Carbon Chemist

Tag: Growth factor signalling

  • MYCT1 controls environmental sensing in human haematopoietic stem cells

    [ad_1]

    Reagents

    See Supplementary Table 9.

    Human HSPC collection and isolation

    First trimester haematopoietic tissues and second trimester FLs (14–18 developmental weeks) were de-identified, discarded material obtained from elective terminations of pregnancy after informed consent. First trimester tissues (5–6 weeks) include the AGM region, the placenta and the yolk sac. CB units were obtained at birth following informed consent and de-identified after collection. Adult BM aspirates were purchased from Allcells.

    AGM, placenta and yolk sac were washed in Dulbecco’s phosphate buffered saline (DPBS; Gibco, 14190250) and placed in sterile DPBS with 5% FBS (FB-01, Omega Scientific), 1% penicillin–streptomycin (Thermo Fisher Scientific, 15140-122) and 2.5 µg ml–1 amphotericin B (Fisher BioReagents, BP2645-50) and processed for sorting within 48 h. Tissue samples were digested in 2.5 U dispase (Thermo Fisher Scientific, 17105-041), 90 mg collagenase A (Worthington, LS004176) and 0.075 mg DNase I (Sigma-Aldrich, D4513) per ml in DPBS containing 10% FBS for 20–45 min at 37 °C. Cells were disaggregated by pipetting and filtered through a 70 µm cell strainer. FLs were collected into DPBS with 5% FBS and mechanically dissociated using scalpels and syringes before proceeding with enzymatic dissociation described above. CB was diluted 1:2 with DPBS containing 2% FBS, 1 mM EDTA (Invitrogen, AM9260G) and 4.2 U ml–1 DNAse I before proceeding to the enrichment of mononuclear cells.

    For FL, CB and adult BM, mononuclear cells were enriched on SepMate-50 tubes using Lymphoprep (StemCell Technologies, 85450 and 07861) layer following the manufacturer’s protocol and filtered through a 70 µm cell strainer. CD34+ cells were enriched using human CD34 MicroBead Kit UltraPure (Miltenyi Biotec 130-100-453). Cells were viably frozen or sorted for experiments directly.

    Ethics statement

    First trimester tissue samples were obtained from the University of Tubingen and delivered to the University of California Los Angeles (UCLA) within 48 h after the procedure. The Ethics Committee at the Medical Faculty of the Eberhard Karls University Tübingen and at the University Hospital in Tübingen approved the use of human embryo tissues from elective terminations for HSC research (number 290/2016BO1). Second trimester FL tissues were obtained from elective terminations performed at UCLA or at Family Planning Associates and provided to the UCLA CFAR Cell and Gene Therapy core for distribution to UCLA investigators. All human fetal tissue used were discarded material from elective terminations that were obtained following informed consent. The donated human fetal tissues were anonymized and did not carry any personal identifiers. In all cases, the decision to terminate the pregnancy occurred before the decision to donate tissue. No payments were made to donors and the donors knowingly and willingly consented to provide research materials without restrictions for research and for use without identifiers. CB units were obtained from Cedars Sinai Medical Center following informed consent and de-identified following collection. The UCLA Institutional Review Board (IRB) determined that the provision of anonymized fetal material and CB for research does not constitute human research per the US Federal regulations because the tissues are anonymized, (that is, provided without any direct or indirect identifiers that could be linked back to a living individual). As a result, investigators using such material are not engaged in research subject to IRB oversight. All donors gave informed consent in compliance with US Public Health Service Act, Sections 498A and 498B for the use of fetal material in research. All human tissue materials were treated as Biosafety level 2 and approved by UCLA Institutional Biosafety Committee (BUA-2016-142-001, BUA-2019-186-001).

    Cell lines

    Immortalized HUVECs (E4EC)13 were obtained from S. Rafii’s laboratory and were cultured on gelatin-coated flasks with Medium 199 (GE Life Sciences, sh30253.01) containing 20% FBS (FB-01, Omega Scientific), 1% penicillin–streptomycin, 1% l-glutamine, 10 mM HEPES (Thermo Fisher Scientific, 15140-122, 2503-081 and 15630080), human FGF (20 ng ml–1) (R&D Systems, 233-FB), human EGF (10 ng ml–1), human IGF-I (10 ng ml–1) (Peprotech, AF-100-15 and 100-11) and heparin (50 μg ml–1) (Sigma-Aldrich, H3149-50KU). HUVECs (Thermo Fisher Scientific, C0035C) were cultured with Medium 200 supplemented with low-serum growth supplement (Thermo Fisher Scientific, M200500 and S00310) or a endothelial growth medium 2 kit with the provided supplements (EGF, FGF, IGF, but no VEGF) (PromoCell, C-22111). KG1 HSC-like AML cells (obtained from Chute’s Laboratory, originally from the American Type Culture Collection) and MKPL1 cells (obtained from K. Li, originally from DSMZ) were cultured in RPMI with 10% FBS, 1% penicillin–streptomycin and 1% l-glutamine. Cell lines were not authenticated and not tested for mycoplasma contamination.

    Cell sorting and flow cytometry for HSC assays

    For identification and sorting of human HSPCs, single-cell suspensions were stained with different combinations of antibodies against human CD34, CD38, CD90, GPI-80, EPCR, ITGA3 and CD45RA. Dead cells were excluded with 7AAD or DAPI. Cells were assayed on a BD LSR Fortessa with Diva (v.8) software and analysed using FlowJo software (Tree Star). Cell sorting was performed using a BD FACS Aria II.

    RNA-seq for human haematopoietic tissues and cell lines

    For RNA-seq of human haematopoietic tissues, cells were isolated as described above. The different populations were sorted directly into RLT based on the surface markers shown in Supplementary Table 10. RNA was extracted using a RNeasy Micro kit (Qiagen, 74004) and all RNA samples were sent to the CIRM consortium65 for library preparation and sequencing at the Next Generation Sequencing Core Facility at the Salk Institute for Biological Studies. Sequencing libraries were prepared using an Ovation RNA-seq system V2 kit (NuGEN). Paired-end 150 bp sequencing was performed on an Illumina HiSeq 4000. Alignment to both the human genome (hg37) and comprehensive genome annotation from Gencode (v.36) was performed using STAR66. Data were normalized to FPKM.

    For KG1 and E4EC cell lines, total RNA was extracted using a RNeasy Mini kit (Qiagen, 74104) and the library was constructed using a KAPA Stranded RNA-Seq kit with a RiboErase kit. Different adapters were used for multiplexing samples in one lane. Sequencing was performed on an Illumina HiSeq 3000 for SE 1 × 50 run. Data quality check was done using Illumina SAV. Demultiplexing was performed using Illumina Bcl2fastq (v.2.19.1.403) software. Alignment to the human genome (hg38) was performed using STAR66. The hg38–Ensembl Transcripts release 101 gtf was used for gene feature annotation. Data were normalized to reads per kilobase million (RPKM).

