Carbon Chemist

Tag: Innate lymphoid cells

  • Rhythmic IL-17 production by γδ T cells maintains adipose de novo lipogenesis

    Rhythmic IL-17 production by γδ T cells maintains adipose de novo lipogenesis

    [ad_1]

    Mice

    In all experiments, male C57BL/6J-OlaHsd mice between 8 and 12 weeks of age were used. Mice were bred in-house under specific-pathogen-free conditions in accordance with Irish and European Union regulations. Il17a/f−/− mice were received from the laboratories of V. K. Kuchroo and Y. Iwakura. Il17a−/− mice were received from the laboratory of K.H.G.M. IL-17A-GFP mice were purchased from The Jackson Laboratory. The Vav1Cre, Il7rCre, Per1Venus and Arntlfl mouse lines were bred and maintained at the Champalimaud Centre for the Unknown (CCU) animal facility. All mouse work was performed in compliance with the L.L. laboratory project licence, with ethical approval from the Trinity College Dublin ethics committee and the Animal Research Ethics Committee from the Health Products Regulatory Authority (HPRA), and the Brigham and Women’s Hospital Institutional Animal Care and Use Committee guidelines. Experiments involving the Vav1Cre (ref. 55), Il7rCre, Per1Venus (ref. 56) and Arntlfl (ref. 57) mouse lines were approved by national and local institutional review boards, the Direção Geral de Veterinária and CCU ethical committees. For experiments using rIL-17A, mice were administered 100 µl of rIL-17A (2 µg per mouse) or PBS control by intraperitoneal (i.p.) injection three times over five days.

    Environmental modulation

    Inversion of light–dark cycles

    For experiments manipulating light cycles, mice were placed inside a ventilated, light-tight cabinet at room temperature, and light was adjusted such that control mice had lights on from 07:00–19:00, and test mice had lights on from 19.00–07:00.

    Diet models

    For HFD feeding experiments, mice were fed a 45% or 60% HFD for 3 weeks or 16 weeks ad libitum, compared with control mice that were fed a SFD, in which 10% of the calories were from fat. For reverse-feeding experiments, mice were fed a SFD ad libitum from 07:00–19:00 during the light cycle, compared with controls that were fed a SFD ad libitum from 19:00 to 07:00 during the dark cycle. For isocaloric feeding experiments, mice were placed into metabolic cages, and food consumption was measured over two days. The total calories per day was calculated, and mice were then fed 50% of the total calories consumed per day, for one week, compared with ad-libitum-fed controls that had 24-h access to food. For high-sucrose feeding experiments, mice were provided a 20% sucrose solution as their drinking water ad libitum for three weeks.

    Tissue processing

    Mice were euthanized by CO2 inhalation and adipose tissue was removed, minced with a razor and digested in 1 mg ml−1 collagenase type II (Worthington) dissolved in RPMI, in a shaking incubator for 25–30 min at 37 °C. Digested cells were filtered through a 70-μm nylon mesh and centrifuged at 300g for 5 min to pellet the stromovascular fraction (SVF). Lymph nodes were disrupted through a 70-μm filter and centrifuged for 5 min at 300g to pellet. After processing, the adipose SVF and lymph-node leukocytes were stimulated with phorbol 12-myristate 13-acetate (PMA; 10 ng ml−1; Sigma), ionomycin (500 ng ml−1; Sigma) and brefeldin A (BFA; 5 µg ml−1; Sigma) in cRPMI medium, and incubated at 37 °C for 3 h. For cytokine stimulations, adipose SVF was stimulated with rIL-23 (10 ng ml−1; Miltenyi) and rIL-1β (10 ng ml−1; Immunotools) with BFA (5 µg ml−1) for 3 h.

    For the circadian cytokine production of lymph-node γδ T cells, all lymph nodes were collected from mice at 07:00 (ZT0) and plated at 3-h time points over 24 h. Each time point was then stimulated with PMA and ionomycin in BFA for 3 h, leading up to the respective time point, before being collected for fluorescent staining for flow cytometry analysis.

