reaction was carried out at 30 °C. At the indicated time points, 8 µl of the reaction was removed and quenched by the addition of 4 µl of a stopping solution (0.5 mg ml⁻¹ salmon sperm DNA, 30 mM EDTA and 3× ficoll loading buffer) and placed on ice. The ‘no ATP’ control was taken at the longest indicated time point. After all time points had been taken, the reaction products were separated by 6% native PAGE, run at 110 V in 0.5× TBE at 4 °C and visualized using fluorescence of the nucleosome.

Two-colour smFRET microscope

smFRET measurements looking at the flipping of nucleosomes by SWR1 were performed on an Olympus IX-71 microscope equipped with a homebuilt prism-TIRF module. Excitation was provided by a 532-nm laser (Stradus, Vortran) or a 637-nm laser (Stradus, Vortran). Fluorescence was collected through a 1.2 NA, 60× water objective (Olympus) and filtered through a dual bandpass filter (FF01-577/690-25, Semrock). The fluorescence was spectrally separated using a OptoSplit II (Cairn Research) to separate donor and acceptor emission. The donor and acceptor emissions were further filtered through ET585/65M and ET700/75M (Chroma) bandpass filters, respectively. The donor and acceptor images were then projected side-by-side onto an electron-multiplying charge-coupled device (EMCCD) (Andor iXon Ultra 897). Data were collected as raw movies using a custom LabVIEW script.

Single-molecule fluorescence spots from the raw movies were localized using custom IDL scripts and converted into raw fluorescence trajectories. Raw fluorescence trajectories were corrected for bleed through of the donor fluorescence into the acceptor channel. Apparent FRET efficiencies were calculated as the ratio of acceptor intensity divided by the sum of the donor and acceptor intensities.

Two mechanical shutters (LS-3, Uniblitz, Vincent Associates) were placed in the excitation path for alternating laser excitation (Extended Data Fig. 4e–g). Frame acquisition and shutter synchronization were obtained using a homebuilt negative-edge-triggered JK flip–flop circuit (SN74LS112AN, Texas Instruments) using the ‘Fire’ output of the EMCCD as the input clock. IDL scripts were modified accordingly to locate single molecules and extract fluorescence trajectories.

Three-colour smFRET microscope

smFRET measurements looking at histone exchange coupled with SWR1 binding were performed on an Olympus IX-71 microscope equipped with a homebuilt prism-TIRF module. Alternating laser excitation was provided by a 488-nm laser (OBIS, Coherent) or a 637-nm laser (OBIS, Coherent). Alternation of the lasers and synchronization of the lasers with the camera were controlled by a custom LabVIEW script and a DAQ (USB-6341, National Instruments). Fluorescence was collected through a 1.2 NA, 60× water objective (Olympus) and filtered through ET500lp (Chroma) and NF03-642E-25 (Semrock) filters. The fluorescence was spectrally separated using a MultiSplit (Cairn Research) housing the following dichroic filters: T500lpxr UF2, T635lpxr UF2 and T725lpxr UF2 (Chroma). The separated fluorescent emission was projected onto quadrants of a sCMOS (ORCA Fusion, Hammamatsu) camera. Data were collected as raw movies using HCImage Live (Hammamatsu).

Single-molecule fluorescence spots from the raw movies were localized using custom IDL scripts and converted into raw fluorescence trajectories. Raw fluorescence trajectories were corrected for bleed through of the donor fluorescence into the acceptor channel. Apparent FRET efficiencies were calculated as the ratio of acceptor intensity divided by the sum of the donor and acceptor intensities.

Microscope slide passivation and flow chamber assembly

Quartz slides (UQC optics) and glass coverslips were aminosilinized with N-(2-aminoethyl)-3-aminopropyltrimethoxysilane, then passivated using methoxy-PEG-SVA (relative molecular mass = 5,000; Laysan Bio, Inc.) containing 5% biotin-PEG-SVA (relative molecular mass = 5,000, Laysan Bio, Inc.) in 100 mM sodium bicarbonate as previously described³⁸ with minor modifications. Following passivation, slides and coverslips were stored under nitrogen in the dark at −20 °C. Before use, slides and coverslips were warmed to room temperature and assembled into flow chambers using 0.12-mm thick double-sided adhesive sheets (Grace Bio-Labs SecureSeal). Flow chambers were sealed with epoxy glue.

Nucleosome or hexasome immobilization

Nucleosomes or hexasomes were surface immobilized as previously described¹². In brief, neutravidin (0.1 mg ml⁻¹) in T50 buffer (50 mM Tris-HCl (pH 7.5) and 50 mM NaCl) was injected into the assembled flow chamber and incubated for 5 min to allow binding to the biotinylated PEG surface. Excess neutravidin was washed out with reaction buffer (25 mM Tris-HCl (pH 7.8), 100 mM KCl, 4% glycerol, 1 mM EDTA, 2 mM MgCl₂ and 0.2 mg ml⁻¹ BSA). Biotinylated nucleosomes or hexasomes were diluted to 10 pM in reaction buffer before injecting into the flow chamber and allowed to bind to the neutravidin for 5 min. Excess nucleosomes or hexasomes were flushed out using imaging buffer (reaction buffer with Trolox, 2.5 mM protocatechuic acid and 0.25 µM protocatechuate-3,4-dioxygenase) and imaged immediately.

smFRET between nucleosome or hexasome and SWR1 data collection

Nucleosomes or hexasomes labelled with a Cy3 donor on the short end of the DNA overhang (113N2.Cy3 or 113H2.Cy3) were immobilized in a flow chamber and imaged. SWR1(647N), 10 nM in imaging buffer (25 mM Tris-HCl (pH 7.8), 100 mM KCl, 4% glycerol, 1 mM EDTA, 2 mM MgCl₂, 0.2 mg ml⁻¹ BSA, Trolox, 2.5 mM protocatechuic acid and 0.25 µM protocatechuate-3,4-dioxygenase) was injected. Imaging was performed by first directly exciting the acceptor with a 637-nm laser for approximately 15 s to localize SWR1(647N), before switching to 532-nm excitation to observe FRET between the nucleosome or hexasome and SWR1. All single-molecule measurements were carried out at room temperature, data were acquired with a 100-ms frame time.

smFRET between nucleosome or hexasome and SWR1 data analysis

Manual inspection of the donor intensity, acceptor intensity and apparent FRET from each molecule was carried out using custom MATLAB scripts. For a molecule to be included in downstream analysis, it needed to have a constant signal from the acceptor under direct acceptor excitation to indicate that SWR1(647N) was bound and display a single step photobleaching event of either the donor or acceptor under donor excitation. All molecules that satisfied these criteria were truncated to just the FRETing region preceding the photobleaching event.

Truncated FRET traces were analysed with a hidden Markov model using vbFRET, using default parameters³⁹. The idealized FRET from vbFRET was used to generate FRET histograms, plotted using Igor Pro 8 (Wavemetrics). Dwell times from the idealized FRET trajectories were extracted using custom MATLAB scripts. Only dwell times in which the idealized FRET transitioned between proximal and distal states (or the reverse) were included. Dwell time plots were generated in MATLAB and plotted in Igor Pro 8. The lifetime of the proximal-bound and distal-bound states was determined by fitting the dwell time plots to a double exponential function in Igor Pro 8. The slow and fast exponential phases probably correspond to a fully or partially engaged SWR1 complex, respectively. The average lifetimes (τ_ave) for proximal-bound and distal-bound states were calculated using the pre-exponential factors (A) and lifetimes (τ) determined from the double exponential fit as follows:

$${\tau }_{{\rm{ave}}}=({A}_{1}{{\tau }_{1}}^{2}+{A}_{2}{{\tau }_{2}}^{2})/({A}_{1}{\tau }_{1}+{A}_{2}{\tau }_{2})$$

In all cases, we observed both static and dynamic trajectories when probing the FRET between nucleosomes or hexasomes and SWR1. Only dynamic trajectories were used for determining the kinetics. For both the canonical and the heterotypic nucleosomes, static trajectories represent a minority of the observed molecules. Short static traces may be due to dye photobleaching or SWR1 diffusion before a flipping event can take place. However, longer static traces are also observed. This heterogeneity is summarized in Extended Data Fig. 5. Long static trajectories suggest that a proportion of SWR1 molecules are stably engaged on one side of the nucleosome and not dynamically checking the histone identity of each nucleosome face. The nature of this stable SWR1 binding, compared with binding that allows nucleosome flipping, is unknown, as is the method by which SWR1 could transition from a static (stable binding) to a flipping (checking histone identity) state.

smFRET real-time imaging of histone exchange and SWR1-binding data collection

A quartz flow cell was prepared as described above. Neutravidin (0.01 mg ml⁻¹) in T50 buffer (50 mM Tris-HCl (pH 7.5) and 50 mM NaCl) was injected into the flow chamber and incubated for 5 min to allow binding to the biotinylated PEG surface. Excess neutravidin was washed out and the flow cell further passivated by incubation with Pluronic F127 (0.5% w/v) in T50 buffer. Excess Pluronic F127 was washed out with reaction buffer (25 mM Tris-HCl (pH 7.8), 100 mM KCl, 4% glycerol, 0.2 mM EDTA, 2 mM MgCl₂ and 0.2 mg ml⁻¹ BSA).

To follow the insertion of variant histones in real time at the single-molecule level, a ‘gain of FRET’ assay was used. Nucleosomes labelled with Alexa Fluor 488 (FRET donor) on the short 2-bp overhang (113N2.AF488) were immobilized in a flow chamber and imaged. To start the reaction, 1 nM SWR1, 4 nM Chz1–Htz1(AF555)–H2B and 1 mM ATP in imaging buffer (25 mM Tris-HCl (pH 7.8), 100 mM KCl, 4% glycerol, 0.2 mM EDTA, 2 mM MgCl₂, 0.2 mg ml⁻¹ BSA, Trolox, 2.5 mM protocatechuic acid and 0.25 µM protocatechuate-3,4-dioxygenase) was injected into the chamber using a syringe pump. Exchange can be monitored by stepwise FRET increases as the AF555-labelled (FRET acceptor) Htz1–H2B dimer is exchanged into the immobilized AF488-labelled nucleosome. To reduce nonspecific binding of the Htz1(AF555)–H2B dimer, the dimer was first complexed with its natural chaperone, Chz1 (ref. ⁴⁰).

For experiments that simultaneously followed exchange and SWR1 binding, the experiment was conducted as described but with SWR1(647N) using the three-colour smFRET microscope described above. The two excitation lasers (488 nm and 637 nm) were alternated at a frequency of 1 Hz. All experiments were carried out at room temperature (22 °C).

smFRET real-time imaging of histone exchange and SWR1-binding data analysis

Visualization of single-molecule trajectories was carried out using custom MATLAB scripts. For each single molecule, the intensity of the donor (Alexa Fluor 488), acceptor (Alexa Fluor 555) and corresponding FRET, along with the colocalized SWR1-binding intensity (Atto647N) were inspected. Nucleosomes that underwent exchange were identified by stepwise increases in the FRET trajectory. SWR1 binding was identified as an increase in the Atto647N intensity. Nucleosomes where the signal for SWR1 binding overlapped with at least one exchange event were included for further analysis. Dwell times were collected by manual inspection of the trajectories. Data were obtained by measuring several regions of interest from at least three independent slides. Dwell time plots were generated in MATLAB and plotted and fit in Igor Pro 8.

Single-molecule measurements of SWR1 nucleosome lifetime

Nucleosomes labelled with Alexa Fluor 488 on the short 2-bp overhang (113N2.AF488) were immobilized in a flow chamber as described above. Of SWR1(647N), 5 nM in imaging buffer (25 mM Tris-HCl (pH 7.8), 100 mM KCl, 4% glycerol, 1 mM EDTA, 2 mM MgCl₂, 0.2 mg ml⁻¹ BSA, Trolox, 2.5 mM protocatechuic acid and 0.25 µM protocatechuate-3,4-dioxygenase with 1 mM ATP) was injected. The three-colour smFRET microscope described above was used. The two excitation lasers (488 nm and 637 nm) were alternated at a frequency of 1 Hz. Experiments were carried out at room temperature (22 °C). Trajectories in which SWR1(647N) colocalized with a nucleosome were selected and further processed using tMAVEN⁴¹ to determine the time for SWR1 to bind and the time SWR1 remained bound to a nucleosome.

Preparation of the SWR1–nucleosome complex for cryo-EM

Recombinant SWR1 was produced in BTI-TN-5B1-4 (High Five) insect cells, and the SWR1–nucleosome complex was assembled as previously described¹². SWR1–nucleosome grids were prepared as previously described, except instead of glow discharge, the grids were cleaned by washing with water and ethyl acetate. Cryo-EM data acquisition, image acquisition and structure reconstruction were conducted using a similar procedure as previously described¹². Data processing and refinement statistics for the two cryo-EM structures are summarized in Extended Data Table 1.

