Carbon Chemist

Tag: Homeostasis

  • NK2R control of energy expenditure and feeding to treat metabolic diseases

    NK2R control of energy expenditure and feeding to treat metabolic diseases

    [ad_1]

    Mice

    Mouse studies performed at the University of Copenhagen were approved by The Danish Animal Experiments Inspectorate (permit number: 2018-15-0201-01441 and 2023-15-0201-01386) and the University of Copenhagen. Animal experiments performed at the University of Michigan were approved by the University of Michigan Committee on the Use and Care of Animals (protocol no. 00011066) and in accordance with Association for the Assessment and Approval of Laboratory Animal Care and National Institutes of Health guidelines. Studies in Fig. 1p–r using EB0014 were conducted by Gubra. Mice were housed in solid bottom cages with environmental enrichment at 22 °C (±2 °C) in 55% (±10%) humidity and a 12-h light:dark cycle (light from 06:00 to 18:00). Mice had ad libitum access to water and standard chow diet (SAFE D30, Safe Diets) or 60% HFD (Rodent Diet with 60 kcal% fat, D12492i, Research Diets) to induce obesity as indicated in the figure captions and results. For studies with DIO mice, mice were challenged with HFD for a minimum of 12 weeks starting from 8 weeks of age and were used in pharmacology studies once the mean cohort size was at least 35 g. Groups were randomized for vehicle and compound treatment. Pharmacological DIO studies in wild-type male and female mice were performed on animals with a C57Bl/6 NRj genetic background (Janvier Labs). The description of backgrounds for the genetic models used are as follows: B6.V-Lepob/JRj (ob/ob) mice and RjOrl:SWISS (CD-1) mice were purchased from Janvier Labs. B6.129S4-Mc4rtm1Lowl/J (Mc4r-knockout), Ccktm1.1(cre)Zjh/J, B6.129-Leprtm3(cre)Mgmj/J, Calcrtm1.1(cre)Mgmj/J, B6;129-Gt(ROSA)26Sortm5(CAG-Sun1/sfGFP)Nat/J and Gt(ROSA)26Sortm1(CAG-EGFP/Rpl10)Dolsn mice were purchased from the Jackson Laboratory. The Ucp1-knockout line was provided by K. Kristiansen. B6N-Tacr2tm1Zpg (Nk2r-floxed) mice were generated by GenOway on a C57Bl/6N background by inserting loxP sites around exon 1, which encodes 130 out of the 384 amino acids in the full-length receptor. Ucp1-knockout, Nk2r-knockout and Nk2r-floxed lines were bred in-house at 22 °C ( ± 2 °C). Ccktm1.1(cre)Zjh/J and B6.129-Leprtm3(cre)Mgmj/J mice were crossed with Gt(ROSA)26Sortm1(CAG-EGFP/Rpl10)Dolsn mice to create CckCreL10 GFP and LeprCre L10 GFP mice respectively. Calcrtm1.1(cre)Mgmj/J mice were crossed with B6;129-Gt(ROSA)26Sortm5(CAG-Sun1/sfGFP)Nat/J to create CalcrCre Sun1 GFP mice. Studies were generally performed at 22 °C (±2 °C). Studies in Ucp1-knockout mice and the ob/ob one time injection and subcutaneous/ICV crossover study were performed in thermoneutrally (29 °C (±2 °C)) housed mice.

    Mice were trained with mock injections for all injection studies for at least 5 days. NKA (1 mg kg−1; Almac) dissolved in Gelofusine (B. Braun) was administered subcutaneously twice daily for 9 consecutive days. EB0014 (synthesized by Almac) was dissolved in DMSO to a 17 mg ml−1 solution and further in 0.9% saline with 3% BSA. EB0014 was subcutaneously administered once daily at 1 mg kg−1 for indirect calorimetry measurements and at 0.01 mg kg−1, 0.1 mg kg−1, 0.3 mg kg−1 and 1 mg kg−1 for the dose-dependent weight loss study.

    EB1002 (synthesized by Novo Nordisk or PolyPeptide) was dissolved in 8 mM phosphate and 240 mM propylene glycol (pH 8.2) and administered once, daily for 7 or 21 consecutive days or every other day for 21 days via subcutaneous injections at 40 nmol kg−1 or 325 nmol kg−1 between 15:00 and 16:00. The NK2R antagonist, saredutant (SR 48968, MedChemExpress) was injected into the peritoneum at 5 mg kg−1 in 0.9% saline with 1% Tween80 30 min prior to EB1002 injections. Body weight, blood glucose and food weight were taken immediately before injections and 24 h after injections. The amount of food for pair-fed groups was determined on the basis of at least two previous studies. To mimic a diet intervention, DIO mice were switched to chow diet 5 days prior to first injection and compared to DIO mice maintained on HFD. The effect of EB1002 on food intake in Extended Data Fig. 5a was assessed in overnight-fasted mice that were refed at the time of injection.

    The insulin tolerance test was performed in DIO mice after the 9-day injection regimen, 12 h after the final injection with 1 mg kg−1 NKA. Insulin tolerance test was carried out on 4-h fasted mice by intraperitoneal injection of 0.75 U kg−1 insulin. Twenty-four hours prior to the glucose tolerance test, DIO mice were subcutaneously injected with vehicle or 325 nmol kg−1 EB1002. Vehicle-treated mice had either ad libitum access to HFD or were pair-fed to EB1002-treated mice. Glucose tolerance test was performed the following day on 4-h fasted mice by intraperitoneal injection of 1 g kg−1 glucose. Insulin levels were measured using the Mouse/Rat Insulin Kit (mesoscale) according to the manufacturer’s protocol.

    GLP-1, leptin, glucagon and PYY were measured in plasma samples using the U-PLEX Gut Hormone Combo 1 (ms) SECTOR Kit (MSD, K15307K-1) according to the manufacturer’s protocol.

    To evaluate the aversive potential in mice, a saccharin-conditioned taste avoidance was performed as described63. On the conditioning day, mice were exposed to a new flavour (0.15% saccharin) followed by a subcutaneous injection of vehicle, 10 nmol kg−1 semaglutide or 325 nmol kg−1 EB1002.

    Liquid phase gastric emptying was performed in 4-h fasted mice. Mice received an injection of vehicle or EB1002 30 min prior to an oral gavage of 4 mg paracetamol in 0.9% NaCl. Blood samples were collected via the tail vein 15 min after gavage and paracetamol levels were measured using Acetaminophen L3K assay kit (Sekisui Diagnostics, 506-30) according to the manufacturer’s protocol.

    Tissue-specific insulin signalling was assessed in mice 18 h after injection with vehicle or EB1002. 2 h fasted mice were sedated with 75 mg kg−1 pentobarbital (intraperitoneal injection) and received a retro orbital injection with 1.5 U kg−1 insulin. Tissues were dissected 10 min after insulin administration, snap-frozen and analysed as described in ‘Immunoblotting’.

    Total lean and fat mass were measured by magnetic resonance imaging using the minispec LF90 II body composition analyser (Bruker).