    For treatments with the REV-ERBβ agonist SR9009 (Sigma), cells were stimulated with PMA–ionomycin or with the recombinant cytokines rIL-1β and rIL-23 as described above, in the presence or absence of SR9009. For dose–response graphs, lymph-node cells were stimulated in the presence of 0 µM, 5 µM, 10 µM, 20 µM, 40 µM and 80 µM doses of SR9009. Adipose SVF was stimulated with 40 µM of SR9009 only.

    ELISA

    γδ T cells were pre-expanded in wild-type mice using IL-7 and IL-15 cytokines and sorted to purity. A total of 50,000 γδ T cells were adoptively transferred into Tcrδ−/− mice. After one day, wild-type, Tcrδ−/− and Tcrδ−/− age-matched mice reconstituted with 50,000 γδ T cells were euthanized and adipose tissue lysates were assayed for IL-17A protein levels by ELISA. Processed adipose SVF lysates were diluted 1:2 in reagent diluent (1% bovine serum albumin in PBS) and IL-17A protein levels were quantified using the Mouse IL-17 Quantikine ELISA kit (M1700, R&D Systems).

    Culturing of mouse adipocytes

    Interscapular BAT was isolated, minced and incubated in Dulbecco’s modified Eagle’s medium (DMEM) (glucose-free) supplemented with 10% fetal calf serum (FCS), 2.5 mM l-glutamine and 5 mM glucose. Tissue explants were then treated with or without rIL-17A (50 ng ml−1; R&D Systems) for 18 h at 37 °C. Once the medium was removed, explants were snap-frozen in liquid nitrogen for RNA extraction.

    Flow cytometry analysis

    For intracellular and intranuclear staining, cells were washed with 1 ml PBS and incubated in ZombieAqua Cell Viability Dye (Biolegend; 1:1,000 in PBS) for 20 min at room temperature. Cells were incubated with an extracellular fluorochrome-labelled antibody cocktail with Fc block (1:200; BD Biosciences) in FACS buffer (PBS + 2% FCS) for 20 min at room temperature. Cells were then washed with 2% FACS buffer resuspended in 100 µl of Foxp3 staining kit (eBioscience) and incubated at room temperature for 20 min. Cells were washed with 1× permeabilization buffer (eBioscience) and then incubated with an intracellular fluorochrome-labelled antibody cocktail in 1× permeabilization buffer (eBioscience) for 20 min at room temperature. Cells were incubated on ice for 30 min and subsequently washed in 2% FACS buffer. Cells were acquired on a FACS Canto or LSR Fortessa cytometer (BD Biosciences). Data were analysed with FlowJo v.10 software. Cell sorting was performed using a FACSAria (BD Biosciences). Sorted populations were more than 95% pure. For a list of flow cytometry antibodies, see Supplementary Table 1.

    Induction and assessment of EAE

    Mice were fed either ad libitum or a 60% HFD three weeks before EAE induction. EAE was induced in male mice by subcutaneous immunization with MOG35–55 peptide (150 µg per mouse; GenScript) emulsified in complete Freund’s adjuvant (Condrex) containing 4 mg ml−1 heat-killed Myocobacterium tuberculosis (MTB). Mice were injected i.p. with pertussis toxin (200 ng per mouse) (Kaketsuken) on day 0 to induce EAE development. Disease severity was monitored and assessed by clinical scores as follows: no clinical signs, 0; limp tail, 1; ataxic gait, 2; hind limb weakness, 3; hind limb paralysis, 4; tetra paralysis or moribund, 5. A weight loss of more than 20% constituted an additional humane end-point.

    RNA extraction and quantitative PCR analysis

    RNA extraction from isolated cells

    Adipose γδ17 T cells were isolated and sorted from adipose tissue. RNA and cDNA were generated from isolated cells using the SYBR Green Fast Advanced Cells-to-CT Kit (Invitrogen) following the manufacturer’s specific instructions. To quantify the relative mRNA expression of genes of interest, quantitative PCR was performed in a 96- or 384-well plate format (Thermo Fisher Scientific) using PowerUp SYBR Green Master Mix (Invitrogen)-based detection (eBioscience). Relative mRNA levels were calculated using the ∆∆ cycle threshold (∆∆Ct) method and normalized to corresponding endogenous controls (Actb).