    Lentiviral vectors for MYCT1 shRNA-mediated KD and OE

    For MYCT1 KD shRNA experiments, pLKO lentiviral vectors from the MISSION TRC library (Millipore-Sigma) containing a puromycin resistance gene with or without GFP were used: TRCN00000135691 (KD1), TRCN00000137125 (KD2) and pLKO control (SHC001). shRNA sequences are provided in Supplementary Table 11.

    For MYCT1 OE, human MYCT1 was cloned from human FL HSPC full-length cDNA into the constitutive FUGW lentiviral vector (Addgene, plasmid 14883, from D. Baltimore). MYCT1 cDNA with a C-terminal V5 tag was inserted downstream and in-frame with the GFP sequence with the synthetic addition of a P2A sequence between the two ORFs using PfuUltra II Fusion High Fidelity DNA polymerase (Agilent 600670). Cloning primers are provided in Supplementary Table 11.

    Lentiviral production of shRNA and OE vectors and transduction

    For lentiviral production, 15–20 million 293T cells were plated with DMEM (Thermo Fisher Scientific, 11995065) without antibiotics the day before transfection. Cells were transfected with 16 μg deltaR8.2 packaging plasmid, 8 μg VSVG-envelope plasmid, 20 μg of the lentiviral vector plasmid of choice and 132 μl of Turbo DNAfectin 3000 (Lambda Biotech, G3000) in Opti-MEM (Thermo Fisher Scientific, 31985070). At 6–8 h after transfection, the medium was changed to fresh complete DMEM. At 72 h after transfection, the supernatant was filtered and concentrated by ultracentrifugation, and pelleted viruses were resuspended in 200 μl SFEM or M199 (100× concentrated) and stored at −80 °C.

    HSPCs were thawed, sorted and pre-stimulated for 24 h before transduction. Transduction was performed with retronectin-bound spin infection. In brief, non-treated plates were coated with Retronectin (Takara, T100B) solution overnight at 4 °C, blocked with 2% BSA in DPBS and washed with DPBS. Virus (multiplicity of infection of 50–100) was added to the coated plate and centrifuged at 2,000g for 2 h at 32 °C. The supernatant was removed, HSPCs were plated at a density of about 25,000 cells per cm2 with Lentiboost (1:100) (Sirion Biotech, SB-A-LF-900-01) and centrifuged again at 800g for 90 min at room temperature. The culture medium was changed the day after transduction. For shRNA lentiviral vectors, HSPCs were selected with puromycin (1 μg ml–1) (Invivogen, ant-pr-1), starting 24 h after transduction. ECs were transduced by directly adding concentrated virus to cultured cells (10 μl ml–1).

    Assessment of MYCT1 expression by RT–qPCR during HSPC culture, after MYCT1 KD and OE or after sorting of dextran fractions

    RNA isolation was performed using a RNeasy Micro or Mini kit (Qiagen, 74004 and 74104) with an additional DNase step using the manufacturer’s protocol. cDNAs were prepared using a High-Capacity cDNA Reverse Transcription kit (Thermo Fisher Scientific, 4368814). qPCR for GAPDH and MYCT1 was performed using LightCycler 480 SYBR Green I master mix (Roche, 4707516001) on a LightCycler 480 (Roche). Primers are presented in Supplementary Table 11.

    HSPC culture and expansion assays

    Human HSPCs were cultured in serum-free conditions with StemSpan SFEM II (StemCell Technologies, 9655) supplemented with 1% penicillin–streptomycin, 1% l-glutamine, human FLT3-L (100 ng ml–1), human TPO (50 ng ml–1), human SCF (125 ng ml–1) (Thermo Fisher Scientific, 15140122, 25030081, PHC9411, PHC9513 and PHC2113), human low-density lipoprotein (10 μg ml–1), SR1 (500 nM) and UM171 (35 nM) (StemCell Technologies, 2698, 72352 and 72914). Cells were cultured at 37 °C and 5% CO2, re-plated as necessary to maintain a cell density of ≤1 × 106 per ml, and half medium changes were performed every other day. For HSPC expansion assays, cells were analysed by flow cytometry every 5–14 days. Absolute counting beads (Thermo Fisher Scientific, C36950) were used to determine cell numbers and to calculate expansion rates. For co-culture with ECs, E4EC cells were plated in standard medium (M199 with serum and cytokines, see above) the day before adding HSPCs. When co-cultured with HSPCs, the standard supplemented StemSpan medium was used.

    Proliferation and cell cycle assays

    Dye dilution (CellTrace) proliferation assays and monitoring of single cell divisions were performed for control and MYCT1 KD or OE HSPCs 72–96 h after transduction. To monitor single cell divisions, transduced HSPCs (CD34+CD38–CD90+) were sorted into single cells in 96-well round-bottom plates 72–96 h after transduction. The cells in each well were visually counted every 24 h for 96 h.

    For dye dilution proliferation assays, cells were resuspended at a concentration of 1 × 106 cells per ml with warm DPBS with 5% BSA and 5  μM CellTrace Violet (Thermo Fisher Scientific, C34571) and incubated at 37 °C for 15 min protected from light. The cells were then washed with 5× volume of cold DPBS 5% BSA, incubated for 5 min at 37 °C and resuspended in pre-warmed culture medium and incubated for at least 10 min at 37 °C. The cells were stained for HSC surface markers as described above and sorted for CD34+CD90+ and a high narrow peak of CellTrace Violet. Cells were analysed by FACS immediately after sorting and after 48 h in culture.

    Colony-forming assays

    CB HSPCs were transduced with control or MYCT1 OE vectors. At 72–96 h after transduction, 180–300 sorted HSPCs (CD34+CD38–CD90+GFP+) were plated with methylcellulose-based medium containing recombinant cytokines for human cells (Methocult, StemCell Technologies, H4435, contains SCF, IL-3, IL-6, EPO, G-CSF and GM-CSF) onto two 35 mm dishes (90–150 HSPCs per plate in duplicates). Colonies were counted and morphologically assessed after 15 days.

    HSPC transplantation assays after MYCT1 KD and FACS quantification of human multilineage engraftment

    Engraftment ability of human MYCT1 KD and control HSPCs was assessed by transplanting equal numbers of sorted HSPCs into 9–11-week-old immunodeficient NSG mice. Sorted FL or CB CD34+CD38–CD90+ HSPCs were transduced 24 h after sorting with MYCT1 shRNA (KD1) or control lentiviruses, selected with puromycin, re-sorted 72 h after transduction and transplanted into female NSG mice. Around 10,000 HSPCs (CD34+CD38–CD90+GPI80+) from FL or 5,000 cells (CD34+CD38–CD90+) from CB were injected retro-orbitally into 6–16-week-old female NSG mice (Jackson Laboratory). Mice were pre-conditioned by sublethal irradiation (2.75 Gy) 24 h before transplantation or 25 mg kg–1 busulfan treatment (intraperitoneal injection) 24 and 48 h before transplantation.