Cryo-EM data collection

A total of 35,076 micrographs were collected using a Titan KRIOS microscope operated at 300 kV. Images were collected on a Falcon IV direct electron detector with a pixel size of 1.1 Å px⁻¹. Images were collected with a defocus range of −0.7 to −1.9 µm, with 1.0 s exposure time and a total dose of 40 e⁻ Å⁻² fractionated over 39 frames.

Cryo-EM data processing

Movie frames were aligned using MotionCor2 (ref. ⁴²), as previously described¹². Contrast transfer function parameters were determined using Gctf⁴³ as previously described¹². Particle picking was performed in cryoSPARC⁴⁴, as previously described¹². Global-resolution and local-resolution estimates were calculated based on the gold-standard Fourier shell correlation (FSC = 0.143) criterion.

The cryo-EM processing workflow for the 3.8 Å SWR1–nucleosome map in configuration I is summarized in Extended Data Fig. 6. First, in the recently collected SWR1–nucleosome dataset, 2D classification in cryoSPARC for 2D classes containing density for SWR1 or the nucleosome resulted in a working particle pool of 1,918,312 particles⁴⁴. These were subdivided into three classes via heterogeneous refinement in cryoSPARC, resulting in class 1 (SWR1–nucleosome complex (15%)), class 2 (SWR1-apo (55%)) and class 3 (nucleosome only (30%)). The subset of 268,805 particles in class 1 (SWR1–nucleosome) was then further classified into five classes via heterogeneous refinement in cryoSPARC, resulting in class 1.1 (SWR1–nucleosome in configuration I (68%)), class 1.2 (SWR1–nucleosome configuration II (17%)), class 1.3 (poorly aligned class (9%)), class 1.4 (poorly aligned class (2%)) and class 1.5 (poorly aligned class (4%)). The particles in class 1.1 were then imported and subjected to 3D refinement in RELION before one round of 3D classification without alignment (T = 30), with a soft mask overlapping the Swc2–bottom gyre DNA interface⁴⁵. This generated two classes: class 1.1.1 (no density for bottom gyre DNA (63%)) and class 1.1.2 (clear density for bottom gyre DNA (37%)). Particles in class 1.1.2 were further selected for 3D refinement in RELION.

Next, in the previously collected dataset, 2D classification in cryoSPARC for 2D classes containing density for SWR1 or the nucleosome resulted in a working particle pool of 296,061 particles. These were subdivided into three classes via heterogeneous refinement in cryoSPARC, resulting in a class 1.1 (SWR1–nucleosome complex (33%)), class 1.2 (SWR1-apo (39%)) and class 1.3 (nucleosome only (28%))⁴⁴. The subset of 96,648 SWR1–nucleosome particles were then further classified into five classes via heterogeneous refinement in cryoSPARC, resulting in class 1.1 (SWR1–nucleosome in configuration I (68%)), class 1.2 (SWR1–nucleosome configuration II (23%)), class 1.3 (poorly aligned class (5%)), class 1.4 (poorly aligned class (2%)) and class 1.5 (poorly aligned class (2%)). Particles in class 1.1 were imported and refined in RELION before one round of 3D classification without alignment (T = 30), with a soft mask overlapping the Swc2–bottom gyre DNA interface. This generated two classes: class 1.1.1 (no density for bottom gyre DNA (16%)) and class 1.1.2 (clear density for bottom density (84%)). Particles in class 1.1.2 were further selected for 3D refinement in RELION⁴⁵. Particles from classes 1.1.2 in the recently collected dataset and 1.1.2 in the previously collected dataset were then merged to generate a working pool of 123,591 particles. The resulting particles were then subjected to 3D refinement and contrast transfer function refinement in RELION with a mask corresponding to the SWR1 subcomplex of Swr1, Arp6, Swc6, Swc2, RuvBL1 and RuvBL2, and the nucleosome to generate the final 3.8 Å SWR1–nucleosome map in configuration I⁴⁵.

The cryo-EM processing workflow for the 4.7 Å SWR1–nucleosome map in configuration II is summarized in Extended Data Fig. 6. First, in the recently collected SWR1–nucleosome dataset, particles in class 1.2 were selected, generating a working pool of 35,102 particles. The subset of particles was further classified into two classes in RELION using 3D classification with alignment (T = 6) in the absence of a mask⁴⁵. This generated class 1.2.1 (SWR1–nucleosome with poor density for the upper gyre DNA (39%)) and class 1.2.2 (SWR1–nucleosome with clearer density of upper gyre DNA (61%)). The particles in class 1.2.2 were selected, generating a working pool of 20,990 particles for 3D refinement in RELION.

Next, in the previously collected SWR1–nucleosome dataset, particles in class 1.2 were selected, generating a working pool of 21,054 particles. The subset of particles was further classified in two classes in RELION using 3D classification with alignment (T = 6) in the absence of a mask⁴⁵. This generated class 1.2.1 (SWR1–nucleosome with poor density for the upper gyre DNA (40%)) and class 1.2.2 (SWR1–nucleosome with clearer density of upper gyre DNA (60%)). The particles in class 1.2.2 were selected, generating a working pool of 12,605 particles for 3D refinement in RELION⁴⁵. Particles from classes 1.2.2 in the recently collected dataset and 1.2.2 in the previously collected dataset were then merged to generate a working pool of 33,595 particles. The resulting particles were then subjected to 3D refinement and contrast transfer function refinement in RELION with a mask corresponding to the SWR1 subcomplex of Swr1, Arp6, Swc6, Swc2, RuvBL1 and RuvBL2, and the nucleosome to generate the final 4.7 Å SWR1–nucleosome map in configuration II.

Model building

For the Swc2 subunit, an initial template was generated using AlphaFold²⁵. Different regions corresponding to secondary structures of the template were manually truncated and docked separately into the recently generated 3.8 Å SWR1–nucleosome map in configuration I in Chimera^12,46, before being further built in Coot⁴⁷. The final coordinates were subjected to real-space refinement in Phenix⁴⁸.

For the 3.8 Å SWR1–nucleosome configuration I map, first the SWR1–nucleosome complex from the previously solved 3.6 Å SWR1–nucleosome structure (Protein Data Bank (PDB) ID 6GEJ) was docked into the density using Chimera^12,46. The coordinates for the DNA were then omitted. Next, the SWR1–nucleosome complex from the previously solved 4.5 Å SWR1–nucleosome structure (PDB ID 6GEN) was superimposed onto the docked structure using RuvBL1 and RuvBL2 as a reference. Coordinates for the superimposed structure were then omitted, with exception to the coordinates for the DNA, which was kept and docked into the 3.8 Å SWR1–nucleosome configuration I map in Chimera, before merging the two PDB models: SWR1–nucleosome DNA omitted and DNA only together. The coordinates corresponding to the previously built Swc2 subunit were then omitted, and the coordinates for the newly built Swc2 model were docked into the map. Additional DNA overhang was then built manually in Coot^12,46,47. The final coordinates were then subjected to real-space refinement in Phenix⁴⁸.

For the 4.7 Å SWR1–nucleosome configuration II map, SWR1 from the previously solved 3.6 Å SWR1–nucleosome structure (PDB ID 6GEJ) was docked into the density using Chimera⁴⁶. The coordinates corresponding to Swc2 were omitted, and the recently built Swc2 was docked together into the density using Chimera and further built in Coot^46,47. The additional DNA overhang was then built manually in Coot. The final coordinates were then subjected to real-space refinement in Phenix⁴⁸.

2D classification of SWR1-mediated nucleosome flipping

First, in the recently collected SWR1–nucleosome dataset, particles in class 2 (SWR1-apo (55%)) were selected, generating a working pool of 594,100 particles. The subset of particles was then further classified into four classes via heterogeneous refinement in cryoSPARC, resulting in class 2.1 (RuvBL1–RuvBL2 only (21%)), class 2.2 (a poorly aligned class (20%)), class 2.3 (SWR1-apo with additional density underneath SWR1 (38%)) and class 2.4 (a poorly aligned class (21%)). Particles in class 2.3 were then selected for 2D classification in RELION⁴⁵.

Next, in the previously collected SWR1–nucleosome dataset, particles in class 2 (SWR1-apo (39%)) were selected, generating a working pool of 115,463 particles. The subset of particles was then further classified into four classes via heterogeneous refinement in cryoSPARC, resulting in class 2.1 (RuvBL1–RuvBL2 only (25%)), class 2.2 (a poorly aligned class (20%)), class 2.3 (SWR1-apo with additional density underneath SWR1 (30%)) and class 2.4 (a poorly aligned class (25%)). Particles in class 2.3 were then selected for 2D classification in RELION. The particles in class 2.3 in the recently collected SWR1–nucleosome dataset and the particles in class 2.3 in the previously collected SWR1–nucleosome dataset were then merged and subjected to multiple rounds of 2D classification in RELION to obtain 2D classes of SWR1-mediated nucleosome flipping.

Statistics and reproducibility

For data relating to Fig. 1, the total number of traces used in each dataset is indicated in each panel and was derived from three independent experiments. For data relating to Fig. 2, the total number of traces used for each dataset is indicated in each panel and was derived from four independent experiments. For data relating to Figs. 3 and 4, two independent experiments were performed, one of which is shown. The total number of traces used for each dataset is indicated in each panel. All gels were independently and successfully repeated twice.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

[ad_2]

Source link

November 6, 2024
AARS1 and AARS2 sense l-lactate to regulate cGAS as global lysine lactyltransferases

[ad_1]
Zhang, D. et al. Metabolic regulation of gene expression by histone lactylation. Nature 574, 575–580 (2019).

Article
ADS
CAS
PubMed
PubMed Central

Google Scholar
Kraut, J. A. & Madias, N. E. Lactic acidosis. N. Engl. J. Med. 371, 2309–2319 (2014).

Article
PubMed

Google Scholar
Certo, M., Tsai, C. H., Pucino, V., Ho, P. C. & Mauro, C. Lactate modulation of immune responses in inflammatory versus tumour microenvironments. Nat. Rev. Immunol. 21, 151–161 (2021).

Article
CAS
PubMed

Google Scholar
Felmlee, M. A., Jones, R. S., Rodriguez-Cruz, V., Follman, K. E. & Morris, M. E. Monocarboxylate transporters (SLC16): function, regulation, and role in health and disease. Pharmacol. Rev. 72, 466–485 (2020).

Article
CAS
PubMed
PubMed Central

Google Scholar
Wang, N. et al. Structural basis of human monocarboxylate transporter 1 inhibition by anti-cancer drug candidates. Cell 184, 370–383.e13 (2021).

Article
CAS
PubMed

Google Scholar
Chen, Y. et al. Metabolic regulation of homologous recombination repair by MRE11 lactylation. Cell 187, 294–311.e21 (2024).

Article
CAS
PubMed

Google Scholar
Moreno-Yruela, C. et al. Class I histone deacetylases (HDAC1–3) are histone lysine delactylases. Sci. Adv. 8, eabi6696 (2022).

Article
ADS
CAS
PubMed
PubMed Central

Google Scholar
Colegio, O. R. et al. Functional polarization of tumour-associated macrophages by tumour-derived lactic acid. Nature 513, 559–563 (2014).

Article
ADS
CAS
PubMed
PubMed Central

Google Scholar
Faubert, B. et al. Lactate metabolism in human lung tumors. Cell 171, 358–371.e9 (2017).

Article
CAS
PubMed
PubMed Central

Google Scholar
Ablasser, A. & Chen, Z. J. cGAS in action: expanding roles in immunity and inflammation. Science 363, eaat8657 (2019).

Article
CAS
PubMed

Google Scholar
Ishikawa, H., Ma, Z. & Barber, G. N. STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity. Nature 461, 788–792 (2009).

Article
ADS
CAS
PubMed
PubMed Central

Google Scholar
Wu, J. et al. Cyclic GMP-AMP is an endogenous second messenger in innate immune signaling by cytosolic DNA. Science 339, 826–830 (2013).

Article
ADS
CAS
PubMed

Google Scholar
Sun, L., Wu, J., Du, F., Chen, X. & Chen, Z. J. Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science 339, 786–791 (2013).

Article
ADS
CAS
PubMed

Google Scholar
Gao, P. et al. Cyclic [G(2′,5′)pA(3′,5′)p] is the metazoan second messenger produced by DNA-activated cyclic GMP-AMP synthase. Cell 153, 1094–1107 (2013).