    Metabolic characterization

    Oxygen consumption, carbon dioxide production and food intake were recorded using the Promethion core system (Sable Systems International) with data processing using OneClickMacroV2.52.1 and Macrointerpretersetup_v2_47 or the Phenomaster Home Cage System (TSE Systems) with PhenoMaster software v.8.2.9. Generally, mice were transferred to training cages 3–7 days prior to the measurement and were allowed to acclimate in the measurement chambers for at least 24 h or until a stable baseline was observed. Fatty acid oxidation was calculated using the formula64: energy expenditure (kcal/h) × (1-RER)/0.3.

    Core body temperature and gross motor activity measurements

    Continuous body temperature and motor activity were measured with G2 E-Mitter telemetric devices (Starr Life Sciences) or with radio frequency identification (RFID) temperature transponders (UCT-2112 microchips, Unified Information Devices). Probes were implanted into the peritoneal cavity under sterile conditions. In brief, mice were anaesthetized with isoflurane and received 5 mg kg−1 Rimadyl (ScanVet, 027693) and 8 mg kg−1 Lidocaine (AstraZeneca). The sterile probe was inserted into the peritoneum via a midline incision. After closure, mice were allowed to recover on a heated surface and received 5 mg kg−1 Rimadyl for 3 consecutive days. Mice were allowed to recover for at least 7 days before study start. E-mitter data was recorded by placing ER4000 Receivers under the cages within the TSE cabinet. Temperature data was integrated in the Phenomaster software. RFID temperature transponder data was recorded by using UID Mouse Matrix system (Unified Information Devices) in combination with the Sable system.

    Triple-chip study

    RFID temperature transponders (UCT-2112 microchips, Unified Information Devices) were surgically implanted and anchored in female mice for continuous and simultaneous measurement of temperature in three distinct anatomical locations. Surgical and post-operative procedures were performed as described above. Ventromedial abdominal chip (abdominal temperature): following a midline incision, the chip was inserted in the abdominal cavity. Distolateral femoral chip (hindlimb temperature): following a transverse left gluteal incision, a subcutaneous lateral femoral pocket was prepared, and the chip was inserted. Dorsomedial intrascapular chip (interscapular temperature) and bilateral BAT denervation: following a midline dorsal incision, the interscapular BAT was detached from the underlying muscle layer. Bilateral denervation was performed as described65. The chip was inserted with the tip containing the temperature probe placed between the BAT and the dorsal muscle. The three temperatures were recorded using the UID Mouse Matrix system (Unified Information Devices).

    Brain cannulation and ICV injections

    For administration of compounds directly into the brain of awake mice, a cannula was placed into the cerebral ventricle. B6.V-Lepob/JRj (ob/ob) mice were anaesthetized with isoflurane and received 5 mg kg−1 Rimadyl (ScanVet, 027693) and 8 mg kg−1 Lidocaine (AstraZeneca). Mice were fixated in a stereotaxic frame (Kopf Instruments) and the scalp was opened to expose the skull. Coordinates were zeroed on bregma and moved to −0.3 mm in the anteroposterior axis and −1.0 mm in the mediolateral axis. A small hole was drilled into the skull and the guide cannula (C315GS-4/Spc 2 mm, PlasticsOne) was inserted and fixated using a G-bond layer (GC America) and G-ænial universal flow (GC America). Finally, a dummy (C315DCS-4/Spc 2.5 mm, PlasticsOne) was screwed onto the guide cannula and mice were allowed to recover on a heated surface and received 5 mg kg−1 Rimadyl for 2 consecutive days following the surgery. To test the correct placement of the cannula, mice received an infusion of 1.5 μl of 24 μM angiotensin II (Sigma) in artificial cerebrospinal fluid (CSF) (Harvard Apparatus) via an injector (C315IS-4/Spc 2.5 mm, PlasticsOne) and an infusion pump (Harvard Apparatus) at a rate of 2 μl min−1 5 days after surgery. After the infusion, the injector was left in place for an additional 45 s to minimize backflow. Then, the injector was removed, and the dummy was placed on the cannula. Mice were monitored for angiotensin II-induced water intake and responsive mice were subsequently used for ICV injection studies. One week prior to study start, mice were housed at thermoneutrality. Mice first received a single subcutaneous injection of vehicle or 325 nmol kg−1 EB1002 and after a wash-out period they were infused with 1.5 μl artificial CSF or 2 nmol EB1002 in 1.5 μl artificial CSF as described above in a crossover design.

    AAV injections into the DVC of Nkr2-floxed mice

    Nk2rfl/fl mice were anaesthetized using isoflurane. Mouse heads were oriented at a 90° angle and an incision was made at the caudal aspect of the skull to expose the brainstem. Using the obex of the skull as a guide, 50 nl of AAV-GFP or AAV-CMV-CRE-GFP were injected into each site of the DVC at a depth (z) of 0.350 mm. Virus was injected at a rate of 15–35 nl min−1. The pipette remained in the DVC for an additional 3 min to allow viral particles to disperse, and then the pipette was slowly removed. Mice received prophylactic analgesic carprofen (5 mg kg−1) before and for 24 h after surgery and were monitored for 10 days following the procedure to ensure recovery for surgical intervention. Mice were fed a 60% HFD starting 6 weeks after surgery for 5 weeks. To assess the acute food intake response to EB1002, mice were injected subcutaneously with either vehicle or 325 nmol kg−1 EB1002 in a crossover design. Food intake was measured at hours 0, 1, 2, 4 and 24 and body weights were recorded at 0 and 24 h post-injection. After termination, hit sites of all mice were confirmed using immunohistochemistry and mice with a confirmed bilateral hit site were included in the analysis.

    Hyperinsulinaemic–euglycaemic clamp and peripheral glucose uptake

    Hyperinsulinaemic–euglycaemic clamps were performed in conscious, unrestrained male mice at 24 weeks of age as previously described66. In short, catheters were implanted under aseptic conditions into the right jugular vein (C20PU-MJV1458; Instech) and the left common carotid artery (C10PU-MCA1459; Instech), exteriorized in the scapular region and secured using a dual-channel vascular access button (VABM2B/25R25; Instech) under general isoflurane anaesthesia. Mice were subcutaneously injected preoperatively with Carprofen (5 mg kg−1, Norodyl Vet, Scanvet) for analgesia and a mixture of Lidocaine (7 mg kg−1, Xylocain, AstraZeneca) and Bupivacaine (7 mg kg−1, Marcaine, Orifarm) at the incision sites for local anaesthesia. Mice were allowed to recover for 7–10 days. Mice were treated with either vehicle or 325 nmol kg−1 EB1002 24 h prior to clamp experiment. Clamp studies were performed in 4 h fasted mice. At 15 min and 5 min before the start of the clamp, blood samples were taken for determination of basal glucose and insulin levels. At 0 min, the clamp was initiated with continuous infusion of human insulin (4mU kg−1 min−1, Actrapid; Novo Nordisk, Denmark). Donor red blood cells were washed and used to compensate for the blood loss to experimental mice during the repeated sampling (5 μl min−1 of 50% RBC in 10 U ml−1 heparinized saline). Blood glucose samples were taken every 10 min (Contour XT, Bayer) and blood glucose was then adjusted using a variable infusion of 50% glucose. Both human and mouse insulin levels (Mercodia) were determined at 100 and 120 min. After 120 min, a 13 μCi bolus of 2-[1-14C]-deoxy-d-glucose was given and blood samples taken at 122, 125, 135, 145 and 155 min and specific activity for 2-[1-14C]-deoxy-d-glucose was determined in these samples. After euthanization, tissues for tissue-specific 2-[1-14C]-deoxy-d-glucose uptake were sampled and snap-frozen in liquid nitrogen. Samples from tissue-specific glucose uptake were processed as previously described66.