    Human haematopoietic engraftment was quantified 6 and 12 weeks after transplantation by BM biopsy. NSG mice from MYCT1 KD transplantation experiments were further analysed 24 weeks after transplantation by collecting cardiac blood, spleen and BM of euthanized mice. Human engraftment was evaluated by FACS after staining for human and mouse CD45, and multilineage engraftment was determined by the detection of human myeloid (CD14 or CD66b), B lymphoid (CD19) and T lymphoid or other (CD3, CD4 and/or CD8) markers within human CD45+ cells (see Supplementary Table 9 for antibody details). The HSPC compartment was also evaluated using CD34 and CD38 markers.

    HSPC transplantation assays with MYCT1 OE and FACS quantification of human multilineage engraftment

    Engraftment ability of human MYCT1 OE and control HSPCs was assessed by transplanting equal numbers of sorted HSPCs or their progeny into immunodeficient NBSGW mice and evaluating human engraftment at 12 weeks, a time point when multilineage engraftment levels in this mouse model have been reported to peak43,67,68. To assess whether MYCT1 improves or alters the function of immunophenotypic HSPCs after short-term culture, CB HSPCs were transduced with MYCT1 OE or control lentiviral vectors, sorted and transplanted 96 h after transduction into female or male 6–17-week-old NBSGW mice (Jackson Laboratory) without irradiation. About 500 or 2,500 sorted HSPCs (CD34+CD38–CD90+GFP+) were resuspended and injected as described above.

    To assess the effects of sustained MYCT1 expression on the function of HSPC progeny after 15 days in culture, sorted CB HSPCs were transduced with MYCT1 OE or control lentiviral vectors, GFP+ cells were re-sorted 72 h after transduction and further cultured for 10 additional days (total of 15 days in culture) and transplanted at limiting dilution doses. The number of cells reported (50, 250, 500, 2,500 or 10,000 cells) is the number of sorted GFP+ cells that were used to initiate the expansion cultures, the progeny of which was transplanted per mouse at day 15. Male and female NBSGW mice (6–15 weeks old; Jackson Laboratory) were used as recipients.

    For MYCT1 OE experiments, mice were considered to be engrafted if human CD45 was ≥0.1% of the total mouse and human haematopoietic compartment, and were considered to have multilineage engraftment if they displayed >0.01% of myeloid (CD14 or CD66b), B lymphoid (CD19) and T lymphoid or other (CD3, CD4 and/or CD8) cells among the total mouse and human haematopoietic compartment. Erythroid engraftment was determined by the presence of CD71+GlyA+ cells. Frequency of reconstituting units was estimated from the total engraftment data with extreme LDA41 including all mice from all replicates.

    All transplanted mice were included in the analysis unless they died before the particular experimental time point (1 out of 9 mice transplanted with MYCT1 KD HSPCs, 2 out of 82 mice transplanted with control vector HSPC for the OE experiment). All studies and procedures involving mice were conducted in compliance with ethical regulations and were approved by the UCLA Animal Research Committee (protocol 2005-109). Mice were housed with a 12-h light–dark cycle (6:00 to 18:00), at 20–26 °C ambient temperature and 30–70% humidity. No sample size calculations were performed a priori. Sample size for transplantation experiments was decided based on previous publications with similar HSC transplantation experiments by our laboratory or others. Allocation of mice to experimental groups was randomized, which ensured equal distribution of ages and sexes. Investigators were not blinded.

    scRNA-seq for uncultured and cultured MYCT1 OE and KD HSPCs

    CB HSPCs were sorted after thawing and sequenced directly (uncultured) or transduced with control, MYCT1 KD and MYCT1 OE vectors and re-sorted (CD34+CD38–CD90+GFP+) 72 h after transduction. For scRNA-seq, single-cell suspensions in DPBS 0.04% Ultrapure BSA (Thermo Fisher Scientific, AM2616) were used. A Chromium single cell instrument (10x Genomics) was used for the generation of single-cell gel beads in emulsion. scRNA-seq libraries were prepared by using a Chromium single-cell 3′ library and gel bead kit v3 (10x Genomics). Sequencing was performed on an Illumina NovaSeq 6000 system. CellRanger mkfastq (v.2.1.1) was used to generate the fastq files, the CellRanger count was mapped to the human reference genome (refdata-cellranger-GRCh38-1.2.0) and the digital expression matrix was extracted from the ‘filtered_gene_bc_matrices’ folder output.

    scRNA-seq for HSPCs with different levels of endocytosis

    CB HSPCs were sorted (CD34+CD38–CD90+) after thawing and cultured for 4 days (96 h). HSPCs were then stained normally, placed back in culture to equilibrate for 1 h and incubated with fluorescent dextran as described below for 30 min (see section ‘FACS-based endocytosis assays’). HSPCs (CD34+CD38–CD90+EPCR+) were sorted into three fractions based on their dextran signal (20% lowest, 20% medium and 20% highest). The cells were prepared for scRNA-seq and sequenced as described above. The data from the three fractions were balanced when aggregating the samples to equilibrate the sequencing depth.

    scRNA-seq data analysis

    The scRNA-seq data were analysed using the R package Seurat (v.3.1.2). Cells with fewer than 100 unique molecular identifiers (UMIs) or more than 10% mitochondrial expression were removed from further analysis. Raw counts were normalized (Seurat function NormalizeData), variable genes identified (FindVariableGenes), expression values were scaled and centred in the dataset and the number of UMIs regressed against each gene (ScaleData). Principal component analysis, t-SNE and UMAP were used to reduce the dimensions of the data.

    To investigate the differences between control, MYCT1 KD and MYCT1 OE HSCs, cells with more than 1 count for HLF were selected (HLF+), the differentially expressed genes between HLF+ cells in the different samples (control, KD and OE) were obtained using the Seurat FindMarkers function using the DESeq2 (v.1.26.0) test. Functional enrichment analysis was performed using both gProfiler69 and PathfindR70 (v.2.3.0). For gProfiler, the significant upregulated or downregulated genes (adjusted P < 0.05) were inputted ordered by log fold change and run as ordered query using the following sources: GO terms, KEGG signalling pathways, Reactome (REAC) and Wikipathway (WP), regulatory motif matches (TRANSFAC, TF), and protein complexes (CORUM). For PathfindR, all genes obtained from the Findmarkers analysis were inputted, including their log fold change and adjusted P value, and GO was used as the source.

    HLF+ cells from control, KD and OE HSPCs were analysed separately from uncultured and HLF– cells by generating a Seurat subsample. We compiled a HSC gene set by including human HSC-associated genes from the dataset from ref. 18, as well as the genes included in the curated HSC cell type signature gene sets from the GSEA database33 (datasets from ref. 34, ref. 36 and ref. 35). The final HSC gene set was matched with the lists of differentially expressed genes to determine whether HSC-associated genes were differentially expressed in our HSC scRNA-seq dataset. Gene modules were compiled for ETS transcription factors and for the relevant functional categories by including all genes belonging to the particular GO term (obtained from QuickGO71; https://www.ebi.ac.uk/QuickGO/annotations). Scores were calculated using AddModuleScore with default parameters, and significance was calculated using Wilcoxon rank-sum test. The module scores and the expression patterns of selected genes are shown using the DotPlot function. The results of functional enrichment analysis, the gene lists used for module scores and the P values for each module are provided in Supplementary Table 3.