Article
CAS
PubMed
PubMed Central

Google Scholar
Ablasser, A. et al. cGAS produces a 2′-5′-linked cyclic dinucleotide second messenger that activates STING. Nature 498, 380–384 (2013).

Article
ADS
CAS
PubMed
PubMed Central

Google Scholar
Diner, E. J. et al. The innate immune DNA sensor cGAS produces a noncanonical cyclic dinucleotide that activates human STING. Cell Rep. 3, 1355–1561 (2013).

Article
CAS
PubMed
PubMed Central

Google Scholar
Zhang, X. et al. Cyclic GMP-AMP containing mixed phosphodiester linkages is an endogenous high-affinity ligand for STING. Mol. Cell 51, 226–235 (2013).

Article
CAS
PubMed

Google Scholar
Dai, J. et al. Acetylation blocks cGAS activity and inhibits self-DNA-induced autoimmunity. Cell 176, 1447–1460.e14 (2019).

Article
CAS
PubMed
PubMed Central

Google Scholar
Li, T. et al. Phosphorylation and chromatin tethering prevent cGAS activation during mitosis. Science 371, eabc5386 (2021).

Article
ADS
CAS
PubMed
PubMed Central

Google Scholar
Barnett, K. C. et al. Phosphoinositide interactions position cGAS at the plasma membrane to ensure efficient distinction between self- and viral DNA. Cell 176, 1432–1446.e11 (2019).

Article
CAS
PubMed
PubMed Central

Google Scholar
Brooks, G. A. The science and translation of lactate shuttle theory. Cell Metab. 27, 757–785 (2018).

Article
CAS
PubMed

Google Scholar
Ibba, M. & Soll, D. Aminoacyl-tRNA synthesis. Annu. Rev. Biochem. 69, 617–650 (2000).

Article
CAS
PubMed

Google Scholar
Soderberg, O. et al. Characterizing proteins and their interactions in cells and tissues using the in situ proximity ligation assay. Methods 45, 227–232 (2008).

Article
PubMed

Google Scholar
de la Torre, D. & Chin, J. W. Reprogramming the genetic code. Nat. Rev. Genet. 22, 169–184 (2021).

Article
PubMed

Google Scholar
Chin, J. W. Expanding and reprogramming the genetic code of cells and animals. Annu. Rev. Biochem. 83, 379–408 (2014).

Article
CAS
PubMed

Google Scholar
Chin, J. W. Expanding and reprogramming the genetic code. Nature 550, 53–60 (2017).

Article
ADS
CAS
PubMed

Google Scholar
Neumann, H., Peak-Chew, S. Y. & Chin, J. W. Genetically encoding N^ε-acetyllysine in recombinant proteins. Nat. Chem. Biol. 4, 232–234 (2008).

Article
CAS
PubMed

Google Scholar
Gao, D. et al. Activation of cyclic GMP-AMP synthase by self-DNA causes autoimmune diseases. Proc. Natl Acad. Sci. USA 112, E5699–E5705 (2015).

Article
CAS
PubMed
PubMed Central

Google Scholar
Gluck, S. et al. Innate immune sensing of cytosolic chromatin fragments through cGAS promotes senescence. Nat. Cell Biol. 19, 1061–1070 (2017).

Article
CAS
PubMed
PubMed Central

Google Scholar
Dou, Z. et al. Cytoplasmic chromatin triggers inflammation in senescence and cancer. Nature 550, 402–406 (2017).

Article
ADS
CAS
PubMed
PubMed Central

Google Scholar
Yu, C. H. et al. TDP-43 triggers mitochondrial DNA release via mPTP to activate cGAS/STING in ALS. Cell 183, 636–649.e18 (2020).

Article
CAS
PubMed
PubMed Central

Google Scholar
Sprenger, H. G. et al. Cellular pyrimidine imbalance triggers mitochondrial DNA-dependent innate immunity. Nat. Metab. 3, 636–650 (2021).

Article
CAS
PubMed
PubMed Central

Google Scholar
Mackenzie, K. J. et al. cGAS surveillance of micronuclei links genome instability to innate immunity. Nature 548, 461–465 (2017).

Article
ADS
CAS
PubMed
PubMed Central

Google Scholar
Harding, S. M. et al. Mitotic progression following DNA damage enables pattern recognition within micronuclei. Nature 548, 466–470 (2017).

Article
ADS
CAS
PubMed
PubMed Central

Google Scholar
Stetson, D. B., Ko, J. S., Heidmann, T. & Medzhitov, R. Trex1 prevents cell-intrinsic initiation of autoimmunity. Cell 134, 587–598 (2008).

Article
CAS
PubMed
PubMed Central

Google Scholar
Gray, E. E., Treuting, P. M., Woodward, J. J. & Stetson, D. B. Cutting edge: cGAS is required for lethal autoimmune disease in the Trex1-deficient mouse model of Aicardi–Goutieres syndrome. J. Immunol. 195, 1939–1943 (2015).

Article
CAS
PubMed

Google Scholar
Bourin, M., Petit-Demouliere, B., Dhonnchadha, B. N. & Hascoet, M. Animal models of anxiety in mice. Fundam. Clin. Pharmacol. 21, 567–574 (2007).

Article
CAS
PubMed

Google Scholar
Steimer, T. Animal models of anxiety disorders in rats and mice: some conceptual issues. Dialogues Clin. Neurosci. 13, 495–506 (2011).

Article
PubMed
PubMed Central

Google Scholar
Choudhary, C., Weinert, B. T., Nishida, Y., Verdin, E. & Mann, M. The growing landscape of lysine acetylation links metabolism and cell signalling. Nat. Rev. Mol. Cell Biol. 15, 536–550 (2014).

Article
CAS
PubMed

Google Scholar
Varner, E. L. et al. Quantification of lactoyl-CoA (lactyl-CoA) by liquid chromatography mass spectrometry in mammalian cells and tissues. Open Biol. 10, 200187 (2020).

Article
CAS
PubMed
PubMed Central

Google Scholar
Kim, S. C. et al. A clean, more efficient method for in-solution digestion of protein mixtures without detergent or urea. J. Proteome Res. 5, 3446–3452 (2006).

Article
CAS
PubMed

Google Scholar
Chen, Y. et al. Quantitative acetylome analysis reveals the roles of SIRT1 in regulating diverse substrates and cellular pathways. Mol. Cell. Proteomics 11, 1048–1062 (2012).

Article
CAS
PubMed
PubMed Central

Google Scholar

Mechanism of BRCA1–BARD1 function in DNA end resection and DNA protection

[ad_1]

Cloning, expression and purification of recombinant proteins

Human wild-type DNA2, helicase-dead DNA2 K654R and nuclease-dead DNA2 D277A were expressed in Sf9 insect cells and purified by affinity chromatography taking advantage of the N-terminal 6×His tag and the C-terminal FLAG tag³⁵. Yeast nuclease-dead Dna2 E675A was expressed in S. cerevisiae and purified using the N-terminal FLAG tag and the C-terminal 6×His tag⁵¹. Full-length wild-type WRN, helicase-dead WRN K577M, exonuclease-dead WRN E84A, WRN fragments, BLM, as well as wild-type CtIP and its variants were purified exploiting the MBP tag at the N terminus and 10×His tag at the C terminus^{23,28,35,38,52,53}. The MBP tag was removed during purification by cleavage with PreScission protease. For the expression of phosphorylated wild-type CtIP (pCtIP) and its variants, Sf9 cells were treated with 50 nM Okadaic acid (APExBIO) 3 h before collection to preserve the phosphorylated state of the proteins, and 1 µM camptothecin (Sigma) 1 h before collection to increase the activation of the protein phosphorylation cascade. For the expression of dephosphorylated WRN (λWRN) and CtIP (λCtIP), proteins were incubated with λ phosphatase at room temperature for 30 min during purification. The MRN and MRE11–RAD50 complexes were obtained using the 6×His tag and 3×FLAG tag at the C termini of MRE11 and RAD50, respectively²³. Human wild-type EXO1, as well as nuclease-dead EXO1 D173A, were purified using M2 anti-FLAG affinity resin (Sigma) and HiTrap SP HP cation exchange chromatography column (Cytiva)^26,54. EXO1Δ1 (Δ353–846) fragment, along with a matched wild-type control, were purified omitting the HiTrap SP HP cation exchange chromatography step. E. coli ExoIII, ScaI and SspI were purchased from New England Biolabs. Wild-type human RAD51, as well as the indicated human RAD51 variants and yeast Rad51, were expressed in BL21 (DE3)pLysS E. coli cells and purified using amylose affinity chromatography followed by HiTrap Q chromatography (Cytiva)⁴⁸.

The BRCA1 sequence was codon optimized for the expression in Sf9 cells (Biomatik) with flanked NheI and XmaI restriction sites. The full-length sequence is listed in Supplementary Table 1 provided in the Supplementary Information. The BRCA1 gene was then cloned into pFB-2×MBP-CtIP-10×His⁵⁵ to generate pFB-2×MBP-BRCA1co-10×His. The cloning created a fusion construct with the 2×MBP tag at the N terminus and the 10×His tag at the C terminus. All BRCA1 variants were cloned from pFB-2×MBP-BRCA1co-10×His using the primers listed in Supplementary Table 3 provided in the Supplementary Information. Similarly, the BARD1 sequence was codon optimized for the expression in Sf9 cells (Supplementary Table 2 provided in the Supplementary Information, Biomatik) with BamHI and XmaI restriction sites. The BARD1 gene was then cloned into pFB-RAD50co-FLAG²³ to generate pFB-BARD1co-FLAG (BARD1 with C-terminal FLAG tag). All BARD1 variants were cloned from pFB-BARD1co-FLAG using the primers listed in Supplementary Table 3 provided in the Supplementary Information. The BRCA1–BARD1 complex, BRCA1 on its own and all variants were expressed in Sf9 cells using the SFX Insect serum-free medium (Hyclone) and the Bac-to-Bac expression system (Invitrogen), according to the manufacturer’s recommendations. Frozen Sf9 pellets from 1 l of culture were resuspended in lysis buffer (50 mM Tris-HCl pH 7.5, 1 mM ethylenediaminetetraacetic (EDTA), 1:400 protease inhibitor cocktail (Sigma, P8340), 30 µg ml⁻¹ leupeptin (Merck Millipore), 1 mM phenylmethylsulfonyl fluoride (PMSF), 1 mM dithiothreitol (DTT), 0.5% NP40) and incubated at 4 °C for 20 min. Glycerol was added to a final concentration of 25%, NaCl was added to a final concentration of 325 mM and the cell suspension was incubated at 4 °C for 20 min. The cell suspension was centrifuged at 55,000g at 4 °C for 30 min. The soluble extract was incubated with amylose resin (New England Biolabs) at 4 °C for 1 h. The resin was washed with amylose wash buffer (50 mM Tris-HCl pH 7.5, 2 mM β-mercaptoethanol, 300 mM NaCl, 10% glycerol, 1 mM PMSF). Proteins were eluted using amylose elution buffer (50 mM Tris-HCl pH 7.5, 2 mM β-mercaptoethanol, 300 mM NaCl, 10% glycerol, 1 mM PMSF, 10 mM maltose (Sigma), 20 mM imidazole (Sigma)). The solution was immediately loaded onto pre-equilibrated Ni-NTA agarose resin (Qiagen) at 4 °C, in flow. The resin was washed with Ni-NTA buffer 1 (50 mM Tris-HCl pH 7.5, 2 mM β-mercaptoethanol, 10% glycerol, 1 mM PMSF, 20 mM imidazole and 1 M NaCl for BRCA1 or 0.3 M NaCl for BRCA1–BARD1), and subsequently with Ni-NTA buffer 2 (50 mM Tris-HCl pH 7.5, 2 mM β-mercaptoethanol, 150 mM NaCl, 10% glycerol, 1 mM PMSF, 20 mM imidazole). Proteins were eluted with Ni-NTA elution buffer (50 mM Tris-HCl pH 7.5, 2 mM β-mercaptoethanol, 150 mM NaCl, 10% glycerol, 1 mM PMSF, 200 mM imidazole). Fractions containing high protein concentration as estimated by the Bradford assay were pooled, aliquoted, snap-frozen in liquid nitrogen and stored at −80 °C. The BRCA1–BARD1 mutants were purified in the same way. We note that attempts to cleave the MBP tag before Ni-NTA purification resulted in protein precipitation. We could obtain up to roughly 0.6 mg of BRCA1–BARD1 from 1 l of media (approximate stock concentration, 800 nM). For the expression of dephosphorylated BRCA1–BARD1 (λBRCA1–BARD1), the complex was incubated with λ phosphatase at room temperature for 30 min during purification, along with a matched control that was similarly incubated but without λ phosphatase.