    Pharmacological pre-toxicology evaluation

    For the evaluation of potential toxicological effects CD-1 outbred mice were daily either injected with vehicle or with increasing concentrations of EB1002 (150 nmol kg−1 (2 consecutive days), 300 nmol kg−1 (2 consecutive days), 600 nmol kg−1 (2 consecutive days), 1,200 nmol kg−1 (2 consecutive days), 2,400 nmol kg−1 (2 consecutive days), 4,800 nmol kg−1 (2 consecutive days) and finally 7,500 nmol kg−1 (3 consecutive days)). Liver, spleen, heart, kidney, oesophagus, stomach, duodenum, colon, testis, cornea, bladder and thymus were dissected, fixed in 10% formalin and stained with haematoxylin and eosin for pathohistological analysis performed by the Histology department, HistoCore, at the University of Copenhagen. Slides were compared pairwise. Serum liver enzymes were analysed by the Veterinary Diagnostic Laboratory core at the University of Copenhagen.

    Quantification of faecal cholesterol and triacylglycerides

    Faecal samples were homogenized in cold methanol containing butylated hydroxytoluene (1 mg ml−1). After centrifugation (10 min at 10,000g, 4 °C), the supernatants were transferred into fresh vials and the methanol was evaporated by vacuum centrifugation. Pellets were re-dissolved in 0.1 M potassium phosphate, pH 7.4, 0.05 M NaCl, 5 mM cholic acid and 0.1% Triton X-100. Cholesterol and triacylglycerides were quantified using colorimetric kits from DiaSys (Cholesterol (113009910704) and triacylglycerides (157109910026)) according to the manufacturer’s instructions.

    NKA and compound detection in the blood

    Pharmacokinetic profiles were determined in lean mice. Mice were subcutaneously dosed with 1 mg kg−1 NKA, 666.3 nmol kg−1 EB0014, 325 nmol kg−1 EB1001 and 325 nmol kg−1 EB1002. Blood samples were taken starting at 5 min until 60 h as indicated in respective graphs. Plasma levels of NKA were determined using a Human Neurokinin A kit Elisa Kit (Ray Biotech). Plasma levels of EB0014, EB1001 and EB1002 were determined using LC-MS after precipitation with acetonitrile containing 0.1% formic acid.

    In situ hybridization

    Wild-type mice were anaesthetized with 75 mg kg−1 pentobarbital and transcardially perfused with 4% paraformaldehyde (PFA) in PBS. Whole brains were dissected, further fixated in 4% PFA in PBS for 48 h at 4 °C and subsequently dehydrated using the automated Excelsior AS tissue processor (Thermo Scientific) and embedded in paraffin. Paraffin-embedded brains were cut into 4 μm sections using the Microm Ergostar HM 200 (Marshall Scientific) and mounted onto glass slides. After deparaffination and rehydration, RNA molecules were detected using the RNAscope Multiplex Fluorescent V2 Assay kit (ACDbio) according to manufacturer’s protocol. Nk2r, Calcr and Glp1r were detected with the RNAscope probes Mm-Tacr2 (441311), Mm-Calcr-C2 (494071-C2) and Mm-Glp1r-C3 (418851-C3), and 3-plex Negative probe (320871) and 3-plex-mouse Positive probe (320881, all ACDbio) were used as negative and positive control respectively. Signals were visualized with fluorophores at 570 nm (OP-001003) for channel 1, 520 nm (OP-001006) for channel 2 and 690 for channel 3 (OP-001001, all 1:1000, Akoya Bioscience). Sections were mounted with ProLong Gold antifade reagent with DAPI (P36935, Invitrogen). For analysis, 4 mice were used and 2–3 sections per animal were imaged.

    Immunohistochemistry

    Mice were fasted overnight and injected subcutaneously with vehicle or 325 nmol kg−1 2 h prior to euthanasia. Mice anaesthetized with isoflurane and transcardially perfused with PBS followed by 4% PFA in PBS. Whole brains were dissected, further fixated in 4% PFA in PBS for 4 h at 22 °C. After 48 h in a 30% sucrose solution, brains were cut into 30 µm sections using a sliding microtome SM2010R (Leica) with a freezing stage and temperature controller (BFS40-MPA, Physiotemp). Free floating sections were blocked in 3% donkey serum with 0.1% Triton X-100 in PBS and incubated overnight at room temperature using the following antibodies, against FOS (Cell Signalling, 2250, 1:1,000) and GFP (Aves Laboratories, 1020, 1:1,000). Sections were washed, incubated with a secondary antibody conjugated to Alexa Fluor 488 and 568 (Invitrogen, A-11039, A-11011, 1:250) and mounted.

    To assess neuronal degradation in the DVC of Nk2rDVC-GFP and Nk2rDVC-cre mice, the Fluoro-Jade C (FJC), RTD Ready-to-Dilute Staining Kit for identifying Degenerating Neurons (VWR) was applied according to manufacturer’s instructions. Fluoro-Jade C positive neurons were counted for quantification of neuronal degradation.

    Microscopy

    Fluorescence microscopy was performed using a Zeiss Axio Observer microscope with Axiocam 702 mono camera or with an Olympus BX53 microscope.

    Whole-brain FOS imaging

    Two-hour fasted obese wild-type mice received a single subcutaneous dose of vehicle or 325 nmol kg−1 EB1002 before being terminated and perfused with 4% PFA 2 h later. The brains were subsequently isolated, postfixed, and transferred to Gubra. At Gubra, the samples were cleared, stained for FOS, and imaged at single-cell resolution using a light sheet microscope as previously described40. The data from individual brains was mapped into an average mouse brain atlas template, and the number of FOS labelled cells was quantified in more than 800 brain regions. For the calculation of fold changes, brain regions without FOS signal (n = 25) were excluded.

    Immunoblotting

    Protein was isolated and western blots were run as described previously67. Proteins were detected using the following antibodies, AKT (Cell Signaling, 9272, 1:1,000), pAKT T308 (Cell Signalling, 9275, 1:1,000), Tyrosine hydroxylase (Abcam, ab137869, 1:1,000), UCP1 (Abcam, ab10983, 1:7,500) and peroxidase-conjugated AffiniPure Goat Anti-Rabbit IgG (H+L) (Jackson Immuno Research, 111-035-144, 1:5,000). Images were acquired using an Odyssey Fc Imager (LI-COR). Uncropped images can be found in the source data.

    snRNA-seq

    Mice were injected subcutaneously with vehicle or 325 nmol kg−1 EB1002 2 h prior to euthanasia. After decapitation, the brain was removed, and the DVCs were isolated from the brainstem under a surgical microscope. A 1 mm coronal section of the hindbrain from bregma −7.0 to −8.0 mm was cut with a razor blade. From the coronal section, a 1.4 mm square containing the DVC was snap-frozen. Samples from the same experimental condition were pooled (n  =  5 mice per sample). Nuclei were extracted as previously described68. Sorting of 2n nuclei was performed by flow cytometry using a BD FACSAria IIIu Influx cell sorter (BD Biosciences). The gating was set according to size and granularity using FSC and SSC to capture singlets and remove debris. To detect DraQ5-positive nuclei fluorescence was set at 647 nm and 670 nm. Each sample was sorted into separate tubes, each with a total of 20,000 nuclei per 40 µl. Sequencing libraries were generated using 10x Genomics Chromium Single-Cell 3′ Reagent kit according to the standardized protocol. Paired-end sequencing was performed using an Illumina NovaSeq 6000.