    MYCT1-regulated programmes from MYCT1 OE and KD datasets were compared with the scRNA-seq data of HSCs with different levels of endocytosis. Module scores and significance were calculated for the dextran scRNA-seq data and plotted using AddModuleScore and DotPlot as performed for MYCT1 KD and OE samples. The P values for each module are provided in Supplementary Table 7.

    RNA-seq analysis of published mouse HSC datasets

    MYCT1-regulated programmes from MYCT1 OE and KD datasets were compared to a previously published RNA-seq data of mouse HSPCs41 (Gene Expression Omnibus (GEO) identifier GSE175400). This dataset compared gene expression profiles of the progeny of single LT-HSCs after 28 days of culture in medium containing PVA, 10 ng ml–1 SCF and 100 ng ml–1 TPO. The resulting progeny had been sorted for phenotypic HSCs (EPCR+LIN–SCA1+KIT–, named ELSK) and the remaining non-ELSK cells and transplanted in parallel to RNA-seq. Therefore, the sorted progeny were further classified as repopulating and non-repopulating41.

    FACS-based mitochondrial assays

    Mitochondrial membrane potential and mitochondrial ROS were quantified using TMRE (Abcam, ab113852) and MitoSOX (Thermo Fisher Scientific, M36008), respectively. HSPCs transduced with control, MYCT1 KD or MYCT1 OE lentiviral vectors were incubated for 20 min at 37 °C with 50 nM of TMRE or 5 μM of MitoSOX. Because HSCs can efflux MitoSOX dyes, 50 μM of verapamil was added during incubation72. DAPI was included to discriminate dead cells.

    FACS-based endocytosis assays

    HSPC or ECs transduced with control, MYCT1 KD or MYCT1 OE lentiviral vectors were incubated with low-molecular-weight fluorescent dextran specific for the detection of endocytosis (40 μg ml–1; 10 kDa, pHrodo Red Dextran, Thermo Fisher Scientific, P10361) with or ECgreen (1:1,000; Dojindo, E296) for 30 min at 37 °C. After incubation, cells were immediately placed on ice, washed with ice-cold DPBS with 5% FBS and resuspended into single-cell suspension for FACS analysis. 7AAD was included to discriminate dead cells.

    Cell fractionation

    Cell fractionation was performed on 2 × 106 KG1 cells overexpressing MYCT1–V5 using a Subcellular Protein Fractionation kit for cultured cells (Thermo Fisher Scientific, 78840) and following the manufacturer’s instructions with the addition of wash steps in between fractions.

    Immunofluorescence

    KG1 cells overexpressing MYCT1–V5 were spun on slides at 200g for 10 min, fixed with 4% paraformaldehyde (Electron Microscopy Sciences, 15710) for 10 min, permeabilized with 0.1% Triton X-100 (Sigma T9284) for 5 min, rinsed twice with DPBS and blocked (DPBS with 0.5% BSA, 5% donkey serum (Jackson Immunoresearch, 017-000-121), 5% goat serum (Abcam, ab7481) and 0.1% Triton) for 30 min. Primary antibodies were prepared in blocking solution and incubated overnight at 4 °C. Slides were washed 4 times with permeabilizing solution, and secondary antibodies prepared in blocking buffer were incubated for 1 h at room temperature. Slides were washed 4 times, stained with DAPI (Miltenyi Biotec, 130-111-570) solution (1:1,000) for 10 min, rinsed with DPBS and mounted with ProLong Gold antifade mountant (Thermo Fisher Scientific, P10144). For immunofluorescence in CB HSPCs transduced with MYCT1 OE vector, GFP+ cells were sorted 72 h after transduction and spun on poly-lysine (Sigma-Aldrich P8920) coated slides. Staining was performed the same way, with the addition of ImageIT signal enhancer (Thermo Fisher Scientific, I36933) for 30 min at room temperature before the blocking step. For antibody details, see Supplementary Table 9. Images were acquired with a Zeiss LSM880 confocal with Zen black software (v.14.0.29.201) at ×40 (for KG1 cells) or at ×63 using high-resolution Airyscan technology (for CB HSPCs) and processed and analysed for colocalization using Imaris (v.9.7.2).

    MYCT1–V5 IP

    KG1 or E4EC cells were washed twice with ice-cold DPBS and lysed with RIPA buffer containing protease inhibitors (Thermo Fisher Scientific, 78429) by rotating the tubes for 30 min. Cell debris was removed by centrifugation for 15 min at 14,000g and collecting the supernatant. Protein concentration was quantified by BCA. Next, 1–2 mg of protein, together with 1–2 mg of protein G beads and 4–8 μg of V5 antibody (Thermo Fisher Scientific, 10004D and R960-25) were incubated overnight with rotation. The beads were washed 3 times with wash buffer (150 mM NaCl, 50 nM Tris pH 7.5) with 0.5% NP-40 and 5 times with wash buffer without NP-40 for 10 min each. Beads were eluted in 80 μl urea 8 M in 100 mM Tris-HCl pH 8 digestion buffer by shaking at 25 °C for 30 min. All steps including centrifugation were performed at 4 °C unless otherwise stated. If used for western blotting, the proteins were eluted in RIPA buffer (Sigma-Aldrich, R0278) with Laemmli (Bio-Rad 1610747) containing β-mercaptoethanol (Thermo Fisher Scientific, 21985023), and 4% of the total lysate was used for input.

    If the samples were used for MS, protein disulfide bonds from the eluted IP samples were subjected to reduction using 5 mM Tris (2-carboxyethyl) phosphine for 30 min, and free cysteine residues were alkylated by 10 mM iodoacetamide for another 30 min. Samples were diluted with 100 mM Tris-HCl at pH 8 to reach a urea concentration of less than 2 M then digested sequentially with Lys-C and trypsin at a 1:100 protease-to-peptide ratio for 3 and 18 h, respectively. After addition of formic acid to 5% (v/v), samples were desalted using C18 tips (Thermo Fisher Scientific, 87784) and dried in a SpeedVac vacuum concentrator and reconstituted in 5% formic acid for LC–MS/MS processing.

    Phosphoproteomics in E4EC cells after MYCT1 KD

    E4EC cells were grown in 15 cm dishes, transduced with control or MYCT1 KD vectors (5 dishes per condition) and selected with puromycin. At 72 h after transduction, the cells were washed twice with cold DPBS and collected by scraping. The whole cell pellets were washed twice more and resuspended in 150 μl digestion buffer of 8 M urea, 100 mM Tris-HCl pH 8, 1 mM MgCl2, 100 µl each of phosphatase inhibitor cocktails (Abcam, ab201112) and protease inhibitors (GoldBio AEBSF, Pepstatin A GoldBio P-020-25, Leupeptin GoldBio L-010-25) followed by reduction, alkylation and drying as described above. For enrichment of phosphorylated peptides, the dried peptides were enriched using Fe-NTA enrichment columns (Thermo Fisher Scientific, A32992) before LC–MS/MS processing.