    RNA extraction from tissues

    Tissues were snap-frozen in liquid nitrogen, defrosted at room temperature and transferred to a 2-ml tube containing a 5-mm stainless steel bead. Tissues were homogenized in 1 ml trizol reagent (Thermo Fisher Scientific) in a tissue lyser for 2.5 min, 25 pulses per second. Then, 200 µl chloroform was added to each tube, and they were inverted once and left at room temperature for 2–3 min, before centrifuging at 12,000g for 15 min. The aqueous phase containing RNA was transferred into a new Eppendorf tube and 500 µl isopropanol was added to precipitate the RNA. Tubes were inverted ten times and left at room temperature for 10 min, and then centrifuged at 12,000g for 10 min. Supernatants were discarded and RNA pellets were washed in 1 ml 75% ethanol, diluted in RNAse free dH2O. Tubes were centrifuged at 12,000g for 5 min and supernatants were discarded by inverting the tube. The RNA pellet was left to dry at room temperature for 20–30 min, until transparent, and the pellets were resuspended in 50 µl RNAse free water. RNA was left on ice for 30 min, then in a heat block set at 55 °C for 15 min. RNA quality and concentration were determined using a Nanodrop 2000 UV spectrophotometer (Thermo Fisher Scientific). Twenty microlitres of cDNA was synthesized from 2 µg of isolated RNA using the High-Capacity cDNA Reverse Transcription Kit (Biosciences) in a MiniAmp Thermal Cycler (BD Biosciences). To quantify the relative mRNA expression of genes of interest, quantitative PCR was performed in a 96- or 384-well plate format (Thermo Fisher Scientific) using SYBR Green-based detection (eBioscience). Relative mRNA levels were calculated using the ∆∆ cycle threshold (∆∆Ct) method and normalized to corresponding endogenous controls (Ppib or Rpl18). For a list of primers, see Supplementary Table 2.

    Protein analysis by western blotting

    BAT from wild-type and Il17a−/− mice was collected over 24 h and snap-frozen. The BAT was then lysed and centrifuged at 14,000g, and the pellet was discarded. The amount of protein was quantified using a BCA kit. Tissue lysates were subsequently boiled at 95 °C for 5 min to denature the proteins. Proteins were resolved, on the basis of their molecular weight, through SDS–PAGE gels in 1× running buffer. Proteins were electro-transferred onto PVDF membranes (Merck) in 1× transfer buffer containing 10% methanol. Membranes were blocked in 5% milk in 1× Tris-buffered saline with Tween-20 and incubated with SCD1, or α-tubulin primary antibodies (Cell Signaling Technologies) overnight at 4 °C and HRP-conjugated secondary antibodies (Jackson Immunoresearch). Membranes were incubated in ECL substrate (BioRad), and images were developed on a Biorad Gel Doc imaging system. Images were quantified using ImageJ. For raw uncropped blots, see Supplementary Fig. 1.

    Plasma 2H2O enrichment analysis and DNL calculations

    For measurements of DNL in vivo, wild-type or Il17a/f−/− mice were placed overnight on 8% enriched D2O drinking water, with subsequent collection and snap-freezing of BAT and liver. The 2H labelling of water from samples or standards was determined by deuterium acetone exchange, and using equations as previously described58.

    Metabolic cage analysis

    Indirect calorimetry experiments were performed with the Promethion metabolic cage system, or the comprehensive lab animal monitoring system (CLAMS), essentially as described59. Mice were singly housed and allowed at least 12 h of acclimatization to the new environment. O2 consumption, CO2 emission, energy expenditure, body weight, food and water intake and locomotor activity were monitored throughout the experiment. For experiments involving the manipulation of light cycles, mice were placed inside the metabolic cages at room temperature, and light was adjusted such that the control mice had lights on from 07:00–19:00, and test mice had lights on from 19:00–07:00. Analysis was performed using the online indirect calorimetry vignettes CalR (ref. 60); online software is available at https://calrapp.org/.