    snRNA-seq analysis

    Raw sequencing data were demultiplexed, aligned to the mouse reference genome GRCm38 (mm10) and counted using cellranger (version 7.0.0; 10x Genomics). Ambient RNA molecules were removed from cellranger raw count matrix files with cellbender:remove-background (v0.3)69. Filtered count matrices were analysed in R with Seurat (v4.3.0)70. Nuclei with at least 1000 detectable genes were retained. Genes expressed in at least 10 nuclei were retained. ScDblFinder (v1.15.4)71 with standard parameters was run on individual 10x lanes to remove doublets. The count data were normalized with NormalizeData and scaled with ScaleData function. Genes were then defined as variable using FindVariableFeatures and used as input into principal components analysis with RunPCA. The top 30 principal components were retained and used for further dimensionality reduction using RunUMAP and clustered using a resolution of 0.8 with FindClusters. To perform cell-type-specific quality control, the nuclei were split into two broad categories, neuronal and nonneuronal, using CellAnnotatorR(v), on the basis of the expression of neuronal marker gene Rbfox3 or Snap25 and the absence of nonneuronal markers. Neuronal data was further filtered by removing nuclei with unique molecular identifiers (UMIs) in the first and 99th percentile. Library complexity was calculated by dividing the log of the total genes detected per nuclei by the log of the total UMIs per nuclei. Nuclei in the first percentile of this metric were removed. Add_Mito_Ribo_Seurat was used to identify and remove nuclei with >1% mitochondria and ribosomal genes. We finally removed outliers by isOutlier with nmads = 5 run on individual 10x lanes from the package SingleCellExperiment72. After all quality control, a total of 23,664 neurons remained. Neuronal cell types were labelled by projecting labels from a previously published dataset39 (GSE166649) using Seurat FindtransferAnchors and TransferData function.

    Immediate early gene analysis

    To calculate an IEG score, rapid primary response genes73 (Fosb, Npas4, Fos, Junb, Nr4a1, Arc, Egr2, Egr1, Maff, Ier2, Klf4, Dusp1, Gadd45g, Dusp5, Btg2, Ppp1r15a and Amigo3) were used to score each nuclei with the AddModuleScore function from Seurat. For each cluster-sample combination we calculated the average activity score which we then modelled by the interaction of cell type and treatment. Estimated marginal means were compared between treatments within each cluster. P values were corrected for multiple testing using the Benjamini–Hochberg method (adjusting for the number of cell populations).

    Perturbed cell-type analysis

    We used the scDist package to calculate the transcriptional distance between treatment and controls while also controlling for individual-to-individual variability74.

    Primary cell studies

    Primary white adipocytes were isolated for wild-type mice and cultures as described75. For in vitro oxygen consumption measurements, cells were replated in Seahorse XF96 Cell Culture Microplates (Agilent Technologies) on day 3 and oxygen consumption in response to vehicle or EB1002 (10 nM, 1 µM and 10 µM) was measured using a Seahorse XFe96 Extracellular Flux Analyzer (Agilent Technologies) on day 7 as described75. For in vitro glucose uptake, differentiated cells were starved for 2 h before treatment with Krebs-Ringer buffer containing 5 mM glucose, and vehicle or EB1002 (10 nM, 1 µM and 10 µM). After 2 h, cell media was incubated with a reaction mix mix (200 mM Tris-HCl, 500 mM MgCl2, 5.2 mM ATP, 2.8 mM NADP, and 6 μg ml−1 hexokinase and glucose-6-phosphate dehydrogenase mixture (10737275001, Roche Diagnostics)) for 15 min and glucose content was measured spectrophotometrically at 340 nm (Hidex sense, Hidex). Glucose uptake was calculated on the basis of disappearance of glucose from the media. Cells have been tested negative for mycoplasma contamination.

    Ex vivo lipolysis

    To assess the effects of EB1002 on the lipolytic function of adipocytes, mature adipocytes were isolated from iWAT of wild-type chow-fed mice. In brief, adipose depots were minced and digested in Krebs-Ringer buffer containing 2% BSA and 0.2% collagenase type I (Worthington Biochemical) at 37 °C. Cells were passed through a 100-µm cell strainer, centrifuged (10 min, 10g, 4 °C) and the floating mature adipocyte fraction was washed three times. Cells were incubated with vehicle, EB1002 (10 nM, 1 µM and 10 µM) or 50 nM isoproterenol for 2 h at 37 °C. Finally, non-esterified free fatty acids were measured in the medium using the Fujifilm NEFA HR R2 kit according to manufacturer’s protocol.

    Macaque studies

    The macaque studies were conducted in compliance with all federal regulations, including the US Animal Welfare Act. Studies were reviewed and approved by the OHSU/ONPRC Institutional Animal Care and Use Committee. The ONPRC is accredited by AAALAC International. For these studies, 10 rhesus macaques (5 males and 5 ovariectomized females,12–23 years of age with a body weight ranging from 7–24 kg) were pair-housed (1 male and 1 female) in custom designed cages (Carter2 Systems) in shared rooms under fixed photoperiodic conditions (lights on from 07:00 to 19:00). The cages meet the minimum European Union accepted standards for housing nonhuman primates (2.0 m2 enclosure size, 3.6 m3 enclosure volume, and 1.8 m enclosure height). Shelves, verandas, solid flooring and changeable plastic toys were available for the monkeys. The commercially available HFD (5L0P, Lab/Test Diets) was provided ad libitum twice every day. Food intake was measured daily, and animals were separated for 1–2 h periods when individual food intake was measured. Paired food intake was measured for the remaining feeding times when animals were socially pair-housed.

    EB1001 was dissolved in 8 mM phosphate and 240 mM propylene glycol (pH 8.2) and administered for 8 consecutive weeks via subcutaneous injections between 08:00 and 09:00 prior to the morning meal. All animals were started on the 30 nmol kg−1 dose with every other day dosing (q48h) for 1 week, followed by daily dosing of the subsequent higher doses. Dose escalations were as follows (nmol kg−1): 60 (1 week), 90 (1 week), 120 (1 week), 240 (2 weeks), 480 (4 days) and 240 (10 days). Body weight was measured on a weekly basis using the same, calibrated digital scale. Heart rate and oxygen saturation were recorded in sedated animals using a pulse oximeter (Model 7500, Nonin Medical).

    Blood samples were collected in conscious animals prior to morning meal (overnight fast) and daily dose administration. Blood glucose was measured on a Biosen clinical analyser (EKF Diagnostics) and C-peptide and insulin were measured on a Cobas e411 analyser (Roche Diagnostics). Remaining chemistry parameters alanine aminotransferase (ALT), aspartate transaminase (AST), total cholesterol (Chol), creatinine (CREA), glucose triglyceride (TG), blood urea nitrogen (BUN) and LDL cholesterol were analysed using the Pentra C400 (Horiba Medical).