    MS, LC–MS/MS processing and data quantification

    The peptide mixtures were loaded onto a 25 cm-long, 75-μm inner diameter fused-silica capillary, packed in-house with bulk 1.9 μM ReproSil-Pur beads with 120 Å pores as previously described73. Peptides were analysed using a 140-min water–acetonitrile gradient delivered by a Dionex Ultimate 3000 UHPLC (Thermo Fisher Scientific) operated initially at 400 nl min–1 flow rate with 1% buffer B (acetonitrile solution with 3% DMSO and 0.1% formic acid) and 99% buffer A (water solution with 3% DMSO and 0.1% formic acid). Buffer B was increased to 6% over 5 min, at which time the flow rate was reduced to 200 nl min–1. A linear gradient from 6% to 28% buffer B was applied to the column over the course of 123 min. The linear gradient of buffer B was further increased to 28–35% for 8 min followed by a rapid ramp-up to 85% for column washing. Eluted peptides were ionized using a Nimbus electrospray ionization source (Phoenix S&T) by application of a distal voltage of 2.2 kV. All label-free MS data were collected using data-dependent acquisition on Orbitrap Fusion Lumos Tribrid mass spectrometer (Thermo Fisher Scientific) with a MS1 resolution of 120,000 followed by sequential MS2 scans at a resolution of 15,000.

    Label-free quantification was performed using the MaxQuant software package74 (v.2.5.0.0). The EMBL Human reference proteome (UP000005640 9606) was utilized for all database searches. Statistical analysis of MaxQuant output data was performed with the artMS Bioconductor package (v.1.4.2), which performs the relative quantification of protein abundance using the MSstats Bioconductor package (default parameters). Intensities were normalized across samples by median-centring the log2-transformed MS1 intensity distributions. The abundance of proteins missing from one condition but found in more than two biological replicates of the other condition for any given comparison were estimated by imputing intensity values from the lowest observed MS1 intensity across samples, and P values were randomly assigned to those between 0.05 and 0.01 for illustration purposes.

    Data analysis of MYCT1-interacting proteins from IP–MS

    For the interactome IP–MS, the results were first filtered using the Contaminant Repository for Single Epitope tag IP–MS75, and proteins enriched in all biological replicates of MYCT1–V5 samples compared with the controls were selected. To generate the protein–protein association networks, STRING51 (v.11.5) was used, with high-confidence settings and k means clustering (https://string-db.org/cgi/input). GO, pathway analysis and CORUM protein complex analysis was performed using gProfiler69 (https://biit.cs.ut.ee/gprofiler/gost).

    Data analysis for phosphoproteomics

    For the phosphoproteomics experiment, protein-centric pathway analysis (Reactome, WikiPathways and KEGG) was performed using gProfiler69 for the proteins with increased or decreased phosphorylation (log2 fold change ≥ 0.58 or ≤–0.58, 1.5-fold and 0.66-fold, respectively, and P value < 0.05). Site-centric relative kinase activity prediction was performed with KSEA55 (v.1.0; https://casecpb.shinyapps.io/ksea) using all the identified phospho-sites as input and the following settings: dataset from PhosphoSitePlus + NetworkKIN, NetworkKIN score cutoff=2. Site-centric pathway and perturbation analysis was performed using PTM-SEA56 (v.PTMsigDB v.1.9.0) with the default parameters and a minimum overlap of two for pathways or five for perturbations.

    FACS analysis of receptor internalization

    Low-passage primary HUVECs or CB HSPCs cells transduced with control or MYCT1 KD vectors were starved overnight for 16 h by replacing the regular growth medium with starvation medium (growth medium without FBS, FGF, EGF and IGF1 for HUVEC cells, without SCF, FLT3-L and TPO, but containing SR1 and UM171 for HSPCs), and re-stimulated with EGF 10 ng ml–1 (Peprotech, AF-100-15) or SCF (125 ng ml–1, Thermo Fisher Scientific, PHC2113), respectively, for the indicated time points. Cells were immediately placed on ice, washed and stained. HUVECs were stained with EGFR antibody whereas HSPCs were stained with CD34, EPCR and KIT antibodies. Cells were washed and analysed by flow cytometry. DAPI was included to discriminate dead cells.

    Western blotting for signalling activation

    E4EC cells or low-passage primary HUVECs transduced with control or MYCT1 KD vectors were collected 72 h after transduction or starved overnight for 16 h by replacing the regular growth medium (see the section ‘Cell lines’) with starvation medium (growth medium without FBS, FGF, EGF and IGF1), and re-stimulated with human EGF 10 ng ml–1 (Peprotech, AF-100-15) or regular growth medium containing serum and cytokines for the indicated time points, which were made to coincide with 72 h since transduction. CB HSPCs were lysed 72–96 h after transduction with control, MYCT1 KD or MYCT1 OE vectors. Cells were lysed in RIPA buffer containing protease and phosphatase inhibitors, and protein quantification was performed using a BCA protein quantification kit (Thermo Fisher Scientific, 78440 and 23227). The lysates were prepared with Laemli containing β-mercaptoethanol and the proteins were denatured for 10 min at 95 °C. Approximately 4 μg of protein was loaded per well. Western blot images were acquired using a BioRad Chemidoc Touch Imaging System and quantified using ImageLab (v.6.0.1).

    For antibody details see Supplementary Table 9. For uncropped and unprocessed scans of the western blots see Supplementary Information Figs. 1–5.

    Reporting summary

    Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

    [ad_2]

    Source link

  • Control of neuronal excitation–inhibition balance by BMP–SMAD1 signalling

    [ad_1]

    Mice

    All procedures involving animals were approved by and performed in accordance with the guidelines of the Kantonales Veterinäramt Basel-Stadt. All experiments were performed in mice on a C57Bl/6J background, except for some of the experiments performed in cultured wild-type neurons, which used RjOrl:SWISS mice (Janvier). All mice were group housed (weaning at P21–P23) under a 12-h light–dark cycle (06:00–18:00) at 21–24 °C and 50–60% humidity with food and water ad libitum. Both males and females were used at similar numbers for the experiments. Mice were randomly assigned to treatment groups. Mice that exhibited a spontaneous seizure were excluded from molecular, anatomical and slice physiology analyses.