Human RPA sequence was cloned from p11d–tRPA construct⁵⁶ using the primers listed in Supplementary Table 3 provided in the Supplementary Information. Whereas both RPA1 and RPA2 were flanked by the BamHI and NheI restriction sites, RPA3 was flanked by SalI and XbaI. These restriction enzymes were used to generate pFB-RPA1, pFB-RPA2 and pFB-6×His-RPA3 insect expression vectors used for the protein purification. RPA was expressed in Sf9 cells in SFX Insect serum-free medium (Hyclone) using the Bac-to-Bac expression system (Invitrogen), according to the manufacturer’s recommendations. A frozen Sf9 pellet from 2 l of culture was resuspended in lysis buffer (50 mM Tris-HCl pH 7.5, 2 mM β-mercaptoethanol, 1:200 protease inhibitor cocktail, 60 µg ml⁻¹ leupeptin, 1 mM PMSF, 20 mM imidazole, 0.1% NP40) and incubated at 4 °C for 20 min. Glycerol was added to a final concentration of 25%, KCl was added to a final concentration of 325 mM and the cell suspension was incubated at 4 °C for 30 min. The cell suspension was centrifuged at 55,000g at 4 °C for 30 min. The soluble extract was incubated with Ni-NTA affinity resin at 4 °C for 1 h. Ni-NTA resin was washed with wash buffer (50 mM Tris-HCl pH 7.5, 2 mM β-mercaptoethanol, 1 mM PMSF, 10% glycerol, 500 mM KCl, 20 mM imidazole, 0.1% NP40). Protein was eluted using wash buffer containing 300 mM imidazole. The eluate was diluted by adding 2 volumes of buffer A (30 mM HEPES pH 7.5, 1 mM DTT, 1 mM PMSF, 10% glycerol, 500 mM KCl, 0.25 mM EDTA, 0.01% NP40). The diluted fractions were purified on a HiTrap Blue HP column (Cytiva) followed by HiTrap desalting column (Cytiva) as described⁵⁷. Peak desalted fractions were pooled, diluted with 1 volume of buffer B (30 mM HEPES pH 7.5, 1 mM DTT, 1 mM PMSF, 10% glycerol, 0.25 mM EDTA) and loaded onto two 5 ml HiTrap Heparin columns (Cytiva) connected in tandem. Proteins were eluted using a 30 ml gradient of 50 mM to 1 M KCl in 1 ml fractions. Peak fractions were pooled and diluted to a final concentration of roughly 100 mM KCl with buffer B. The diluted eluate was loaded and further purified on a HiTrap Q column (Cytiva) as previously described⁵⁷. We could obtain roughly 45 mg of human RPA from 2 l insect cells. The sequences of all primers used for cloning in this study are listed in Supplementary Table 3 provided in the Supplementary Information. Purified recombinant proteins were analysed by using SDS–PAGE denaturing electrophoresis and stained with Coomassie Brilliant Blue (VWR). The final images were acquired with a photo scanner operated with Epson Scan v.3.9.4.0 US software and CanoScan 9000F Mark II scanner operated with ImageCapture v.6.6(525) software.

The sgCtIP (CTCCCGGATCTATACTCCAC) used for depletion of endogenous CtIP in RPE1 EXO1^+/+ and RPE1 EXO1^−/− cells was cloned into pLentiCRISPR-v2 using BsmBI. The PAM-sequence of this guide RNA (gRNA) was mutated in the full-length pcDNA3.1 CtIP overexpressing constructs (pcDNA3.1_CtIP-WT-2×FLAG and pcDNA3.1_CtIP-S327A-2×FLAG) using site-directed mutagenesis to render the exogenous CtIP expression insensitive to CRISPR-mediated depletion. Subsequently, the coding sequence was cloned into the Gateway entry vector pENTR_1A using KpnI and NotI before transferring it to the destination vector pCW57.1-Zeo using a Gateway LR reaction.

Sequence analysis of BRCA1 and BARD1 proteins

Alignment of the BRCA1 region 931–1171 and of the BARD1 region 123–261 were generated using the MAFFT method⁵⁸ and represented using Jalview⁵⁹.

Preparation of DNA substrates

The sequences of all oligonucleotides used for DNA substrate preparation are listed in Supplementary Table 4 provided in the Supplementary Information. The oligonucleotide-based Y-structured DNA substrate was prepared with the oligonucleotides X12-3HJ3 and X12-3TOPLbis³⁵. The oligonucleotide-based 70 bp-long dsDNA substrate was prepared with the oligonucleotides PC210 and PC211. X12-3HJ3 and PC210 oligonucleotides were ³²P-labelled at the 3′ terminus with (α-³²P)dCTP (Hartmann Analytic) and terminal transferase (New England Biolabs) according to the manufacturer’s instructions. The oligonucleotide-based 70 bp-long dsDNA biotinylated at the 5′ terminus was prepared using the oligonucleotides PC206 and PC217. PC206 oligonucleotide was ³²P-labelled at the 5′ terminus with (γ-³²P)ATP (Hartmann Analytic) and T4 PNK (New England Biolabs) according to the manufacturer’s instructions. The randomly labelled 2.2 kbp-long substrate was prepared by amplifying the human NBS1 gene by PCR reaction containing 66 nM (α-³²P)dCTP (Hartmann Analytic) with the standard dNTPs concentration (200 µM each)²⁷. When randomly labelled ssDNA was required, the 2.2 kbp-long substrate was heated at 95 °C for 5 min before the experiments. The HindIII digest of λ DNA (New England Biolabs) was labelled by fill-in at the 3′ end with (α-³²P)dCTP (Hartmann Analytic), dGTP, dATP (0.25 mM each) and 5 U of the Klenow fragment of DNA polymerase I exo- (lacking the 3′–5′ and 5′–3′ exonuclease activities of DNA polymerase I) (New England Biolabs). Unincorporated nucleotides were removed with Micro Bio-Spin P-30 Tris chromatography columns (BioRad). When the heat-denatured substrate was needed, the substrate was incubated at 95 °C for 5 min to obtain ssDNA²⁷. pUC19-based dsDNA substrate was prepared by digesting the pUC19 plasmid with HindIII-HF restriction enzyme (New England Biolabs) according to the manufacturer’s instructions, and purified by phenol-chloroform extraction and ethanol precipitation. The resulting linear dsDNA was labelled by fill-in at the 3′ end with 0.25 mM of (α-³²P)dCTP (Hartmann Analytic), dGTP, dATP and 5 U of the Klenow fragment of DNA polymerase I exo- (New England Biolabs). Unincorporated nucleotides were removed using Micro Bio-Spin P-30 Tris chromatography columns (BioRad). For the ATPase assay with wild-type DNA2 and helicase-dead DNA2 D277A, the 10.3 kbp-long pFB-MBP-hMLH3 plasmid⁶⁰ was linearized with NheI (New England Biolabs) and purified with QIAquick PCR purification kit (Qiagen). The substrate was denatured at 95 °C for 5 min to obtain ssDNA. The overhanging substrate used for single-molecule magnetic tweezer experiments was prepared as previously described^61,62. Briefly, the main 6.6 kbp-long fragment was prepared from pNLRep plasmid⁶³ using the restriction enzymes BamHI and BsrGI (New England Biolabs). Furthermore, a 63 nt-long ssDNA gap was introduced using the nicking enzyme Nt.BbvCI (New England Biolabs). The gap was then filled by hybridizing a 25 nt-long DNA oligomer carrying an extra 40 nt-long polythimidine tail at the 5′ end (overhang), followed by 3′ end ligation inside the gap. Subsequently, 600 bp-long DNA handles carrying either several digoxigenin or biotin modifications were attached at either end. The handles were produced by PCR using as a template the plasmids pBlueScript II SK+ (digoxigenin, Dig handle Forward and Dig handle Reverse primers) or pNLRep (biotin, Bio handle Forward and Bio handle Reverse primers), respectively, in the presence of digoxigenin and biotin-modified nucleotides and digested with BamHI or BsrGI (New England Biolabs), respectively. The final construct shows the 5′ overhang at roughly 0.5 kbp distance from the surface attachment handle.

DNA end resection and protection assays

DNA endonuclease assays with the MRN complex and pCtIP were performed in 15 µl volume in nuclease buffer containing 25 mM Tris-acetate pH 7.5, 5 mM magnesium acetate, 1 mM manganese acetate, 1 mM ATP, 1 mM DTT, 0.25 mg ml⁻¹ bovine serum albumin (BSA) (New England Biolabs), 1 mM phosphoenolpyruvate (PEP), 80 U ml⁻¹ pyruvate kinase (Sigma) and 1 nM substrate (in molecules). Biotinylated DNA ends were blocked by adding 15 nM monovalent streptavidin (a kind gift from M. Howarth, University of Oxford)⁶⁴ and by incubating the samples at room temperature for 5 min. Different from above, DNA exonuclease assays with recombinant MRE11–RAD50 were carried out in nuclease buffer containing 3 mM manganese acetate. Recombinant proteins were added on ice and the reactions were incubated at 37 °C for 2 h. Reactions were stopped by adding 0.5 µl of 0.5 M EDTA and 1 μl Proteinase K (Roche, 18 mg ml⁻¹), and incubated at 50 °C for 30 min. An equal amount of formamide dye (95% [v/v] formamide, 20 mM EDTA, bromophenol blue) was added, samples were heated at 95 °C for 4 min and separated on 15% denaturing polyacrylamide gels (ratio acrylamide:bisacrylamide 19:1, BioRad). After fixing in a solution containing 40% methanol, 10% acetic acid and 5% glycerol for 30 min, the gels were dried on 3MM paper (Whatman), exposed to storage phosphor screens (GE Healthcare) and scanned with Typhoon FLA 9500 Phosphor Imager (GE Healthcare).

DNA end-resection assays with PCR-based or pUC19-based dsDNA substrate were performed in a 15 µl volume in 25 mM Tris-acetate pH 7.5, 2 mM magnesium acetate, 1 mM ATP, 1 mM DTT, 0.1 mg ml⁻¹ BSA, 1 mM PEP, 80 U ml⁻¹ pyruvate kinase and 1 nM substrate (in molecules). NaCl was added to the reaction buffer to a final concentration of 50 mM (unless indicated otherwise) taking into account the salt coming from protein storage or dilution buffers. When randomly labelled ssDNA was used, 2 nM substrate (in molecules) was used. Where indicated, AMP-PNP (Toronto Research Chemicals) or ATP-γ-S (Cayman Chemical) were used instead of ATP. Human RPA was included to saturate all ssDNA, as indicated. Further recombinant proteins were then added on ice and the reactions were incubated at 37 °C for 30 min, unless indicated otherwise. Reactions were stopped by adding 5 µl of 2% stop solution (150 mM EDTA, 2% SDS, 30% glycerol, bromophenol blue) and 1 µl of Proteinase K (Roche, 18 mg ml⁻¹) and incubated at 37 °C for 15 min. Samples were analysed by 1% agarose gel electrophoresis. Gels were dried on DE81 chromatography paper (Whatman) and analysed as described above.

The nuclease assays with λ DNA/HindIII-based substrates were carried out similarly as described above with the following differences. DNA was used at 0.15 nM (in molecules), the reaction buffer contained 3 mM magnesium acetate, 30 mM NaCl and, unless indicated otherwise, reactions were incubated at 37 °C for 1 h. DNA protection assays with PCR-based dsDNA substrate were carried out as indicated above for the respective DNA end resection assays, except RAD51, BRCA1–BARD1 or BRCA1 were pre-incubated at 37 °C for 10 min before the addition of the other recombinant proteins. Protection reactions were stopped by adding 0.5 µl of 0.5 M EDTA and 1 μl of Proteinase K (Roche, 18 mg ml⁻¹), and incubated at 50 °C for 30 min. An equal amount of formamide dye (95% [v/v] formamide, 20 mM EDTA, bromophenol blue) was added, and samples were heated at 95 °C for 4 min and separated on 20% denaturing polyacrylamide gels (ratio acrylamide:bisacrylamide 19:1). After fixing in a solution containing 40% methanol, 10% acetic acid and 5% glycerol for 30 min, the gels were dried on 3MM paper (Whatman) and analysed as described above. Protection assays with pUC19-based dsDNA substrate were carried out as indicated above for the respective DNA end resection assays. Signals were quantified using ImageJ2 (National Institutes of Health, NIH) and plotted with Prism 10 (GraphPad).