    Bulk RNA-seq and scRNA-seq data analysis

    The bulk RNA-seq dataset of BAT from wild-type and AdIl17rc−/− mice was downloaded from the GEO repository GSE144255 as cuff gene counts22. The bulk RNA-seq datasets of skin biopsies from patients with psoriasis who were receiving brodalumab36 and ixekizumab37 were downloaded from the GEO repositories GSE117468 and GSE31652, respectively. Heat maps were generated using the online platform Heatmapper61 (http://heatmapper.ca/).

    scRNA-seq was performed on single-cell suspensions of sorted γδ T cells and iNKT cells from the visceral adipose tissue of C57BL/6J mice using the 10x Genomics platform. A total of five visceral adipose tissue deposits from five independent biological replicates were pooled for sequencing. Single-cell suspensions were loaded onto a 10x Chromium Controller to generate gel beads-in-emulsion (GEMS), and GEMs were processed to generate unique molecular identifier (UMI)-based libraries according to the 10X Genomics Chromium Single Cell 3’ protocol. Libraries were sequenced using a NextSeq 500 sequencer. Raw BCL files were demultiplexed using Cell Ranger v.3.0.2 mkfastq to generate fastq files with default parameter. Fastq files were aligned to the mm10 genome (v.1.2.0) and feature reads were quantified simultaneously using the Cell Ranger count for feature barcoding. Filtered feature-barcode UMI count matrices containing quantification of gene expression were used for downstream analysis.

    Downstream scRNA-seq data analysis

    A total of 22,748 cells mouse γδ T cells, iNKT cells and MAIT cells expressing a median of 1,423 genes and 3,556 UMIs per cell were loaded from feature-barcode UMI count matrices using the Seurat v.4.1.0 package62. Adipose and splenic iNKT cells were reanalysed from GSE142845 (ref. 63), thymic iNKT cells were reanalysed from GSE141895 (ref. 64), thymic MAIT cells were reanalysed from E-MTAB-7704 (ref. 65), pulmonary γδ T cells were reanalysed from E-MTAB-8732 (ref. 66), peripheral lymph node (PLN) and dermal γδ T cells were reanalysed from GSE123400 (ref. 67) and meningeal γδ T cells were reanalysed from GSE147262 (ref. 68). Cells expressing more than 11% of mitochondrial genes as a percentage of total gene counts were considered to represent apoptotic or dead cells and were therefore removed from the analysis. Cells were also filtered on the basis of total UMI counts and total gene counts on a per-sample basis to remove empty droplets, poor quality cells and doublets, with a minimum cut-off of at least 300 genes per cell across all samples. UMI counts were normalized using regularized negative binomial regression using sctransform v.0.3.3 (ref. 69).

    Dimensionality reduction was performed using principal component analysis (PCA) with n = 100 dimensions and 2,000 or 3,000 variable features, and an elbow plot was used to determine the number of PCA dimensions used as input for UMAP70. For collective analysis of cells from different batches and cells sequenced using different scRNA-seq technologies the Harmony v.1.0 package71 was used with default settings to remove batch effects, and batch-corrected harmony embeddings were used for UMAP. UMAP was performed using a minimum distance of 0.3 and a spreading factor of 1. Shared nearest neighbour graphs were calculated using k = 20 nearest neighbours. Graph-based clustering was performed using the Louvain algorithm. In some cases, overclustering was performed and clusters were manually collapsed, and/or the first two dimensions of the UMAP reduction were used as input for graph-based clustering instead of PCA or harmony embeddings. Adipose γδ T cells were distinguished from adipose iNKT cells by expression of Trdc and graph-based clustering, and analysed separately for γδ1 versus γδ17 cell identification. Type-1 and type-17 innate T cells were individually identified in each dataset using graph-based clustering and gene-expression analysis, and cycling cells were excluded. For thymic innate T cells, CD44− progenitor populations were also excluded. Raw counts from type-1 and type-17 cell populations were then merged and normalized together into a single file for comparative analysis.