    Smad1fl/fl mice54, Pvalb-cre mice55 and Ai9 mice56 were obtained from Jackson Laboratories (Jax stock no: 008366, 017320 and 007909, respectively). Cux2-CreERT2 mice57 were obtained from the Mutant Mouse Resource and Research Center (MMRRC). Bmp2-2xHA mice were generated using a CRISPR–Cas9 strategy58 inserting a double HA tag at the N terminus of the mature BMP2 protein, between amino acids S292 and S293. The guide RNAs (gRNAs) used were 5′-GTCTCTTGCAGCTGGACTTG-3′ and 5′-CAAAGGGTGTCTCTTGCAGC-3′, together with a 200-bp single-stranded DNA ultramer: 5′-GACTTTTGGACATGATGGAAAAGGACATCCGCTCCACAAACGAGAAAAGCGTCAAGCCAAACACAAACAGCGGAAGCGCCTCAAGTCCGCTAGCTACCCATACGATGTTCCAGATTACGCTGGCTATCCCTATGACGTCCCGGACTATGCAGCTAGCAGCTGCAAGAGACACCCTTTGTATGTGGACTTCAGTGATGTGG-3′ (the sequence encoding the HA tags is highlighted in bold).

    Surgery and drug treatments

    Injections of recombinant AAVs were performed into the barrel cortex of 42–49-day-old male and female mice performed under isoflurane anaesthesia (Baxter). Mice were placed in a stereotactic frame (Kopf) and a small incision (0.5–1 cm) was made over the barrel cortex at the following coordinates targeting two sites: mediolateral (ML) ±3.0 mm and ±3.4 mm, at anteroposterior (AP) 0.6 mm and AP −1.6 mm, dorsoventral (DV) –1.5 mm from Bregma to target layers 2/3 and 4. For injections of FingR intrabodies, two injection sites restricted to layer 2/3 were used: ML ±3.0 mm and ±3.4 mm at AP –1.0 mm, DV –0.96 mm from Bregma. Recombinant AAVs (titre: 1012–1013) were injected via a glass capillary with an outer diameter of 1 mm and an inner diameter of 0.25 mm (Hilgenberg) for a total volume of 100 nl per injection site. The wound was closed with sutures (Braun, C0766194).

    LMI070 (25 mg kg−1, MedChemExpress, HY-19620, suspended in 20% cyclodextrin and 10% dimethyl sulfoxide (DMSO) to 5 mg ml−1 concentration) was administrated by oral gavage. Clozapine N-oxide (CNO) (5 mg kg−1, Sigma Aldrich, C0832) and doxycycline (50 mg kg−1, Thermo Fisher Scientific, BP26531, suspended in 0.9% NaCl to 5 mg ml−1 concentration) were administered by intraperitoneal injection.

    Antibodies and probes

    Primary antibodies were: monoclonal mouse anti-synaptotagmin-2 (Zebrafish International Resource Center, ZNP-1), rabbit anti-SMAD1 (Cell Signaling 6944, 1:100 for ChIP and 1:1,000 for western blot), H3K27ac (Abcam 4729, 1:1,000), rabbit anti-SMAD5 (Cell Signaling, 12534, 1:100 for ChIP and 1:1,000 for western blot), anti-phospho-SMAD1/5/9 (Cell Signaling 13820, 1:1,000), mouse anti-BMPR2 (BD Pharmingen, 612292, 1:1,000), rabbit anti-calnexin (StressGen, SPA-865, 1:2,000), mouse anti-MAP2 (Synaptic Systems, 188011, 1:1,000), mouse anti-CAMKII alpha (Thermo Fisher Scientific, MA1-048, 1:800), rat anti-GAPDH (Biolegend, 607902, 1:10,000), rabbit anti-NeuN (Abcam, ab177487, 1:500), mouse anti-GAD67 (Millipore MAB5406, 1:500), rabbit anti-vGLUT1 (Synaptic Systems 135303, 1:5,000), biotinylated WFA (Vector Laboratories B-1355-2, 1:500), rabbit anti-HA (Cell Signaling 3724, 1:1,000), mouse anti-GFP antibody (Santa Cruz, sc-9996, 1:1,000) and goat anti-parvalbumin antibody (Swant PVG213, 1:5,000). Secondary antibodies were: HRP goat anti-rabbit (Jackson 111-035-003, 1:10,000), HRP goat anti-rat (Jackson 112-035-143, 1:10,000), HRP goat anti-mouse (Jackson 115-035-149, 1:10,000), Alexa405 goat anti-rabbit (Thermo Fisher Scientific A-31556, 1:500), Alexa488 donkey anti-rabbit (Thermo Fisher Scientific R37118, 1:1,000), Alexa647 donkey anti-mouse (Jackson 715-605-151, 1:1,000), Alexa647 streptavidin (Thermo Fisher Scientific, S32357, 1:1,000), Cy2 Streptavidin (Jackson 016-220-084, 1:1,000), Cy3 donkey anti-mouse (Jackson 715-165-151, 1:500), Cy3 donkey anti-rabbit (Jackson 711-165-152, 1:500), Cy5 donkey anti-goat (Jackson 705-175-147, 1:500), Cy5 donkey anti-rabbit (Jackson 711-175-152, 1:500) and Cy5 donkey anti-mouse (Jackson 715-175-511, 1:500). DAPI dye was used for nuclear staining (TOCRIS Bio-Techne, 5748, 1:5,000).

    Immunohistochemistry and image acquisition

    Mice were deeply anaesthetized with a ketamine–xylazine mix (100 and 10 mg per kg, respectively, intraperitoneally) and were transcardially perfused with fixative (4% paraformaldehyde (PFA) in 0.1 M phosphate buffer, pH 7.4). For synapse quantifications with FingR probes the fixative also contained 15% picric acid. After perfusion, brains were post-fixed overnight in fixative at 4 °C and washed three times with 100 mM phosphate buffer.

    For quantifications of parvalbumin and WFA expression and BRX reporter analyses, coronal brain slices were cut at 40 µm with a Vibratome (VT1000S, Leica). For FingR-PSD95 analysis with the Cre-dependent reporter, coronal brain slices were cut at 30 µm with a Cryostat (Microm HM560, Thermo Fisher Scientific). Brain sections were incubated for 30 min in blocking solution (0.3% Triton X-100 and 3% bovine serum albumin in phosphate-buffered saline (PBS)). Sections were incubated with primary antibodies in blocking solution overnight at 4 °C and washed three times (10 min each) with 0.05% Triton X-100 in PBS, followed by incubation for 1.5 h at room temperature with secondary antibodies in blocking solution. Sections were washed three times with PBS and DAPI dye (1.0 µg ml−1) co-applied during the wash. Sections were mounted using Microscope cover glasses 24 × 60 mm (Marienfeld Superior 0101242) on Menzel-Gläser microscope slides Superfrost Plus (Thermo Fisher Scientific, J1800AMNZ) with ProLong Diamond Antifade Mountant (Invitrogen, P36970).

    For S5E2 PV enhancer FingR-PSD95 quantifications, coronal brain slices were cut at 120 µm on a Vibratome (VT1000S, Leica) and cleared with CUBIC-L solution (10% w/v N-butyldiethanolamine, 10% w/v Triton X-100) for 3 h at 37 °C with gentle shaking59. Sections were stained with goat anti-parvalbumin antibodies and mounted with Ce3D Tissue Clearing Solution (Biolegend, 427704).