Helicase assays

Helicase assays with the oligonucleotide-based Y-structured DNA substrate were performed in 15 µl volume in reaction buffer (25 mM Tris-acetate pH 7.5, 5 mM magnesium acetate, 1 mM ATP, 1 mM DTT, 0.1 mg ml⁻¹ BSA, 1 mM PEP, 80 U ml⁻¹ pyruvate kinase and 50 mM NaCl) with 0.1 nM DNA substrate (in molecules). Recombinant proteins were added as indicated. Reactions were incubated at 37 °C for 30 min and stopped by adding 5 µl of 2% stop solution (150 mM EDTA, 2% SDS, 30% glycerol, bromophenol blue) and 1 µl of Proteinase K (Roche, 18 mg ml⁻¹) and incubated at 37 °C for 10 min. To avoid re-annealing of the substrate, the 2% stop solution was supplemented with a 20-fold excess of the unlabelled oligonucleotide with the same sequence as the ³²P-labelled one. The products were separated by 10% polyacrylamide gel electrophoresis, dried on 17 CHR chromatography paper (Whatman) and analysed as described for resection assays. Helicase assays with PCR-based, pUC19-based dsDNA substrate or HindIII digest of λ DNA were performed as described for the respective DNA end resection assays. Signals were quantified using ImageJ2 (NIH) and plotted with Prism 10 (GraphPad).

ATPase assays

ATPase assays with recombinant WRN were performed in 25 mM Tris-acetate pH 7.5, 5 mM magnesium acetate, 1 mM DTT, 0.1 mg ml⁻¹ BSA, 1 mM ATP, 100 mM NaCl, 1 nM of (γ-³²P)ATP (Hartmann Analytic) and 0.1 nM (in molecules) of the X12-3HJ3 oligonucleotide used to prepare the Y-structured DNA substrate used in the helicase assays. RPA and BRCA1–BARD1 or BRCA1 were added on ice and samples were pre-incubated at 37 °C for 10 min. WRN was then added and reactions were incubated at 37 °C for 30 min. ATPase assays with recombinant wild-type DNA2 and nuclease-dead DNA2 D277A were performed in 25 mM Tris-acetate pH 7.5, 3 mM magnesium acetate, 1 mM DTT, 0.1 mg ml⁻¹ BSA, 1 mM ATP, 20 mM NaCl, 1 nM of (γ-³²P)ATP (Hartmann Analytic) and 0.32 nM (in molecules) of a heat-denatured 10.3 kbp-long dsDNA as a substrate. RPA and indicated proteins were added on ice and samples were incubated at 37 °C for 15 min. Reactions were stopped with 1.1 µl of 0.5 M EDTA, and separated using thin layer chromatography plates (Merck) with 0.3 M LiCl and 0.3 M formic acid as the mobile phase. Dried plates were exposed to storage phosphor screens (GE Healthcare) and scanned with Typhoon FLA 9500 Phosphor Imager (GE Healthcare). Signals were quantified using ImageJ2 (NIH) and plotted with Prism 10 (GraphPad).

Protein-interaction assays

To test the interaction between BRCA1–BARD1 and WRN or EXO1, 1 μg of anti-BRCA1 antibody (Santa Cruz Biotechnology, sc-6954) or anti-WRN antibody (Cell Signaling, 4666S) were captured on 10 μl Protein G magnetic beads (Dynabeads, Invitrogen) by incubating at 4 °C for 1 h with gentle rotation in 50 μl of PBS-T (PBS with 0.1% Tween-20, Sigma). The beads were washed twice on a magnetic rack with 150 μl of PBS-T. The beads were then mixed with 1 μg of the bait in 60 μl of immunoprecipitation buffer (25 mM Tris-HCl pH 7.5, 1 mM DTT, 3 mM EDTA, 0.20 μg μl⁻¹ BSA, 100 mM NaCl) and incubated at 4 °C for 1 h with gentle rotation. Beads were washed three times with 150 μl of wash buffer (25 mM Tris-HCl pH 7.5, 1 mM DTT, 3 mM EDTA, 80 mM NaCl, 0.05% Triton-X, Sigma). Then 1 μg of the prey was added to the beads in 60 μl of immunoprecipitation buffer (25 mM Tris-HCl pH 7.5, 1 mM DTT, 3 mM EDTA, 0.20 μg μl⁻¹ BSA, 100 mM NaCl) and incubated at 4 °C for 1 h with gentle rotation. Beads were again washed three times with 150 μl of wash buffer (25 mM Tris-HCl pH 7.5, 1 mM DTT, 3 mM EDTA, 80 mM NaCl, 0.05% Triton-X) and proteins were eluted by boiling the beads in SDS buffer (50 mM Tris-HCl pH 6.8, 1.6% SDS, 100 mM DTT, 10% glycerol, 0.01% bromophenol blue) at 95 °C for 3 min. Avidin (Sigma) was added to the eluate as a stabilizer. The eluate was separated on a 7.5% SDS–PAGE gel and proteins were detected by western blotting using anti-BRCA1 antibody (Santa Cruz Biotechnology, sc-6954, 1:1,000), anti-His antibody (Invitrogen PA1-983B, 1:1,000) or anti-FLAG antibody (Sigma, F3165, 1:1,000). The final images were acquired with Fusion FX7 capture software (Vilber Imaging).

Mass photometry characterization of protein complexes

Mass photometry measurements were performed on a TwoMP mass photometer (Refeyn Ltd). First, borosilicate microscope glass plate (No. 1.5 H thickness, 24 × 50 mm, VWR) were cleaned by sequential soaking in Milli-Q-water, isopropanol and Milli-Q-water followed by drying under a stream of clean nitrogen. Next, silicone gaskets (CultureWell Reusable Gasket, Grace Bio-Labs) were placed on the clean coverslip to create a defined well for sample delivery. To convert optical reflection-interference contrast into a molecular mass, a known protein size marker (NativeMark Unstained Protein Standard, Invitrogen) was measured on the same day. For mass measurements, gaskets were filled with 18 μl of measurement buffer (25 mM Tris-HCl pH 7.5, 1 mM ATP, 3 mM magnesium acetate) to allow focusing the microscope onto the coverslip surface. Subsequently, 40 nM of either BRCA1 or BRCA1–BARD1 were added into the well (final volume, 20 μl) and sample binding to the coverslip surface was monitored for 1 min using the software AcquireMP (Refeyn Ltd). Data analysis was performed using DiscoverMP software (Refeyn Ltd).

Single-molecule magnetic tweezer experiments

Single-molecule magnetic tweezer experiments were carried out in a custom-built magnetic tweezers setup and operated using a self-developed code in Labview (2016, National Instruments)⁶⁵. The DNA constructs were linked at their biotinylated ends with streptavidin-coated magnetic beads (Dynabeads M280, Thermo Fisher Scientific) and flushed into the flow cell, where the bottom slide was coated with antidigoxigenin to ensure surface-specific binding. Moving the magnet closer to the flow cell resulted in the stretching of the DNA molecules that were attached to a magnetic bead. Tracking of the magnetic beads for all measurements was conducted at 300 Hz using video microscopy and real-time GPU-accelerated image analysis⁶⁶. The magnetic forces were calibrated based on fluctuation analysis⁶⁷. The measurements were performed in a reaction buffer (25 mM Tris-acetate pH 7.5, 2 mM magnesium acetate, 1 mM ATP, 1 mM DTT, 0.1 mg ml⁻¹ BSA), with the indicated protein concentrations at a temperature of 37 °C and forces between 15 and 25 pN. The analysis of the recorded traces was conducted with a custom written MATLAB program⁶⁸. We considered only traces from measurements in which the magnetic bead position was traceable for at least 300 s. The acquired processivity and velocity for the unwinding events were calculated by fitting linear segments to parts of the recorded traces with roughly constant velocity, which were used to construct the histograms and for statistical analysis. To quantify the ratio of rewinding/unwinding events, the total number of the two events, acquired as described above, was determined for a fixed period of 300 s for each recorded trace. To characterize the different protein combinations (Fig. 3c) and WRN variants (Extended Data Fig. 7e), the difference between the maximum value and the minimum value of DNA extension for a given molecule was calculated during the first 300 s and expressed as ΔDNA-length. Each dot represents one measured molecule.

Cell lines

The RPE1 hTERT were purchased from American Type Culture Collection (ATCC). The RPE1 hTERT PAC^−/−TP53^−/− cell line (referred to as RPE1 EXO1^+/+ in this paper)⁴⁵ was used to generate RPE1 hTERT PAC^−/−TP53^−/−EXO1^−/− (referred to as RPE1 EXO1^−/−) cells by nucleofection of pLentiCRISPR_v2 containing the sgEXO1 (GCGTGGGATTGGATTAGCAA) as described before⁴⁵. After clonal selection, genotyping was performed to confirm indel formation using target locus PCR amplification and Sanger sequencing, followed by TIDE (tracking of indels by decomposition) analysis. RPE1 EXO1^+/+ and EXO1^−/− cells inducibly expressing exogenous CtIP-WT or CtIP-S327A were obtained by viral transduction with pCW57.1_Zeo-CtIP-WT-2×FLAG or pCW57.1_Zeo-CtIP-S327A-2×FLAG.

U2OS cells were originally bought from ATCC. U2OS-derived cells, carrying green fluorescent protein (GFP), GFP-CtIP-WT or GFP-CtIP-S327A mutant¹⁶, were grown in DMEM medium (Sigma). Media were supplemented with 10% fetal bovine serum (Sigma), 2 mM l-glutamine (Sigma), 100 U ml⁻¹ penicillin and 100 μg ml⁻¹ streptomycin (Sigma). U2OS cells were last authenticated in June 2024 by the GenePrint 10 System (Promega) using short tandem repeat profiling, and data were analysed using genemapper id-x v.1.2 software (Applied Biosystems) at the genomic core facility of the Instituto de Investigaciones Biomedicas Sols-Morreale. All cell lines were routinely tested for mycoplasm contamination. All the experiments performed here used mycoplasm-free cell lines.

Viral transductions and transfections

Third-generation packaging vectors pMDLg/pRRE, pRSV-Rev, pMD2.g and a lentiviral expression vector (pLentiCRISPR-v2 or pCW57.1) were transfected to human embryonic kidney (HEK) 293T using jetPEI (Polyplus Transfection) to produce lentiviral particles. The HEK 293T cell line was originally purchased from ATCC. The medium was refreshed 16 h post-transfection. Viral supernatants were harvested 48 h post-transfection, filtered with a 0.45 mm filter and transduced into cells at a multiplicity of infection of 1 in the presence of 4 μg ml⁻¹ polybrene. Puromycin (2 μg ml⁻¹) and zeocin (400 μg ml⁻¹) were used for the selection of pLentiCRISPR- and pCW57.1- transduced RPE1 cells, respectively.

Clonogenic survival assays

RPE1 EXO1^+/+ or EXO1^−/− cells transduced with CtIP-WT or CtIP-S327A were induced with doxycycline (2 μg ml⁻¹) to express CtIP protein exogenously. Cells were virally transduced with pLentiCRISPR-sgCtIP or empty vector to deplete endogenous CtIP 24 h post-doxycycline induction. After 48 h of puromycin selection to select for pLentiCRISPR transduced cells, 500 cells were seeded in 10-cm dishes for clonogenic growth. Medium containing doxycycline (2 μg ml⁻¹) was refreshed after 7 days. After 14 days, colonies were stained with crystal violet solution (0.4% [w/v], 20% methanol) and counted manually. Simultaneously with plating cells for clonogenic survival, cells were collected for immunoblotting analysis and lysed in RIPA lysis buffer (1% NP40, 50 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.1% SDS, 3 mM MgCl₂, 0.5% sodium deoxycholate) supplemented with Complete Protease Inhibitor Cocktail (Sigma) and 100 U ml⁻¹ Benzonase (Sigma). Western blots were stained with primary antibodies against CtIP (Millipore, MABE1060, 1:2,000), FLAG (Sigma, F1804-200UG, 1:2,000), EXO1 (Abcam, ab95068, 1:1,000) and α-Tubulin (Sigma, T6199, 1:5,000); and with HRP-conjugated secondary antibodies donkey anti-rabbit IgG-HRP (Thermo Scientific, 31458, 1:5,000) or goat anti-mouse IgG-HRP (Thermo Scientific, 31432, 1:5,000).