    Behaviour analysis was performed by members of the ONPRC Behavioural Sciences Unit blinded to the experimental design. Observations were taken directly on a mobile device and average behaviour scores were calculated on the basis of events such as anxiety, stereotypy, eye poking or withdrawn behaviour. Additional cage side observations included signs of nausea (gaping and hunched posture), emesis and stool consistency.

    Association of missense variants with cardiometabolic traits

    To assess whether the 4 missense NK2R variants (R3232H, I23T, V54I and A161T) are associated with cardiometabolic traits, their associations in T2D Knowledge Portal (HbA1c phenotype page, accessed 21 May 2024; https://t2d.hugeamp.org/phenotype.html?phenotype=HBA1C; RRID:SCR_003743)24 were queried. For each variant, only the associations that presented a P value < 0.05 for the latest and largest European genome-wide association study (GWAS) per trait were included. Additionally, the minor allele frequency in five ancestries are reported: AFR, AMR, EAS, EUR and SAS retrieved from 1000 Genomes reference panel data from dbSNP30,76.

    SNP-level associations in the HK1–NK2R–TSPAN15 region

    Utilizing the latest and largest European GWAS of HbA1c available in T2D Knowledge Portal (query on 10/05/2024) (HbA1c phenotype page, accessed 21 May 2024; https://t2d.hugeamp.org/phenotype.html?phenotype=HBA1C (RRID:SCR_003743))24, summary statistics from Jurgens et al.29 were retrieved and 1,944 common variants (minor allele frequency > 1%) located 100 kilobases (kb) upstream from the HK1 transcription start site (TSS) and 100 kb downstream from the TSPAN15 TSS (10:70929740–71367422) were investigated further.

    The number of lead, independent, genome-wide significant variants were assessed by performing LD clumping with with plink1.9 (ref. 77) and utilizing the European 1000 Genomes reference panel phase 3 version 5 (ref. 30). An r2 threshold of 0.01 and distance threshold of 1,000 kilobases (kb) were used.

    Fine mapping of HbA1c associations in 10:70929740–71367422 locus with CARMA31, a software designed to correct for differences in LD between summary statistics and LD reference panels were performed. CARMA with the default settings, utilizing European 1000 Genomes reference panel phase 3 version 5 with annotations30 were performed, and those variants that presented a posterior inclusion probability of >0.1 were investigated further. In dbSNP76, minor allele frequencies in five genetic ancestries were retrieved: AFR, AMR, EAS, EUR and SAS.

    Finally, Open Target Genetics (OTG)78 was utilized to query the variant-to-gene (V2G) scores used for gene prioritization and the associations of causal variants with eQTLs.

    Linkage disequilibrium analysis

    All analyses were performed in Rstudio (2022.07.2 + 576) with R (4.1.3). Data were loaded and manipulated using data.table (1.14.2) and tidyverse (1.3.1). LD operations were performed using plink1.9 (ref. 77), ggLD (https://github.com/mmkim1210/ggLD), and LDLink79. All results can be reproduced by following the code available at https://github.com/MarioGuCBMR/nk2r_hk1_genetics.

    TWAS of NK2R and HbA1c

    Elastic Net model of SPrediXcan methods were used to predict the association between gene and traits80,81,82. The Elastic Net-based GTEx v8 eQTL models were downloaded from https://predictdb.org/post/2021/07/21/gtex-v8-models-on-eqtl-and-sqtl/. The summary statistics of GWAS for BMI83, HbA1c levels (total sample based)83, and BMI-adjusted HbA1c levels (total sample based)84 were used to conduct the association analysis. The SNPlocs.Hsapiens.dbSNP144.GRCh37 Bioconductor package85 was used to convert the genomic coordinates of SNPs to rsID for the summary statistics of HbA1c and BMI-adjusted HbA1c. Sensitivity analysis was performed using the CAVIAR fine-mapped variants86 for NK2R in nucleus accumbens of the brain tissue.

    Genetic association studies in Greenlanders

    Blood samples from Greenlanders collected in three population surveys (data are available at ref. 87 and https://www.sdu.dk/da/sif/rapporter/2011/inuit_health_in_transition and https://www.sdu.dk/da/sif/rapporter/2019/befolkningsundersoegelsen_i_groenland) were genotyped using the Multi-Ethnic Global Array (Illumina). After quality control up to 5,758 individuals were available for association analyses. Metabolic phenotypes were measured as previously described88, and association analyses were performed with a linear mixed model, to account for relatedness and admixture, assuming an additive genetic model and adjusting for age, sex, cohort using GEMMA89. We performed association tests for all 132 variants within the coding region of NK2R and the 3′ and 5′ untranslated regions ±1,000 bp. The strongest associations across traits related to body composition were observed for the non-coding rs139900276 variant. RNA was extracted from peripheral blood for a subset of 499 individuals. The procedure for RNA extraction, sequencing, quality control, and quantification has previously been described88. NK2R expression according to rs139900276 genotype was tested with a linear mixed model adjusted for sex, age, and top ten principal components from a principal components analysis of the normalized expression matrix.

    Mutation of human wild-type NK2R

    SNPs identified by GWAS were introduced to human wild-type NK2R coding sequence (NP_001048.2) in a custom pCDNA3.1(+) vector (Genscript) using PCR-based QuickChange Site-Directed Mutagenesis (Agilent) according to manufacturer’s protocol. Mutated vector was introduced to Escherichia coli to amplify DNA and indicated mutations were confirmed by forward and reverse strand Sanger sequencing (Eurofins). PCR primers used to introduce mutations are as follows (forward, reverse): I23T (CAACACCACGGGCACGACAGCCTTCTCCA, TGGAGAAGGCTGTCGTGCCCGTGGTGTTG), V54I (TGACGGGTAATGCCATCATCATCTGGATCATCCTG, CAGGATGATCCAGATGATGGCATTACCCGTCA), A161T (CTGGTGGCTCTCACCCTGGCCTCCC, GGGAGGCCAGGGTGAGAGCCACCAG), R323H (CCGGCTTGCCTTCCATTGCTGCCCATGG, CCCATGGGCAGCAATGGAAGGCAAGCCGG), T346M (CGACCTCCCTCTCCATGAGAGTCAACAGGTG, CACCTGTTGACTCTCATGGAGAGGGAGGTCG), T363A (TGGCTGGGGACGCAGCCCCCTCC, GGAGGGGGCTGCGTCCCCAGCCA), H395R (TTGCCCCCACCAAAACTCGTGTTGAAATTTGAGGATC, GATCCTCAAATTTCAACACGAGTTTTGGTGGGGGCAA).

    Receptor activity assays

    NKA-induced activation of mutated human NK2R and substance P-, NKA-, NKB-, EB1001- and EB1002-induced activation of mouse and human wild-type NK1R, NK2R and NK3R were measured by inositol-1,4,5-trisphosphate [3H] Radioreceptor assay (IP3 assay). IP3 assays were carried out using COS-7 cells (ATCC, CRL-1651) transiently transfected by calcium phosphate transfection with one of the mutated NK2R variants or the wild-type receptors as previously described75. The IP3 assay was performed the day after transfection. In brief, cells were washed and pre-incubated in assay buffer (HBSS, 10 mM LiCl, 0.2% w/v ovalbumin) for 30 min followed by 120 min incubation with substance P, NKA, NKB, EB1001 or EB1002 at 37 °C as indicated in result section and figure legends. After incubation, plates were immediately placed on ice, and cells were lysed (10 mM formic acid). After 30 min incubation 1 mg per well SPA YSI beads were pipetted into a solid white 96 wells plate and 35 μl of the lysis solution was transferred to the plate. Plates were mixed, briefly centrifuged and left at room temperature for 8 h before counting in a MicroBeta plate counter (Perkin Elmer). Cells have been tested negative for mycoplasma contamination.