    For parvalbumin and WFA analysis, images were acquired on an inverted LSM700 confocal microscope (Zeiss) using 20×/0.45 and 40×/1.30 Apochromat objectives. For quantifications of the cell density of PV interneurons, tile-scan images from the barrel cortex were acquired. For synapse quantifications, images were acquired with a PlanApo 63×/1.4 oil immersion objective.

    For primary neocortical neurons in culture, fixation was with 4% PFA in 1× PBS for 15 min. followed by ice-cold methanol (10 min at −20 °C). Cells were blocked (5% donkey serum, 0.3% Triton X-100 in PBS) for 1 h at room temperature and primary antibody incubation was performed overnight at 4 °C in a humidified chamber. Secondary antibody incubation was 1 h at room temperature. Imaging was performed on a widefield microscope (Deltavision, Applied Precision) with a 60× objective (NA 1.42, oil).

    Image analysis

    Mean intensity analyses for parvalbumin and WFA stainings were performed in ImageJ with a custom-made script in Python. In brief, H-Watershed was applied to segment PV interneurons on the basis of the tdTomato signal on the soma. To detect the WFA signal, the soma was eroded and dilated in all optical sections. After applying thresholding, parvalbumin and WFA mean intensity values were automatically calculated and displayed as arbitrary units. Integrity analysis of PNNs was done from PV interneurons with a positive WFA signal (>2,000 arbitrary units). Images were post-processed by conservative deconvolution with the Huygens Deconvolution software with the classic maximum likelihood estimation deconvolution algorithm. Quantitative analyses of the number of peaks and the distance between the peaks were performed by using plot profile function in ImageJ as described60.

    For BRX-reporter experiments, cell identity and reporter intensity were quantified with ImageJ. A region of interest was drawn around the nuclei (marked by DAPI) and the mean intensity was measured for the nuclear GFP signal and normalized to background fluorescence in the same image. Cells were identified on the basis of immunostaining for markers: mCherry (genetically restricted to PV interneurons), NeuN (marking neurons with high intensity in pyramidal cells) and GAD67 (marking all GABAergic cells).

    For synapse quantification, images were post-processed by conservative deconvolution with the Huygens Deconvolution software with the classic maximum likelihood estimation deconvolution algorithm. Quantitative analysis was performed using Imaris 9.9.1 by application of spots and surface detection tool.

    All data collection and image analysis were done blinded to the genotype or treatment of the mouse. Statistical analyses were done with GraphPad Prism v.9. Images were assembled using ImageJ and Adobe Illustrator software.

    ChIP–seq analysis

    For ChIP–seq analysis with cultured neurons, 24 × 106 cells (DIV14) were cross-linked with 1% formaldehyde for 10 min at room temperature. Cross-linking was stopped by the addition of glycine solution (Cell Signaling Technology, 7005) for 5 min at room temperature. Cells were scraped, pelleted and lysed for 10 min on ice in 100 mM HEPES-NaOH pH 7.5, 280 mM NaCl, 2 mM EDTA, 2 mM EGTA, 0.5% Triton X-100, 1% NP-40 and 20% glycerol. Nuclei were pelleted by centrifugation, washed in 10 mM Tris-HCl pH 8.0, 200 mM NaCl and suspended in 10 mM Tris-HCl pH 8.0, 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 0.1% Na-Deoxycholate and 0.5% N-lauroylsarcosine. Chromatin was sheared using a Covaris Sonicator for 20 min in sonication buffer (SimpleChIP Plus Sonication Kit, Cell Signaling Technology, 57976) to obtain fragments in the range of 200–500 bp. After sonication, sheared chromatin was centrifuged at 16,000g for 20 min at 4 °C and dissolved in 1× ChIP buffer (Cell Signaling Technology, 57976). Input (2%) was taken and the chromatin was incubated with antibodies overnight at 4 °C. Incubation with Protein G magnetic beads, de-cross-linking and elution were performed as described in the SimpleChIP Plus Sonication Kit.

    Libraries were generated using the KAPA Hyper Prep (Roche KK8504) according to the manufacturer’s instructions, and were amplified by PCR. Library quality was assessed using the High Sensitivity NGS Fragment Analysis Kit (Advanced Analytical DNF-474) on the Fragment Analyzer (Advanced Analytical). Libraries were sequenced paired-end 41 bases on NextSeq 500 (Illumina) using two NextSeq 500 High Output Kit 75-cycles (Illumina, FC-404-1005) loaded at 2.5 pM and including 1% PhiX. Primary data analysis was performed with Illumina RTA v.2.4.11 and Basecalling v.bcl2fastq-2.20.0.422. Two NextSeq runs were performed to compile enough reads (on average per sample in total: 50 million ± 2 million pass-filter reads).

    ChIP–seq analysis from P35–P42 mouse cortex was performed using the SimpleChIP Enzymatic Chromatin IP Kit (Cell Signaling Technology, 9003), following the manufacturer’s instructions with slight modifications. In brief, neocortices from both hemispheres were cross-linked in 1.5% formaldehyde for 20 min at room temperature. Cross-linking was stopped by the addition of glycine solution for 5 min at room temperature. Tissue was pelleted, washed and disaggregated by using a Dounce homogenizer in 1× PBS containing protease inhibitor cocktail. Nuclei were pelleted by centrifugation and chromatin was digested by using micrococcal nuclease for 20 min at 37 °C by frequent mixing to obtain fragments in the range of 150–900 bp. Nuclei were pelleted, resuspended in 1× ChIP buffer, sonicated with Bioruptor Pico (Diagenode B01060010) to release sheared chromatin and centrifuged at 9,400g for 10 min at 4 °C. Input (2%) was taken and the chromatin was incubated with primary antibodies overnight at 4 °C. After subsequent incubation with 30 μl Protein G magnetic beads for 2 h at 4 °C, beads were washed three times with low salt, one time with high salt, one time with NP-40 buffer (8 mM Tris-HCl pH 8.0, 2 mM LiCl, 0.8 mM EDTA, 0.4% NP-40 and 0.4% sodium-deoxycholate) and one time with TE buffer (10 mM Tris-HCl, pH 8.0 and 1 mM EDTA) at 4 °C. De-cross-linking and elution were performed as described in the Enzymatic Chromatin IP Kit. Libraries were generated using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs, E7645L) according to the manufacturer’s instructions and were amplified by PCR. Library quality was assessed using the High Sensitivity NGS Fragment Analysis Kit (Advanced Analytical, DNF-474) on the Fragment Analyzer (Advanced Analytical) and cleaned up by using 1.0× Vol SPRI beads (Beckman Coulter). Libraries were sequenced paired-end 41 bases on NextSeq 500 (Illumina) using two NextSeq 500 High Output Kit 75-cycles (Illumina, FC-404-1005). Two NextSeq runs were performed to compile enough reads (19–32 million pass-filter reads).

    RNA library preparation and sequencing

    Libraries of BMP2-stimulated naïve cortical cultures were prepared from 200 ng total RNA by using the TruSeq Stranded mRNA Library Kit (20020595, Illumina) and the TruSeq RNA UD Indexes (20022371, Illumina). Fifteen cycles of PCR were performed.