Immunofluorescence and microscopy

For RPA foci visualization, U2OS-derived cells were seeded on coverslips. For the experiment with DNA2 inhibitor C5 (MedChemExpress, catalogue no. HY128729), 20 μM of the inhibitor or the same amount of vehicle (dimethylsulfoxide, DMSO) were added to the plates 6 h before irradiation. Then 1 h after irradiation (10 Gy), coverslips were washed once with PBS followed by treatment with pre-extraction buffer (25 mM Tris-HCl pH 7.5, 50 mM NaCl, 1 mM EDTA, 3 mM MgCl₂, 300 mM sucrose and 0.2% Triton-X-100) for 5 min on ice. Cells were fixed with 4% paraformaldehyde [w/v] in PBS for 20 min. Following two washes with PBS, cells were blocked for 1 h with 5% fetal bovine serum in PBS, costained with the appropriate primary antibodies (RPA2, Abcam, ab2175, 1:500) in blocking solution overnight at 4 °C or for 2 h at room temperature, washed again with PBS and then co-immuno-stained with the appropriate secondary antibodies (Alexa Fluor 594 goat anti-mouse, Invitrogen, A11032, 1:500 and Alexa Fluor 488 goat anti-rabbit, Invitrogen, A11034, 1:500) in blocking buffer. After washing with PBS, coverslips were incubated sequentially in 70% and 100% ethanol to dehydrate them. Finally, they were air dried and mounted into glass slides using Vectashield mounting medium with 4,6-diamidino-2-phenylindole (Vector Laboratories). RPA foci immunofluorescence was analysed using a Leica DM6000B Fluorescence microscope (AF6000).

Cell-cycle analysis

Cells were trypsinized and fixed with cold 70% ethanol overnight, incubated with 250 μg ml⁻¹ RNase A (Sigma) and 10 μg ml⁻¹ propidium iodide (Fluka) at 37 °C for 30 min and analysed with a LSRFortessaTM Cell Analyzer (BD) Flow Cytometer. Cell-cycle distribution data were further analysed using ModFit LT v.5.0 software (Verity Software House Inc.).

Statistics and reproducibility

Sample size or number of technical (for biochemical assays) and biological (for cellular assays) replicates were chosen on the basis of what is common in the field and what was practical to do. A minimum of three independent replicates were performed for each biochemical experiment to add statistical analysis, when required. Where indicated, a representative experiment from independent repeats with similar results was shown. Coomassie-stained protein gels were repeated twice to confirm the quality and the concentration of the indicated recombinant proteins. Protein-interaction assays were performed twice.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

[ad_2]

Source link

The UFM1 E3 ligase recognizes and releases 60S ribosomes from ER translocons

[ad_1]

Antibodies and recombinant proteins

Details of the antibodies and recombinant proteins used in this study are provided in Supplementary Table 1.

Mammalian cell culture and cell line generation

Flp-In T-REx HEK293 cells (Invitrogen, R78007) were cultured in high-glucose DMEM supplemented with 10% (v/v) fetal bovine serum (FBS), 50 mg ml⁻¹ penicillin–streptomycin and 2 mM l-glutamine. Cells were maintained at 37 °C under 5% CO₂ in an incubator in a humidified environment and routinely checked for mycoplasma. CDK5RAP3-KO cells were generated using CRISPR–Cas9. CRISPR sense and anti-sense guides were cloned into pX335 (DU64982) and pBABED puro U6 (DU64977) plasmids, respectively. In a separate strategy, single guide RNAs were cloned into the px459 vector (Addgene, 48139). In brief, around 2 million cells were seeded into a 10 cm dish in antibiotic-free Dulbecco’s modified Eagle medium (DMEM) and transfected with 1 μg plasmid DNA using Lipofectamine 2000 (Invitrogen, 1168019) according to the manufacturer’s instructions. Then, 24 h after transfection, cells were selected in 2 μg ml⁻¹ puromycin for 24 h followed by a 24 h recovery period in preconditioned medium. Cells were submitted for single-cell sorting, expanded and knockouts were confirmed by sequencing and immunoblot analysis.

Cytosolic and membrane fractionation

For chemical induction of ribosome stalling, cells were treated with 200 nM anisomycin for 4 h before collection. The parent cell line (Flp-In T-REx HEK293 cells) and KOs were washed once in ice-cold PBS, collected in ice-cold PBS and pelleted by centrifugation at 800g. Cell pellets (around 2 × 10⁶ cells) were resuspended in 125 μl of 0.02% (w/v) digitonin, 50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM CaCl₂, and 1× cOmplete protease inhibitor cocktail EDTA-free (Roche). Cells were incubated on ice for 10 min and centrifuged at 17,000g for 10 min at 4 °C. The supernatant was transferred to a fresh tube (cytoplasmic extract). The remaining pellet was washed with 1× PBS and centrifuged at 7,000g for 5 min at 4 °C. The pellet was resuspended in 125 μl 1% Triton X-100, 50 mM HEPES pH 7.5, 150 mM NaCl and 1× EDTA-free protease inhibitor cocktail tablet. This was further incubated on ice for 10 min and centrifuged at 17,000g for 10 min at 4 °C. The supernatant was transferred to a new Eppendorf tube (membrane extract). Equal volumes of the cytosolic and membrane fractions were resolved by SDS–PAGE and analysed using immunoblotting.

Expression and purification of recombinant proteins

UBA5, UFC1, UFM1, UFL1–UFBP1 and CDK5RAP3 were expressed and purified as described previously³. GST–3C–UFBP1(178–204) was applied onto Glutathione Sepharose 4B beads (Cytiva) followed by 3C-protease cleavage on the beads and purified on the HiLoad 26/600 Superdex 75 pg column, pre-equilibrated with 25 mM HEPES pH 7.5 and 200 mM NaCl. E3_mUU constructs were applied onto HisTrap columns, pre-equilibrated with 50 mM Tris pH 7.5, 200 mM NaCl, 20 mM imidazole (pH 8.0) and eluted with the same buffer containing 300 mM imidazole. Constructs with a cleavable His-tag were incubated with 1:50 TEV protease and dialysed against 25 mM Tris pH 7.5, 200 mM NaCl at 4 °C overnight and further purified on the HiLoad 26/600 Superdex 75 pg column, pre-equilibrated with 25 mM HEPES pH 7.5, 200 mM NaCl and 1 mM DTT. For crystallization of the E3_mUU(ΔUFIM)–UFC1 complex, 6×His-TEV-UFL1(1–179) was co-expressed with a UFC1-UFBP1 204-C fusion construct. Here, the His-tag was not cleaved.

Discharge assays

Single-turnover lysine discharge assays were performed to analyse the activity of UFC1 and UFL1–UFBP1 as described previously³. In brief, UFC1 was charged by incubating 0.5 μM UBA5, 10 μM UFC1 and 10 μM UFM1 in reaction buffer containing 50 mM HEPES pH 7.5, 50 mM NaCl, 0.5 mM DTT, 10 mM ATP and 10 mM MgCl₂ for 20 min. The reaction was quenched by addition of 50 mM EDTA (pH 8.0) to the reaction mix followed by incubation for 10 min at room temperature. Discharge was performed in the presence of 50 mM lysine (pH 8.0). The reaction was stopped at the indicated timepoints and analysed under non-reducing conditions on a 4–12% SDS–PAGE gel followed by Coomassie staining.

Preparation of 80S ribosomes and polysomes

HEK293 cells (around 80% confluency) grown in five 15 cm dishes were washed briefly with ice-cold PBS and collected in a 15 ml falcon tube. Cells were lysed in buffer containing 20 mM Tris pH 7.5, 150 mM NaCl, 5 mM MgCl₂, 1 mM DTT, 100 µg ml⁻¹ cycloheximide, 1% Triton X-100, 1× cOmplete protease inhibitor cocktail, EDTA-free (Roche) and RNasin for 10 min on ice followed by centrifugation at 13,000g for 10 min. The clarified supernatant was collected and layered onto a 10–50% sucrose gradient containing 20 mM Tris pH 7.5, 150 mM NaCl, 5 mM MgCl₂, 1 mM DTT, 100 µg ml⁻¹ cycloheximide and 1% Triton X-100, followed by centrifugation at 36,000 rpm for 3 h using the SW41 Ti rotor. The fractions containing 80S ribosomes and polysomes were collected and layered onto a 50% sucrose cushion and centrifuged at 40,000 rpm for 12 h in a Type 70 Ti rotor. Ribosome pellets were then resuspended in buffer containing 20 mM HEPES pH 7.6, 100 mM KCl, 5 mM Mg(OAc)₂, 10 mM NH₄Cl and 1 mM DTT and stored at −80 °C until further use.

Purification of stable 60S ribosomes from HEK293 cells

60S ribosomes were purified as described previously^39,40 with minor changes. HEK293 cells were grown to around 80% confluency in fifteen 15 cm dishes with medium containing high-glucose DMEM supplemented with 10% (v/v) FBS, 50 mg ml⁻¹ penicillin–streptomycin and 2 mM l-glutamine. To collect cells, the medium was first removed by aspiration, washed with ice-cold PBS followed by removal of PBS by aspiration. Cells were scrapped in residual PBS and transferred to a 15 ml falcon. Cells were pelleted by centrifugation at 1,000g for 3 min and the supernatant was discarded. Next, the cell pellets were resuspended in lysis buffer (containing 15 mM Tris pH 7.6, 1,500 mM NaCl, 10 mM MgCl₂, 1% Triton X-100, 2 mM DTT, RNAsin (60 U), 1× cOmplete mini protease inhibitor cocktail (Roche)) and mixed gently followed by incubation on ice for 10 min. The cell lysates were then centrifuged at 17,000g for 10 min and the supernatant was collected. The collected supernatant was layered directly onto a high-salt sucrose cushion containing 20 mM Tris pH 7.5, 500 mM KCl, 30% (v/v) sucrose, 10 mM MgCl₂, 0.1 mM EDTA pH 8.0 and 2 mM DTT. Total ribosomes were sedimented by centrifugation at 63,000g (24,800 rpm) for 18 h using a Type 70 Ti rotor (Beckman Coulter). The sedimented ribosomes were then resuspended in buffer containing 20 mM Tris pH 7.5, 500 mM KCl, 7.5% (v/v) sucrose, 2 mM MgCl₂, 75 mM NH₄Cl, 2 mM puromycin and 2 mM DTT. The resolubilized pellet containing ribosomes was incubated at 4 °C for 1 h and then at 37 °C for 1.5 h. To isolate 40S and 60S ribosomal subunits, the solution was layered directly onto a linear 10–30% sucrose gradient containing 20 mM Tris pH 7.5, 500 mM KCl, 6 mM MgCl₂ and 2 mM DTT. The 60S and 40S were separated by centrifugation at 49,123g (16,800 rpm) for 9 h 42 min at 4 °C using a SW41 Ti rotor (Beckman Coulter). Gradients were fractionated into 0.5 ml fractions using the BioComp fractionating system. The fractions containing 60S ribosomal subunits were collected and exchanged into buffer containing 20 mM HEPES pH 7.2, 100 mM KCl, 5 mM MgCl₂, 2 mM DTT and stored at −80 °C.

In vitro UREL–ribosome association assays

Approximately, 0.2 µM of preformed UREL was added to a mixture of 0.2 µM of 60S ribosomes (1×) and 0.5 µM of 80S ribosomes (2.5×) and incubated for 15 min at 23 °C. After incubation, the mix was layered onto a 10–50% sucrose gradient containing 20 mM HEPES pH 7.5, 50 mM KCl, 5 mM MgCl₂ and centrifuged at 36,000 rpm for 6 h at 4 °C. The samples were then manually fractionated into 22 fractions (100 µl each) and analysed for co-migration by immunoblotting using the indicated antibodies.

Cryo-EM sample preparation

Reconstitution of stable ribosome–E3 complexes

Approximately 10 µM of UREL complexes was incubated with 1 µM of purified 60S ribosomes in the presence of excess UFC1–UFM1 conjugate (5 µM) in buffer containing 20 mM HEPES pH 7.2, 50 mM KCl, 5 mM MgCl₂ and 0.25 mM TCEP for 2 h at 4 °C. After incubation, the samples were mixed with 0.05% glutaraldehyde for 30 s at 23 °C followed by quenching with 100 mM Tris pH 8.0 (final concentration). The cross-linked sample was then layered onto a 10–30% sucrose gradient containing 20 mM HEPES pH 7.5, 50 mM KCl, 5 mM MgCl₂ and 0.25 mM TCEP, and centrifuged using the TLS55 rotor at 24,000 rpm for 6 h at 4 °C. The sucrose gradient of 2.2 ml volume was then manually fractionated into 100 µl fractions and analysed for co-migration of UREL components, 60S ribosomes and UFC1–UFM1 by immunoblotting. The fractions containing UREL–60S ribosome–UFC1–UFM1 were then pooled and concentrated to 7.7 mg ml⁻¹ and buffer-exchanged to remove excess sucrose.