    Sample size determination and blinding

    No statistical methods were applied to predetermine sample size for in vivo pharmacology experiments. Sample sizes were determined on the basis of previous experience with related experimental setups75. Studies were not blinded.

    Statistical analysis

    Statistical analyses were performed using GraphPad Prism v.9.5.1 or SPSS v.29.0.2.0 (IBM). Sample numbers and statistical analysis methods are provided in the figure legends. Data are presented as mean ± s.e.m. unless otherwise specified.

    Reporting summary

    Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

    [ad_2]

    Source link

  • Leptin-activated hypothalamic BNC2 neurons acutely suppress food intake

    Leptin-activated hypothalamic BNC2 neurons acutely suppress food intake

    [ad_1]

    Mice

    All animal experiments were approved by the Institutional Animal Care and Use Committee at Rockefeller University and were carried out in accordance with the National Institutes of Health guidelines. Mice were group housed in a 12-h light/12-h dark cycle at 22 °C and 30–60% humidity with ad libitum access to a normal chow diet and water. We used the following mouse genotypes: C57BL/6J (wild type (WT); stock no. 000664, The Jackson Laboratory), NPY-IRES2-FlpO-D (The Jackson Laboratory, stock no. 030211), Rosa26-LSL-Cas9 (The Jackson Laboratory, stock no. 024857) and BNC2-P2A-iCre (see below). For all Cre or Flp mouse line experiments, only heterozygous animals were used. Sample sizes were decided on the basis of experiments from similar studies. Littermates of the same sex were assigned randomly to either experimental or control groups. The experiments were performed using both male and female mice, as indicated.

    Generation of BNC2-P2A-iCre mouse line

    The BNC2-P2A-iCre mouse line was generated by the CRISPR and Genome Editing Resource Center and Transgenic and Reproductive Technology Resource Center at Rockefeller University using CRISPR–Cas9 technology51. Briefly, a custom-designed long single-stranded DNA (lssDNA) donor, containing homology arms of Bnc2 locus flanking the P2A-iCre sequence, was inserted near the endogenous STOP codon. Two guide RNAs (sgRNAs) were used to induce site-specific double-stranded breaks. The lssDNA donor with the pre-assembled Cas9 protein–gRNA complexes was mixed and microinjected into C57BL/6J mouse zygotes following standard CRISPR genome engineering protocols. The resulting live offspring were genotyped by PCR with two sets of primers that specifically amplified the mutant allele. Validation was ensured by Sanger sequencing. The BNC2-P2A-iCre transgenic animals were bred to C57BL/6J mice for maintenance.

    Viruses

    AAVs used in these studies were obtained from Addgene, UNC Vector Core, or generated by Janelia Viral Tools Service. We used the following viruses: AAV5-hSyn-DIO-hM3D(Gq)-mCherry (Addgene, catalogue no. 44361, 2.2 × 1013 vg ml−1), AAV5-hSyn-DIO-hM4Di(Gi)-mCherry (Addgene, catalogue no. 44362, 2.5 × 1013 vg ml−1), AAV5-hSyn-DIO-mCherry (Addgene, catalogue no. 50459, 2.2 × 1013 vg ml−1), AAV5-Ef1a-DIO-EYFP (Addgene, catalogue no. 27056, 1.6 × 1013 vg ml−1), AAV5-hSyn-Flex-GCaMP6s-WPRE (Addgene, catalogue no. 100845, 2.9 × 1013 vg ml−1), AAV5-EF1a-DIO-hChR2(H134R)-EYFP (UNC Vector Core, 2.7 × 1012 vg ml−1), AAV1-hSyn1-SIO-stGtACR2-FusionRed (Addgene, catalogue no. 105677, 2.1 × 1013 vg ml−1), AAV5-Ef1a-fDIO-mCherry (Addgene, catalogue no. 114471, 2.3 × 1013 vg ml−1), AAV8-Ef1a-fDIO-GCaMP6s (Addgene, catalogue no. 105714, 2.1 × 1013 vg ml−1), AAV5&DJ-EF1a-fDIO-hChR2(H134R)-EYFP-WPRE (UNC Vector Core, 1.4 × 1012 vg ml−1), AAV5-Ef1a-mCherry-flex-dtA (Addgene, catalogue no. 58536, 3.88 × 1012 vg ml−1). For Lepr deletion, AAV viral vectors were cloned inhouse and packaged with the AAV5 serotype using Janelia Viral Tools Service. The sequences of sgLepR are: 5′-GAGTCATCGGTTGTGTTCGG-3′, 5′-TGCCGGCGGTTGGATG GACT-3′ (virus titre, 4.9 × 1012 vg ml−1); The sequence of sgCtrl is: 5′-TTTTTTTTTTTTTTGAATTC-3′ (virus titre, 8.5 × 1012 vg ml−1). Viral aliquots were stored at −80 °C before stereotaxic injection.

    Chemicals and diet

    The following chemicals were used in this study: Leptin (ThermoFisher Scientific, catalogue no. 498OB05M, 3 mg kg−1 or 5 mg kg−1, intraperitoneal injection), Sema (Millipore Sigma, catalogue no. AT35750, 10 nmol kg−1, subcutaneous injection), CNO dihydrochloride (Tocris, catalogue no. 6329, 3 mg kg−1, intraperitoneal injection), sucrose tablets 20 mg (TestDiet, catalogue no. 1811555) and HFD (Research Diets, 60% kcal% Fat).

    Stereotactic surgery

    Mice (8–10 weeks old) were anaesthetized using isoflurane anaesthesia (induction 5%, maintenance 1.5–2%) and positioned on a stereotaxic rig (Kopf Instruments, Model 1900). Viruses were delivered into the brains through a glass capillary using a Drummond Scientific Nanoject III Programmable Nanoliter Injector. For the ARC region, the following coordinates relative to the bregma were used: anterior–posterior, −1.65 mm to −1.70 mm; medial–lateral (ML), ±0.25 mm to 0.30 mm and dorsal–ventral (DV), −5.9 mm. For chemogenetics experiments, Bnc2 neuron labeling and Lepr deletion, 30–50 nl of the virus was injected bilaterally at a rate of 1 nl s−1. For optogenetics, 30 nl of the virus was injected unilaterally at a rate of 1 nl s−1 followed by the implant of an optical fibre (ThorLabs, catalogue no. CFM12U-20) at 200 µm above the ARC (anterior–posterior, −1.65 mm; ML, 0.3 mm; DV, −5.7 mm). For fibre photometry experiments, 30 nl of the virus was injected unilaterally followed by the implant of an optical fibre cannula (Doric, catalogue no. MFP_400/430/1100-0.57_1m_FCM-MF2.5_LAF) at 150 µm above the ARC (anterior–posterior, −1.65 mm; ML, 0.3 mm; DV, −5.75 mm). For CRACM experiments, the two viruses were mixed at the ratio of 1:1, and 50 nl of the mixed virus was injected bilaterally into the ARC.