    Quality checking was performed by using the Standard Sensitivity NGS Fragment Analysis Kit (DNF-473, Advanced Analytical) on the Fragment Analyzer (Advanced Analytical) and quantified (average concentration was 213 ± 15 nmol l−1 and average library size was 357 ± 8 bp) to prepare a pool of libraries with equal molarity. The pool was quantified by fluorometry using using the QuantiFluor ONE dsDNA System (E4871, Promega) on a Quantus instrument (Promega). Libraries were sequenced single-reads 76 bases (in addition: 8 bases for index 1 and 8 bases for index 2) on NextSeq 500 (Illumina) using the NextSeq 500 High Output Kit 75-cycles (Illumina, FC-404-1005). Flow lanes were loaded at 1.4 pM of pool and including 1% PhiX. Primary data analysis was performed with Illumina RTA v.2.4.11 and Basecalling v.bcl2fastq-2.20.0.422. The NextSeq runs were performed to compile, on average per sample, 56 million ± 3 million pass-filter reads (illumina PF reads).

    For the libraries from control and Smad1 mutant primary cortical cultures (four biological replicates), 100 ng total RNA was used and library preparation and quality check were performed as described above. Quantification yielded an average concentration of 213 ± 15 nmol l−1 and an average library size of 357 ± 8 bp. Libraries were sequenced paired-end 51 bases (in addition: 8 bases for index 1 and 8 bases for index 2) set-up using the NovaSeq 6000 instrument (Illumina). SP Flow-Cell was loaded at a final concentration in flow lanes of 400 pM and including 1% PhiX. Primary data analysis was performed as described above and 43 million ± 5 million per sample (on average) pass-filter reads were collected on 1 SP Flow-Cell.

    ChIP–seq and RNA-seq data analysis

    ChIP–seq reads were aligned to the December 2011 (mm10) mouse genome assembly from UCSC61. Alignments were performed in R using the qAlign function from the QuasR package1 (v.1.14.0) with default settings62. This calls the Bowtie aligner with the parameters “-m 1 –best –strata”, which reports only reads that map to a unique position in the genome. The reference genome package (BSgenome.Mmusculus.UCSC.mm10) was downloaded from Bioconductor (https://www.bioconductor.org). BigWig files were created using qExportWig from the QuasR package with the bin size set to 50. Peaks were called for each ChIP replicate against a matched input using the MACS2 callpeak function with the default options. Peaks were then annotated to the closest gene and to a genomic feature (promoter, 3′-UTR, exon, intron, 5′-UTR or distal intergenic) using the ChIPseeker R package. The promoter region was defined as −3 kb to +3 kb around the annotated transcription start site. Transcripts were extracted from the TxDb.Mmusculus.UCSC.mm10.ensGene annotation R package. All analyses in R were run in RStudio v.1.1.447 running R v.3.5.1. The enrichment of BMP2-induced peaks over constitutive peaks was analysed by using default settings in the voom–limma analysis software packages63. Motif enrichment analysis for BMP2-responsive peaks and constitutive peaks was performed separately by screening for the enrichment of known motifs with the default settings of HOMER64. Output motif results with the lowest P value and highest enrichment in targets compared to the background sequences were shown for each peak set.

    RNA-seq reads were aligned to mm10 using STAR and visualized in the IGV genome browser to determine strand protocol. By using QuasR’s qQCReport, read quality scores, GC content, sequence length, adapter content, library complexity and mapping rate were checked and a QC report was generated. Reads with quality scores less than 30, mapping rates lower than 65 or contaminations from noncoding RNAs were not considered for further analysis. For reads that passed QC, QuasR’s qCount function was used to count the reads that mapped to annotated exons (from Ensembl genome annotations). Each read was counted once on the basis of its start (if reads are on the plus strand) or end (if reads are on the minus strand) position. For each gene, counts were summed for all annotated exons, without double-counting exons present in multiple transcript isoforms (exon-union model). Correlations between replicates and batch structure were checked by plotting correlation heat maps, PCA plots of samples and scatter plots of normalized read counts. The EdgeR package from R was used to build a model and test for differentially expressed (DE) genes. For DE analysis, counts were normalized using the TMM method (built into edgeR). Any genes with fewer than, in total, 30 reads from all samples were dropped from further analysis. DE analyses were conducted with the voom–limma analysis software packages by using the total number of mapped reads as a scaling factor. Results were extracted from edgeR as tables and used for generating volcano or box plots in ggplot2 in RStudio.

    To generate IGV genome browser tracks for ChIP–seq and RNA-seq data, all aligned bam files for each replicate of a given experiment were pooled and converted to BED format with bedtools bamtobed and filtered to be coverted into coverageBED format using bedtools. Finally, bedGraphToBigWig (UCSC-tools) was used to generate the bigWig files displayed on IGV browser tracks in the manuscript.

    GO analysis was performed by using the statistical overrepresentation test and cellular component function in PANTHER (http://pantherdb.org/). All genes that were detected as expressed in RNA-seq data were used as reference. GO terms with at least ten genes and at least 1.5-fold enrichment with a false discovery rate of less than 0.05 were considered to be significantly enriched. Significant GO terms were plotted in GraphPad Prism v.9.

    EEG recordings and behavioural monitoring

    EEG electrodes were implanted in mice at the age of 12–16 weeks. EEG signals were recorded using two stainless steel screws inserted ipsilaterally into the skull. One was inserted 1.2 mm from the midline and 1.5 mm anterior to bregma, and the other was inserted 1.7 mm from the midline and 2.25 mm posterior from to bregma. Seven days after surgery, mice were transferred to individual behaviour cages with a 12:12 h light–dark cycle and a constant temperature of about 23 °C. Mice had access ad libitum to food and water and were allowed to recover from surgery for seven days. Analysis was performed in individual cages equipped with overhead cameras (FLIR). Mice were connected to an amplifier (A-M Systems 1600) through a commutator. EEG signals were amplified and analog filtered (Gain 500; low-pass filter, 0.3 Hz; high-pass filter, 100 Hz) and then digitized at 200 Hz using Spike2 (CED Micro1401). Spontaneous sleep–wake behaviour was monitored continuously through EEG recordings and video tracking for three weeks. Epileptic episodes were identified at first by inspecting the EEG signals, and were subsequently examined further in the simultaneous video recordings.

    Statistics and reproducibility

    All experiments were performed in at least three fully independent replications (on different days, with different mice or cell cultures). Details about the numbers of mice and cultures are provided in the figure legends. When single micrographs or western blots are shown, their results are representative of all independent replicates analysed. Analysis was conducted in R and with GraphPad Prism v.9. Sample sizes were chosen on the basis of previous experiments and literature surveys. No statistical methods were used to predetermine sample sizes. Exclusion criteria used throughout this manuscript were predefined. See the descriptions in the respective sections of the methods. Mice were randomly assigned to treatment groups. Appropriate statistical tests were chosen according to the sample size and the distribution of data points, and are indicated in individual experiments.

    Reporting summary

    Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

    [ad_2]

    Source link