    Gene-expression analysis was performed using the FindMarkers() or FindAllMarkers() Seurat functions and the Wilcoxon rank sum test. Heat maps were generated using the Complex Heatmap v.2.7.11 and circlize v.0.4.14 packages72, and module scores were calculated using the AddModuleScore() Seurat function with n = 10 control features. Density plots were produced using the Nebulosa v.1.1.1 package73. Log-normalized RNA counts were used for all gene-expression analysis and visualization. All computational analysis was performed using R v.4.1.2 and RStudio Desktop v.1.4.1712 on an Ubuntu 20.04 Linux GNU (64 bit) system.

    Statistical analysis

    GraphPad Prism 9.3.0 was used for statistical analysis. For all experiments, a 95% confidence interval was used and P ≤ 0.05 was considered statistically significant. A D’Agostino–Pearson omnibus normality test was first performed to test whether the data were normally distributed (Gaussian distribution). If data were normally distributed, parametric testing was performed. If data were not normally distributed, non-parametric testing was performed. When comparing two groups, an unpaired or paired two-tailed student’s t-test was used. When comparing more than two groups, an ordinary one-way ANOVA with Dunnett’s test was used. When comparing data with two variables, a two-way ANOVA with Bonferroni test was used. Cosine curves were fitted in GraphPad Prism and circadian rhythmicity was evaluated using the cosinor regression model using the cosinor and cosinor2 R packages in RStudio. The circadian period was assumed to be 24 h for all analysis and the significance of the circadian fit was assessed by a zero-amplitude test with 95% confidence. Amplitude and acrophase were extracted from the cosinor model. In all figures, *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001, ****P ≤ 0.0001.

    Graphical representations

    All diagrams and graphical representations were created using BioRender.

    Reporting summary

    Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

    [ad_2]

    Source link

  • ILC2-derived LIF licences progress from tissue to systemic immunity

    [ad_1]

    Mice

    All mice were maintained in the Medical Research Council ARES animal facility under specific-pathogen-free conditions at 19–23 °C and 45–65% humidity with a 12/12 h light/dark cycle. In individual experiments, mice were matched for age, sex and background strain. All experiments undertaken in this study were performed with the approval of the LMB Animal Welfare and Ethical Review Body and the UK Home Office. C57BL/6 JOla controls were bred in house. Mouse strains Il7rCre (ref. 56), Roraflox/flox (ref. 57), Il1rl1−/− (ref. 58), Rag2−/−, Rag2−/−Il2rgc−/− (Rag2−/−gc−/−), Lif flox/flox, BIC33, SiglechCre (ref. 59) and Lifr–/flox were either on the C57BL/6J Ola background or back-crossed for at least six generations.

    Generation of Lif
    flox/flox mice

    To produce a Lif allele that could be conditionally deleted by Cre recombinase, we generated a homology-directed repair-template construct for use in combination with CRISPR–Cas9 to insert LoxP sites 5′ and 3′ of the final exon of both protein-coding annotated Lif transcripts (ENSMUSE00000656154). In addition, the construct included a neomycin selection cassette flanked by Frt sites to permit Flp-mediated excision, and both LoxP sites were followed by a BglII site to facilitate screening and verification of appropriately targeted embryonic stem cell clones (Extended Data Fig. 1r). Embryonic stem cells were transfected with this repair-template construct along with expression constructs for WT Cas9 and four single-guide RNAs, two targeting sequences 5′ and two targeting 3′ of the final Lif exon. Neomycin-resistant clones were screened for correct targeting initially by PCR and digested with BglII using 5′ primer pairs P1 and P2 such that a product cleaved by BglII indicated correct targeting. Clones were further verified by Southern blot analysis using 5′ and 3′ probes that both detected a 16.4 kb fragment in the WT allele and 4.9 and 7.6 kb fragments, respectively, in the targeted allele (Extended Data Fig. 1s). Guide RNA target sequences were: G1 (F) TAATGATTCTAGTTGCCTACAGG; G2 (F) TGGAGTCCCCATGTCACAGGTGG; G3 (F) TTCCTCCATCGGTCCAGGAGGGG; G4 (R) TACCCCTCCTGGACCGATGGAGG. Screening primers were: P1 TAGGAAGCCAGAGTCTAGTGGCAGTTTTAAGAGATGG; P2 AAGGCTTCTTTGTCAGAGTGGTCGG. Primers for generation of probes were: 5′ probe 1 fwd CCTGCCACCCCCTTAACCTCCATAAGTGAAAAGCAAGTGG; 5′ probe 1 rev. ACTGGGCCTGCTAGGGGTTTGACAG; 3′ probe 1 fwd TGATGGAGCTGTGGGATGGG; 3′ probe 1 rev. ACACACTCGGGCTCCATTATGC.