    Isolation of nuclei and snRNA-seq

    Male C57BL/6J mice aged 10–12 weeks were euthanized by transcardial perfusion using ice-cold HEPES-Sucrose Cutting Solution containing NaCl (110 mM), HEPES (10 mM), glucose (25 mM), sucrose (75 mM), MgCl2 (7.5 mM) and KCl (2.5 mM) at pH 7.4 (ref. 52). Subsequently, brains were dissected quickly in the same solution, frozen using liquid nitrogen and stored at −80 °C until nuclei isolation. To isolate nuclei, as described previously53,54, the samples were thawed on ice, resuspended in HD buffer containing tricine KOH (10 mM), KCl (25 mM), MgCl2 (5 mM), sucrose (250 mM), 0.1% Triton X-100, SuperRNaseIn (0.5 U ml−1), RNase Inhibitor (0.5 U ml−1). Samples were homogenized using a 1 ml dounce homogenizer. The resulting homogenates were filtered using a 40 μM filter, centrifuged at 600g for 10 min and resuspended in nucleus storage buffer containing sucrose (166.5 mM), MgCl2 (10 mM), Tris buffer (pH 8.0, 10 mM), SuperRNaseIn (0.05 U ml−1), RNase Inhibitor (0.05 U ml−1) for subsequent staining. Nucleus quality and number were assessed using an automated cell counter (Countess II, ThermoFisher). For staining, nuclei were labelled with Hoechst 33342 (ThermoFisher Scientific, catalogue no. H3570; 0.5 µl per million nuclei), anti-NeuN Alexa Fluor 647-conjugated antibody (Abcam, catalogue no. ab190565; 0.5 µl per million nuclei) and TotalSeq anti-Nuclear Pore Complex Proteins Hashtag antibody (BioLegend, catalogue no. 682205; 0.5 mg per million nuclei) for 15 min at 4 °C. Following staining, samples were washed with 10 ml 2% BSA (in PBS) and centrifuged at 600g for 5 min. Nuclei were then resuspended in 2% BSA (in PBS) with RNase inhibitors (SuperRNaseIn 0.5 U ml−1, RNase Inhibitor 0.5 U ml−1) for subsequent fluorescence-activated cell sorting. The samples were gated on the basis of Hoechst fluorescence to identify nuclei and then further sorted on the basis of high Alexa Fluor 647 expression, designating NeuN+ nuclei as neurons.

    Nuclei were captured and barcoded using 10x Genomics Chromium v.3 following the manufacturer’s protocol. The processing and library preparation were carried out by the Genomics Resource Center at Rockefeller University, and sequencing was performed by Genewiz using Illumina sequencers.

    SnRNA-seq analysis

    The FASTQ file was analysed with Cell Ranger v.5.0. The snRNA-seq data for ARC (WT) was preprocessed individually using the Seurat v.4 (v.4.0.3)55. Cells with more than 800 and fewer than 5,000 RNA features were selected for further analysis. Cells with greater than 1% mitochondrial genes and greater than 12,000 total RNA counts were also removed. Genes detected in fewer than three cells were excluded. We then demultiplexed the cells on the basis of their hashtag count (positive quantile = 0.8) using the built-in function in Seurat v.4. Only the cells with singlet Hashtag assignment were kept for downstream analysis. The data was then log-normalized with a scale factor of 10,000. After the initial quality control, demultiplexing and normalization steps, all the singlets were then scaled and reduced dimensionally with principal component analysis and uniform manifold approximation and projection (UMAP). Leiden clustering (resolution = 0.55) was applied to identify clusters. We used known cell-type specific gene expression to annotate the clusters.

    We analysed co-expression of marker genes within the human ARC using previously published human adult samples, and the data can be accessed through the NeMO archive (https://assets.nemoarchive.org/dat-917e9vs). A cell was considered to express the marker gene if at least two unique molecular identifiers were detected. The identification of arcuate cells was achieved by clustering and the expression of canonical markers, as detailed in the earlier study. Co-expression of genes such as Lepr, Bnc2, Agrp, Npy and Pomc was tabulated in R, and two-tailed Fisher’s tests were calculated to assess the significance of co-expression of gene pairs within the 16,819 arcuate cells in the human dataset.

    Chemogenetics for activation or inhibition

    AAV viruses were delivered bilaterally into the ARC of male BNC2-Cre mice aged 8–10 weeks. Mice were then allowed to recover and express DREADDs for at least 3 weeks. For activation or inhibition, animals were injected intraperitoneally with 3 mg kg−1 of CNO or PBS (control).

    Optogenetics for activation or inhibition

    AAV viruses were delivered unilaterally into the ARC of male BNC2-Cre mice aged 8–10 weeks followed by the implantation of an optic fibre. Subsequently, the mice were given a recovery period of at least 3 weeks to allow for gene expression. Before the experiments, the mice were habituated to patch cables over a period of 5 days. The implanted optic fibres were connected to patch cables using ceramic sleeves (Thorlabs) and linked to a 473 nm laser (OEM Lasers/OptoEngine). The output of the laser was verified at the beginning of each experiment. A blue light, generated by a 473 nm laser diode (OEM Lasers/OptoEngine) with a power of 15 mW, was used. The light pulse (10 ms) and frequency (20 Hz) were controlled by a waveform generator (Keysight) to either activate or inhibit BNC2 neurons in the ARC. In the activation feeding experiments, mice were allowed to acclimate to the cage for 20 min. Subsequently, three feeding sessions, each lasting 20 min, were initiated. During these sessions, the light was turned off for the initial 20 min, switched on for the subsequent 20 min and then turned off again for the remaining 20 min. In the inhibition feeding experiments, following the 20 min acclimation, each feeding session was extended to 30 min. The amount of food consumed during each feeding session was recorded manually. Animals were euthanized at the end of the experiments to confirm viral expression and fibre placement using immunohistochemistry.

    Real-time place preference

    A custom-made two-chamber box (50 × 50 × 25 cm black plexiglass) with an 8.5 cm gap enabling animals to move freely between the chambers was used for this assay. To evaluate the initial preference of the mice, they were introduced into the box for a 10 min session without any photostimulation. Subsequently, in the second 10 min session following the initial one, photostimulation (15 mW, 20 Hz) was paired with the chamber for which the mice exhibited less preference during the initial session. The Ethovision XT v.13 software, coupled with a CCD camera, facilitated the recording of the percentage of time spent by the mice in each chamber.

    Fibre photometry

    Mice were acclimated to tethering and a home-cage-style arena for 5 min daily over the course of 5 days before the experiment. Data acquisition was conducted using a fibre photometry system from Tucker-Davis Technologies (catalogue no. RZ5P, Synapse) and Doric components, with recordings synchronized to video data in Ethovision by transistor–transistor logic triggering. A dual fluorescence Mini Cube (Doric) combined light from 465 nm and isosbestic 405 nm light-emitting diodes (LEDs), which were transmitted through the recording fibre connected to the implant. GCaMP6s fluorescence, representing the calcium-dependent signal (525 nm), and isosbestic control (430 nm) were detected using femtowatt photoreceivers (Newport, catalogue no. 2151) and a lock-in amplifier at a sampling rate of 1 kHz. Analysis was conducted using a Matlab script involving the removal of bleaching and movement artifacts using a polynomial least square fit applied to the 405 nm signal, adjusting it to the 465 nm trace (405fitted), and then calculating the GCaMP signal as %ΔF/F = (465signal − 405fitted)/405fitted. The resulting traces were filtered using a moving average filter and down-sampled by a factor of 20. The code is available upon request.