Reconstitution of UFMylated 60S ribosome–UREL complexes

First, an in vitro UFMylation reaction was performed by incubating 0.1 µM UBA5, 5 µM UFC1, 10 µM UFM1, 3 µM UFL1–UFBP1, 5 µM CDK5RAP3 and 1 µM 60S ribosomes in the presence of 5 mM MgCl₂ and 5 mM ATP. After the reaction, 10 µM UFC1–UFM1 was added to the reaction and further incubated at 4 °C for 2 h. The reaction products were then separated on a sucrose gradient and the fractions containing 60S–UREL–UFC1–UFM1 were collected as described in the previous section.

Cryo-EM data collection and image processing

UREL–60S EM grid preparation

Cryo-grids were prepared with 0.05% glutaraldehyde-cross-linked 60S–UREL–UFC1–UFM1 complex at 7.7 mg ml⁻¹ in 25 mM HEPES pH 7.5, 50 mM KCl, 5 mM MgCl₂, 2 mM DTT. Quantifoil R3.5/1 copper 200 mesh holey grids were glow discharged using the PELCO easiGlow glow discharge unit at 15 mA for 30 s. Cryo-grids were prepared using the Thermo Fisher Scientific Vitrobot MK IV with a chamber temperature of 4 °C and 100% humidity. A total of 3 μl of protein was applied to the grid and immediately blotted for 6 s with blot force 1, followed by rapid plunge-freezing into liquid ethane.

UREL–60S cryo-EM data collection

Single-particle cryo-EM data were collected on the Thermo Fisher Scientific Titan Krios G2 transmission electron microscope with a Thermo Fisher Scientific Falcon 4i direct electron detector and SelectrisX energy filter. Data were collected with an accelerating voltage of 300 kV and nominal magnification of ×165,000, which corresponds to a pixel size of 0.74 Å (full data acquisition settings are shown in Extended Data Table 1). A total of 59,394 cryo-EM videos was acquired.

UREL–60S image processing

Cryo-EM videos were imported, beam-induced motion corrected (MOTIONCOR2) and the CTF parameters were estimated (CTFFIND4.1) using RELION (v.3.1)^41,42,43. Approximately 2.2 million particles were picked from motion-corrected micrographs using crYOLO (v.1.6.1)⁴⁴ untrained particle picking (2019 general model) with a particle box size of 400 pixels and a picking confidence threshold of 0.2. Picked particles were extracted in RELION with a particle box size of 588 pixels, rescaled to 128 pixels (rescaled pixel size, ~3.4 Å). Extracted particles were imported into cryoSPARC (v.3.2)⁴⁵ for processing. Seven rounds of reference-free 2D class averages were generated with the initial classification uncertainty factor set between 2 and 7, the number of online-EM iterations set to 40 and batchsize per class set to 200, and all ribosome-like particles were taken forward. The selected 1.6 million particles were used to generate an initial 3D model with C₁ symmetry. The initial 3D model was further refined using the non-uniform refinement algorithm with the dynamic masking start resolution set to a value below the resolution of the data (that is, 1 Å) to generate a refined 3D model and a mask that encompasses the entire box size. The mask and model were input for 3D variability analysis asking for three classes. Particles from the class containing ligase-bound 60S ribosomes were taken forward for another round of 3D refinement, this time with dynamic masking start resolution set to default (12 Å) and the dynamic mask threshold set to 0.1. This was then followed by several more rounds of 3D variability analysis, asking for two classes to separate ligase-bound 60S ribosomes from unbound 60S ribosomes, resulting in 356,394 ligase-bound ribosome particles. Particles were then downsampled to 128 pixels and a cryoDRGN (v.3.2.0)⁴⁶ model was trained with 8 latent dimensions and 50 training iterations. CryoDRGN particle filtering removed 57,386 junk particles, resulting in a final particle stack of 299,008 particles. The homogenous particle population containing ligase-bound ribosomes were re-extracted in Relion at the full box size. A 3D model was generated with C₁ symmetry, followed by non-uniform refinement with per particle defocus optimization, Ewald sphere correction and CTF refinement in cryoSPARC (v.4.2.1) to generate the ligase-bound 60S ribosome map.

To further refine the density for the ligase complex, two masks were created from the final 3D refinement volume using UCSF ChimeraX (v.1.2.5)⁴⁷: one that encompasses the ligase complex plus RPL10a and another that encompasses the ribosome. The ribosome mask was used for particle signal subtraction. Signal-subtracted particles were then used for local refinement of the ligase complex plus RPL10a using the ligase mask to generate a ligase-only map. A cryoSPARC (v.4.2.1) 3DFlex¹⁹ training model was generated for the ligase with 6 latent dimensions and a rigidity prior of 2. The resulting 3DFlex model was used for 3DFlex reconstruction with 40 max BFGS iterations to generate the final ligase map.

UREL–60S model building

The ligase-bound 60S map was sharpened using Phenix (v.1.2.1)⁴⁸ autosharpen map job and the ligase-only map was sharpened using the DeepEMhancer⁴⁹ tight target sharpening protocol. Atomic models were built using Coot (v.0.9.8.1)⁵⁰. For the ligase-bound 60S ribosome map, PDB 7QWR (ref. ⁵¹) was used as a starting model for the 60S ribosome by rigid-body fitting the model into the density map, followed by rebuilding in Coot. No ligase components were built into the ligase-bound ribosome map except for the UFL1 PTC loop. For the ligase complex, AlphaFold2 models of the individual proteins were separated into smaller segments and then rigid-body fitted into the density map, followed by manual rebuilding in Coot. The UFL1 CTD (residues 515–786), CDK5RAP3 UUBD (residues 15–116) and UFM1 displayed poor side-chain density and the side chains of these regions were therefore set to an occupancy of 0. Atomic models were refined using Phenix real space refinement and validated using MolProbity. All 3D density maps were visually inspected in UCSF ChimeraX (v.1.2.5)⁴⁷.

UFMylated ribosome data collection and image processing

Cryo-EM grids were prepared as described above with 1.5 mg ml⁻¹ sample. Single-particle cryo-EM data were collected on the Thermo Fisher Scientific Titan Krios G2 transmission electron microscope with a Thermo Fisher Scientific Falcon 4 direct electron detector. Data were collected with an accelerating voltage of 300 kV and a nominal magnification of ×96,000, corresponding to a pixel size of 0.82 Å (full data-acquisition settings shown in Extended Data Table 1). A total of 3,028 cryo-EM videos was acquired. The data were processed as previously, with the final map being generated from the particles after several rounds of 3D variability analysis.

XL-MS sample preparation and analysis

Approximately 1.2 µM UFL1–UFBP1, 2 µM CDK5RAP3, 0.2 µM ribosomes and 10 µM of UFC1–UFM1 were incubated with 1 mM DSBU (disuccinimidyl dibutyric urea) in buffer containing 50 mM HEPES pH 7.5, 50 mM KCl, 6 mM MgCl₂, 0.5 mM TCEP for 30 min at 23 °C. The reaction was quenched by addition of 50 mM Tris pH 8.0. Cross-linked samples were processed for MS analysis using S-Trap micro spin columns (Protifi) according to the manufacturer’s protocol. In brief, cross-linked samples were reduced by adding 20 mM DTT (10 min, 50 °C), and then alkylated with 40 mM iodoacetamide (30 min, 20 °C). The samples were acidified by the addition of phosphoric acid to a final concentration of 5%, and subsequently diluted with 90% methanol in 100 mM triethylammonium bicarbonate (TEAB) pH 7.1 (1:7 (v/v) sample: buffer). A total of 1 µg trypsin (Promega) was added, and the samples were then bound to a S-Trap micro spin column (Protifi). Subsequently, the column was washed three times with 90% methanol in 100 mM TEAB. An additional 0.6 µg of trypsin was applied to the column, and digestion was then performed by incubating the S-trap column at 47 °C for 90 min. Peptides were recovered by washing the column sequentially with 50 mM TEAB (40 µl), 0.2% (v/v) formic acid (40 µl) and 50% acetonitrile/0.2% (v/v) formic acid (40 µl). The eluate was then evaporated to dryness in a vacuum centrifuge and the peptides were resuspended in 5% (v/v) acetonitrile/0.1% (v/v) formic acid (20 μl) before MS analysis. Peptides (5 µl) were injected onto the Vanquish Neo LC (Thermo Fisher Scientific) system and the peptides were trapped on the PepMap Neo C18 trap cartridge (Thermo Fisher Scientific, 5 µm particle size, 300 µm × 0.5 cm) before separation using the Easy-spray reverse-phase column (Thermo Fisher Scientific, 2 µm particle size, 75 µm × 500 mm). Peptides were separated by gradient elution of 2–40% (v/v) solvent B (0.1% (v/v) formic acid in acetonitrile) in solvent A (0.1% (v/v) formic acid in water) over 80 min at 250 nl min⁻¹. The eluate was infused into an Orbitrap Eclipse mass spectrometer (Thermo Fisher Scientific) operating in positive-ion mode. Orbitrap calibration was performed using FlexMix solution (Thermo Fisher Scientific). Data acquisition was performed in data-dependent analysis mode and fragmentation was performed using higher-energy collisional dissociation. Each high-resolution full scan (m/z 380–1,400, R = 60,000) was followed by high-resolution product ion scans (R = 30,000), with a stepped normalized collision energies of 21%, 26% and 31%. A cycle time of 3 s was used. Only charge states 3–8⁺ were selected for fragmentation. Dynamic exclusion of 60 s was used. Cross-link identification was performed using Proteome discoverer (v.3.0) and the in-built XlinkX module (Thermo Fisher Scientific) using the following settings: crosslinker: DSBU, mass deviation tolerances of 10 ppm in MS and 0.02 Da for Sequest HT and 20 ppm for XlinkX tandem MS (MS/MS). Carbamidomethylation of Cys residues was set as a static modification, and dynamic modifications were set as Met oxidation and DSBU dead-end modifications (DSBU-amidated, DSBU Tris and DSBU hydrolysed) (maximum of three modifications per peptide). Only results with scores corresponding to a false-discovery rate of <1% were taken forward. Finally, a minimum XlinkX score of 45 was used to filter cross-linked peptides^52,53.

Ribosome UFMylation assays

Ribosome UFMylation assays were performed as described previously³. Purified 60S ribosomes (approximately 0.05 µM) were mixed with 0.5 μM UBA5, 1 μM UFC1, 1 μM UFM1 and 0.1 µM UFL1–UFBP1 in a reaction buffer containing 25 mM HEPES pH 7.5, 100 mM NaCl, 10 mM MgCl₂ and 5 mM ATP and incubated at 37 °C for 10 min or the indicated time duration. The reaction was stopped by the addition of SDS loading buffer and run on a 4–12% SDS–PAGE gel under reducing conditions followed by immunoblotting using the indicated antibodies. In reactions containing CDK5RAP3, approximately 0.15 µM of CDK5RAP3 was added to the reaction along with 0.1 µM of UFL1–UFBP1.

Polysome profiling using HEK293 cell lysates

Polysomes were isolated from HEK293 cells as described previously with slight modification. In brief, HEK293 cells were seeded one night before the experiment. On the day of the experiment, cells were treated with either 0.1% DMSO or 200 nM anisomycin for around 20 min before collection. Cells were washed with ice-cold PBS, scraped off and pelleted by centrifugation at 800g for 5 min. The pellet was then resuspended in lysis buffer containing 20 mM Tris pH 7.5, 150 mM NaCl, 5 mM MgCl₂, 1 mM DTT, 100 µg ml⁻¹ cycloheximide, 0.02% Digitonin, cOmplete protease inhibitor cocktail, EDTA-free (Roche) and RNasin. Digitonin-treated cells were incubated for 5 min on ice and centrifuged at 17,000g for 10 min at 4 °C. The supernatant containing the cytoplasmic extract was discarded and the remaining pellet was washed with 20 mM Tris pH 7.5, 150 mM NaCl and 5 mM MgCl₂ and centrifuged at around 7,000g for 5 min. Supernatant was discarded and the pellet was resuspended in lysis buffer containing 20 mM Tris pH 7.5, 150 mM NaCl, 5 mM MgCl₂, 1 mM DTT, 100 µg ml⁻¹ cycloheximide, 0.5% Triton X-100, cOmplete protease inhibitor cocktail, EDTA-free (Roche) and RNasin. The resuspended pellets were incubated on ice for 10 min and centrifuged at 17,000g for 10 min at 4 °C. The supernatant containing the membrane fraction extract was transferred to a new Eppendorf tube and the amount of RNA was quantified for each sample using the NanoDrop system. RNA-normalized samples were then layered onto a 10–50% sucrose gradient containing 20 mM Tris pH 7.5, 150 mM NaCl, 5 mM MgCl₂, 1 mM DTT, 100 µg ml⁻¹ cycloheximide and RNAsin, and then centrifuged at 36,000 rpm for 3 h. Polysomes were then separated by fractionation using the Biocomp fractionating system and analysed using western blotting.