    In situ hybridization

    Mice were briefly transcardially perfused with ice-cold RNase-free PBS. Brains were then quickly collected, embedded in optimal cutting temperature embedding medium on dry ice, and stored at −80 °C until cryostat sectioning (15 µm thickness) onto Superfrost Plus Adhesion Slides (ThermoFisher). The RNAscope Fluorescent Multiplex assay (Advanced Cell Diagnostics Bio) was based on the manufacturer’s protocol. All reagents were purchased from Advanced Cell Diagnostics (ACDbio). Probes for the following mRNAs were used: Agrp (catalogue no. 400711-C3), Pomc (catalogue no. 314081-C3), Lepr (catalogue no. 402731), Slc31a1 (catalogue no. 319191) and Bnc2 (catalogue no. 518521-C2). Briefly, brain sections were fixed in 4% paraformaldehyde (PFA) at 4 °C for 15 min followed by serial submersion in 50% ethanol, 70% ethanol, and twice in 100% ethanol for 5 min each at room temperature. Sections were treated with Protease IV for 30 min at room temperature followed by a 2 h incubation with specific probes at 40 °C using a HyBez oven. Signal amplification was achieved through successive incubations with Amp-1, Amp-2, Amp-3 and Amp-4 for 30, 15, 30 and 15 min, respectively, at 40 °C using a HyBez oven. Each incubation step was followed by two 2 min washes in RNAscope washing buffer. Nucleic acids were counterstained with DAPI Fluoromount-G (SouthernBiotech) mounting medium before coverslipping. The slides were visualized using an inverted Zeiss LSM 780 laser scanning confocal microscope with a ×20 lens. The acquired images were imported into Fiji for further analysis.

    Immunohistochemistry

    Mice were perfused transcardially with PBS first and then 4% PFA for fixation. Brains were collected and immersed in 4% PFA overnight at 4 °C for more fixation. Fixed brains were immersed sequentially in 10% sucrose, 20% sucrose and 30% sucrose buffers for 1 h, 1 h and overnight, respectively, all at 4 °C. After this, the brains were embedded in optimal cutting temperature embedding medium and stored at −80 °C until cryostat sectioning (30–50 µm thickness). For the staining process, brain sections were first blocked in a blocking buffer containing 3% BSA, 2% goat serum and 0.1% Triton X-100 in PBS for 30 min at room temperature followed by an overnight incubation with primary antibodies in the cold room. After washing in PBS, the sections were incubated with fluorescence-conjugated secondary antibodies (Invitrogen) for 1 h at room temperature. Stained sections were mounted onto SuperFrost (Fisher Scientific catalogue no. 22-034- 980) slides and then visualized with an inverted Zeiss LSM 780 laser scanning confocal microscope with a ×10 or ×20 lens. The acquired images were imported to Fiji for further analysis. The following antibodies were used: FOS antibody (1:1,000; Synaptic systems, catalogue no. 226308), pSTAT3 antibody (1:1,000; Cell Signaling Technology, catalogue no. 9145 s), GFP (1:1,000; abcam, catalogue no. ab13970), RFP (1:1,000; Rockland, catalogue no. 600-401-379).

    Electrophysiology and CRACM

    Adult mice were euthanized by transcardial perfusion using ice-cold cutting solution containing choline chloride (110 mM), NaHCO3 (25 mM), KCl (2.5 mM), MgCl2 (7 mM), CaCl2 (0.5 mM), NaH2PO4 (1.25 mM), glucose (25 mM), ascorbic acid (11.6 mM) and pyruvic acid (3.1 mM). Subsequently, brains were quickly dissected in the same solution and sectioned using a vibratome into 275 µm coronal sections. These sections were then incubated in artificial cerebral spinal fluid containing NaCl (125 mM), KCl (2.5 mM), NaH2PO4 (1.25 mM), NaHCO3 (25 mM), MgCl2 (1 mM), CaCl2 (2 mM) and glucose (11 mM) at 34 °C for 30 min, followed by room temperature incubation until use. The intracellular solution for current-clamp recordings contained K-gluconate (145 mM), MgCl2 (2 mM), Na2ATP (2 mM), HEPES (10 mM) and EGTA (0.2 mM, 286 mOsm, pH 7.2). The intracellular solution for the voltage-clamp recording contained CsMeSO3 (135 mM), HEPES (10 mM), EGTA (1 mM), QX-314 (chloride salt, 3.3 mM), Mg-ATP (4 mM), Na-GTP (0.3 mM) and sodium phosphocreatine (8 mM, pH 7.3 adjusted with CsOH). Signals were acquired using the MultiClamp 700B amplifier and digitized at 20 kHz using DigiData1550B (Molecular Devices). The recorded electrophysiological data were analysed using Clampfit (Molecular Devices) and MATLAB (Mathworks).

    For CRACM experiments, voltage-clamp recordings were conducted on BNC2 and NPY neurons. To record oIPSCs, the cell membrane potential was held at 0 mV. ChR2-expressing axons were activated using brief pulses of full-field illumination (0.5 ms, 0.1 Hz, ten times) onto the recorded cell with a blue LED light (pE-300 white; CoolLED). Subsequently, TTX (1 µM), 4-AP (100 mM) and PTX (1 µM) were applied sequentially through the bath solution, each for 10–20 min. Data acquisition started at least 5 min after each drug application.

    Indirect calorimetry

    Indirect calorimetry was performed using the Phenomaster automated home cage phenotyping system (TSE Systems). Mice were housed individually in environmentally controlled chambers maintained at 22 °C, following a 12 h light/12 h dark cycle, and at 40% humidity, with ad libitum access to food and water. O2 and CO2 measurements were collected at 15 min intervals with a settling time of 3 min and a sample flow rate of 0.25 l min−1. The raw data obtained were analysed using CalR56.

    Blood glucose, GTT and ITT

    Blood glucose levels were measured using a OneTouch Ultra meter and glucose test strips. For GTTs, mice were fasted overnight followed by a 20% glucose injection (2 g kg−1) and glucose measurements at 0, 15, 30, 60 and 120 min. ITTs were conducted after a 4 h fast, with insulin injection (0.75 U kg−1) and glucose measurements at 0, 15, 30, 45 and 60 min. To test how BNC2 neuron activity affected glucose metabolism, CNO was injected for 1 h before the start of GTT and ITT experiments.

    Statistical analysis

    All statistical analyses used GraphPad Prism v.9. Data distribution was tested for normality (Shapiro–Wilk test) and then comparisons were made using parametric or non-parametric tests, as appropriate. Two-tailed statistical tests were used, and statistical significance was determined by Student’s t-test, Mann–Whitney test, Fisher’s exact test, one-way or 2-way ANOVA, and Friedman test as indicated in the Source Data.

    Reporting summary

    Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

    [ad_2]

    Source link