Comparison of 60S and 80S UFMylation in vitro

In vitro UFMylation reactions were performed by incubating 0.1 µM 60S ribosome, 0.2 µM or 0.3 µM enriched 80S (two or threefold excess over 60S) with 0.5 µM UBA5, 1 µM UFC1, 1 µM UFM1, 0.3 µM UFL1–UFBP1 and 0.3 µM CDK5RAP3 in the presence of 5 mM MgCl₂ and 5 mM ATP at 37 °C for 15 min. After incubation, the reaction mix was layered over a 10–50% sucrose gradient containing 20 mM Tris pH 7.5, 150 mM NaCl, 5 mM MgCl₂, 1 mM DTT and centrifuged at 36,000 rpm for 3 h at 4 °C using a SW41 Ti rotor. The gradients were fractionated using the BioComp fractionation system. The sucrose gradient fractions were then run on a 4–12% SDS–PAGE gel and analysed for UFMylation of RPL26 by immunoblotting.

Preparation of membrane-associated 60S ribosomes

Parental cells (WT HEK293) or CDK5RAP3-KO cells (around 80% confluency) grown in ten 15 cm dishes were washed briefly with ice-cold PBS and collected in a 15 ml falcon tube. Cells were pelleted down by centrifugation at 500g for 5 min. Cell pellets were resuspended in buffer containing 20 mM Tris pH 7.5, 150 mM NaCl, 5 mM MgCl₂, 1 mM DTT, 100 µg ml⁻¹ cycloheximide, 0.02% (w/v) digitonin, 1× cOmplete protease inhibitor cocktail, EDTA-free (Roche) and RNasin for 10 min on ice followed by centrifugation at 17,000g for 10 min. The clarified supernatant is the cytosolic fraction and was discarded. The remaining membrane pellet was resuspended in lysis buffer containing 20 mM Tris pH 7.5, 150 mM NaCl, 5 mM MgCl₂, 1 mM DTT, 100 µg ml⁻¹ cycloheximide, 1% (w/v) decyl maltose neopentyl glycol (DMNG), 1× cOmplete protease inhibitor cocktail, EDTA-free (Roche) and RNasin for 15 min on ice, and then centrifuged at 17,000g for 10 min. The clarified supernatant was collected and layered onto a 10–30% sucrose gradient containing 20 mM Tris pH 7.5, 150 mM NaCl, 5 mM MgCl₂, 1 mM DTT, 100 µg ml⁻¹ cycloheximide and 0.01% DMNG, and then centrifuged at 36,000 rpm for 3 h using the SW41 Ti rotor. Fractions containing 60S ribosomes were collected and exchanged into buffer containing 20 mM HEPES pH 7.2, 100 mM KCl, 5 mM MgCl₂ and 2 mM DTT and stored at −80 °C until use.

In vitro 60S ribosome–SEC61 dissociation assays

The in vitro 60S–SEC61 dissociation reaction was performed by incubating 0.05 µM membrane solubilized 60S ribosomes (60S–SEC61 solubilized and enriched from CDK5RAP3-KO cells) with 0.5 µM UBA5, 1 µM UFC1, 1 µM UFM1, 0.1 µM UFL1–UFBP1, 0.1 µM CDK5RAP3 in the presence of 5 mM MgCl₂ and 5 mM ATP at 37 °C for 25 min. At the end of the reaction, the reaction mix was layered over a 10–50% sucrose gradient containing 20 mM Tris pH 7.5, 150 mM NaCl, 5 mM MgCl₂ and 1 mM DTT, and centrifuged at 36,000 rpm for 3 h using the SW41 Ti rotor. Sucrose gradients were fractionated using the BioComp fractionation system. The sucrose gradient fractions were separated on a 4–12% SDS–PAGE gel and analysed for co-migration of SEC61β with 60S ribosomes by immunoblotting.

LC–MS/MS sample preparation, data acquisition and analysis

First, an in vitro ribosome UFMylation reaction was performed to generate UFMylated ribosomes in the presence of either UFL1–UFBP1 or UREL. Then, the reaction products were run on a 4–12% SDS–PAGE gel to separate the mono- and di-UFMylated ribosomes. Next, the bands corresponding to mono- and di-UFMylated ribosomes were excised and in-gel digestion was performed according to a previously described protocol⁵⁴. Digested peptides were analysed by liquid chromatography coupled with MS/MS (LC–MS/MS) on the Exploris 240 (Thermo Fisher Scientific) system coupled to the Evosep One (Evosep). The samples were loaded onto the Evotips according to the manufacturer’s recommendations and analysed using the 30 SPD method. Peptides were then analysed in on the Exploris 240 system using data-dependant acquisition with an MS1 resolution of 60,000, an AGC target of 300% and a maximum injection time of 25 ms. Peptides were then fragmented using TOP 2 s method, MS2 resolution of 15,000, NCE of 30%, AGC of 100% and maximum injection time of 100 ms. Peptide identification was performed in MaxQuant (v.2.0.2.0) against UniProt SwissProt Human containing isoforms (released 5 May 2021) with match between runs enabled. Carbamidomethylation (C) was set as a fixed modification and oxidation (M), acetyl (protein N-term) and the addition of the dipeptide valine–glycine (K) were set as variable modifications. The other parameters were left as the default.

Preparation of isopeptide-linked UFC1–UFM1 conjugate

First, 30 µM UBA5, 30 µM UFC1(C116K) and 60 µM UFM1 were incubated in 25 mM HEPES pH 7.5, 200 mM NaCl, 10 mM MgCl₂ and 10 mM ATP. The pH of the reaction mixture was adjusted to 9.8 with 0.5 M CAPS, pH 11.5, and incubated for 18 h at 23 °C. UFC1–UFM1 was subsequently separated from UBA5 and unreacted UFC1 and UFM1 using the HiLoad 26/600 Superdex 75 pg column, pre-equilibrated with 25 mM HEPES pH 7.5, 200 mM NaCl, 1 mM DTT.

Crystallization and structure determination

UFC1–UFM1 conjugate

UFC1–UFM1 crystals were obtained using the sitting-drop vapour diffusion technique whereby UFC1–UFM1 (22.8 mg ml⁻¹) was 1:1 mixed with 30% (v/v) PEG 400, 0.1 M Tris pH 8.5, 0.2 M Na citrate and incubated at 19 °C. Single crystals appeared within 2–3 days. Crystals were flash-frozen in crystallization buffer containing 30% (v/v) ethylene glycol. Datasets were collected at Diamond Light Source (DLS), beamline I04, and processed with Xia2 (ref. ⁵⁵) and DIALS⁵⁶. The crystal structure was solved by molecular replacement (PHASER)⁵⁷ using the crystal structures of UFC1 (PDB: 3EVX)⁵⁸ and UFM1 (PDB: 5IA7)⁵⁹ as the starting model. Refinement and model building was performed using REFMAC⁶⁰ and Coot⁵⁰ (CCP4i2 suite), respectively. The statistics for data collection and refinement are listed in Extended Data Table 2.

UFL1–UFBP1–UFC1 complex

UFL1–UFBP1–UFC1 crystals were obtained using the sitting-drop vapour diffusion technique whereby UFL1–UFC1–UFBP1 (20.2 mg ml⁻¹) was 1:1 mixed with 1.03 M Li₂SO₄, 0.1 M HEPES pH 7.2 and incubated at 19 °C. Single crystals appeared within 1–2 days. Crystals were flash-frozen in crystallization buffer containing 30% (v/v) ethylene glycol. Datasets were collected at the European Synchrotron Radiation Facility (ESRF), beamline ID23-EH2, and processed with the autoPROC suite⁶¹ (including XDS⁶², Pointless⁶³ Aimless⁶⁴, CCP4 (ref. ⁶⁵) and STARANISO⁶⁶). The crystal structure was solved by molecular replacement (PHASER)⁵⁷ using the AlphaFold¹¹ predicted models for UFL1 and UFBP1 and the crystal structure of UFC1 (PDB: 3EVX)⁵⁸ as starting models. Refinement and model building was performed using REFMAC⁶⁰ and Coot⁵⁰ (CCP4i2 suite), respectively. The statistics for data collection and refinement are listed in Extended Data Table 2.

SEC

Analytical SEC runs were performed using the Superdex 200 Increase 3.2/300 column, pre-equilibrated with 25 mM HEPES pH 7.5, 200 mM NaCl, 0.5 mM TCEP. A total of 50 µl protein of the different components was mixed and incubated on ice for 30 min before loading onto the column.

ITC

ITC experiments were performed using a MicroCal PEAQ-ITC (Malvern). Proteins were first dialysed into ITC buffer containing 25 mM HEPES pH 7.5, 200 mM NaCl, 0.44 mM TCEP. Each experiment consisted of 13 injections for a duration of 6 s each followed by a 150 s spacing between injections except the experiment for UFBP1 UFIM–UFM1, which consisted of 19 injections instead. All of the experiments were performed at 25 °C.

Figures

Adobe Illustrator, BioRender and ChimeraX⁴⁷ were used to make figures.

Materials availability

All cDNA constructs in this study were generated by H.M.M., J.J.P. and the cloning team at the MRC PPU Reagents and Services team. All of the plasmids have been deposited at the MRC PPU Reagents and Services and are available at https://mrcppureagents.dundee.ac.uk/.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

[ad_2]

Source link

Tag: Enzyme mechanisms

Nucleosome flipping drives kinetic proofreading and processivity by SWR1

Purification of wild-type SWR1

Purification of fluorescently labelled SWR1

Purification of S. cerevisiae histones

Preparation of nucleosomes

Preparation of hexasomes

Preparation of heterotypic nucleosomes

Bulk histone exchange assay

Two-colour smFRET microscope

Three-colour smFRET microscope

Microscope slide passivation and flow chamber assembly

Nucleosome or hexasome immobilization

smFRET between nucleosome or hexasome and SWR1 data collection

smFRET between nucleosome or hexasome and SWR1 data analysis

smFRET real-time imaging of histone exchange and SWR1-binding data collection

smFRET real-time imaging of histone exchange and SWR1-binding data analysis

Single-molecule measurements of SWR1 nucleosome lifetime

Preparation of the SWR1–nucleosome complex for cryo-EM

Cryo-EM data collection

Cryo-EM data processing

Model building

2D classification of SWR1-mediated nucleosome flipping

Statistics and reproducibility

Reporting summary

AARS1 and AARS2 sense l-lactate to regulate cGAS as global lysine lactyltransferases

Mechanism of BRCA1–BARD1 function in DNA end resection and DNA protection

Cloning, expression and purification of recombinant proteins

Sequence analysis of BRCA1 and BARD1 proteins

Preparation of DNA substrates

DNA end resection and protection assays

Helicase assays

ATPase assays

Protein-interaction assays

Mass photometry characterization of protein complexes

Single-molecule magnetic tweezer experiments

Cell lines

Viral transductions and transfections

Clonogenic survival assays

Immunofluorescence and microscopy

Cell-cycle analysis

Statistics and reproducibility

Reporting summary

Architecture and activation mechanism of the bacterial PARIS defence system

Substrate-induced condensation activates plant TIR domain proteins

The UFM1 E3 ligase recognizes and releases 60S ribosomes from ER translocons

Antibodies and recombinant proteins

Mammalian cell culture and cell line generation

Cytosolic and membrane fractionation

Expression and purification of recombinant proteins

Discharge assays

Preparation of 80S ribosomes and polysomes

Purification of stable 60S ribosomes from HEK293 cells

In vitro UREL–ribosome association assays

Cryo-EM sample preparation

Reconstitution of stable ribosome–E3 complexes

Reconstitution of UFMylated 60S ribosome–UREL complexes

Cryo-EM data collection and image processing

UREL–60S EM grid preparation

UREL–60S cryo-EM data collection

UREL–60S image processing

UREL–60S model building

UFMylated ribosome data collection and image processing

XL-MS sample preparation and analysis

Ribosome UFMylation assays

Polysome profiling using HEK293 cell lysates

Comparison of 60S and 80S UFMylation in vitro

Preparation of membrane-associated 60S ribosomes

In vitro 60S ribosome–SEC61 dissociation assays

LC–MS/MS sample preparation, data acquisition and analysis

Preparation of isopeptide-linked UFC1–UFM1 conjugate

Crystallization and structure determination

UFC1–UFM1 conjugate

UFL1–UFBP1–UFC1 complex

SEC

ITC

Figures

Materials availability

Reporting summary