    Generation of LIFR conditional mice

    For generation of pDC-specific LIFR knockout (SiglecHCre/Cre Lifr−/flox) mice, pDCCre (SiglecHCre/Cre) mice were crossed with Lifr−/flox to delete exon 5 of Lifr (transcript variant 1). Both Tg(Siglech-Cre,-mCherry)59 and Lifrtm1a(EUCOMM)Hmgu (ref. 25) mice were obtained from the European mouse mutant archive. To delete the lacZ–neomycin-resistance cassette and generate mice with a loxP-flanked Lifr allele (EuComm Lifrtm1c is denoted as Lifrflox in this paper), chimaeras were bred to FLPe C57BL/6 mice. However, we also detected inefficient Lifrflox allele recombination and consequently analysed pDCCre × Lifr−/flox mice in which two Cre-mediated recombination events occurred to produce LIFR deficiency, with pDCCre × Lifr−/+ mice as controls. Despite two Cre alleles and one functional flox allele, pDCCre × Lifr−/flox mice showed a reduction in LIFR expression of only 50% in pDCs (Extended Data Fig. 1t).

    Mouse challenge protocols

    IL-33-induced type 2 lung inflammation

    Mice were challenged intranasally with IL-33 (Biolegend; 0.25 µg in 40 µl of PBS) on 3 consecutive days. All tissues were harvested 24 h following the final dose.

    Neutralizing LIF antibody treatment

    Mice were intranasally challenged with IL-33 (0.25 µg in 40 µl of PBS) and intraperitoneally injected with 100 µg of either isotype antibody (R&D systems) or anti-LIF neutralizing antibody (R&D systems) on 3 consecutive days. All tissues were harvested 24 h following the final dose.

    rLIF intranasal challenge

    Mice were intranasally challenged with rLIF (R&D systems; 1 µg in 40 µl of PBS) on 3 consecutive days. All tissues were harvested 24 h following the final dose. For the pDC migration kinetics experiment, mice were intranasally challenged with one rLIF dose (1 µg in 40 µl of PBS) and tissues harvested at 6 or 24 h after challenge.

    RWP-induced type 2 lung inflammation

    Mice were intranasally challenged with RWP (300 μg of protein per dose, Ambrosia artemisiifolia, short form; Greer Laboratories) on 3 consecutive days. All tissues were harvested 24 h following the final dose. For the chronic lung inflammation model, mice were intranasally challenged with RWP thrice weekly over 5 weeks. All tissues were harvested on day 38.

    FITC-dextran-labelled cell migration

    Mice were challenged intranasally with IL-33 (Biolegend, 0.25 µg) and 40 kDa FITC-dextran (Sigma-Aldrich, 40 µg in 50 µl of PBS) on 3 consecutive days. All tissues were harvested 24 h following the final dosing.

    Mouse infection models

    PVM infection

    Mice were infected intranasally with a single dose of PVM (50 PFU in PBS). PVM strain J3666 stock was a gift from A. J. Easton. All tissues were harvested at 8 days postinfection unless stated otherwise. For the CCL21 kinetics experiment, mice were intranasally challenged with PVM (50 PFU in PBS) and tissues harvested on 0, 4, 8 and 11 days postinfection.

    For PVM rechallenge, mice were challenged with PVM (50 PFU in PBS) on days 0 and 30 and all tissues were harvested on day 38.

    FITC-dextran-labelled cell migration

    Mice were challenged intranasally with PVM (50 PFU) and 40 kDa FITC-dextran (Sigma-Aldrich, 40 μg in 50 µl of PBS). All tissues were harvested 3 days postinfection.

    rLIF and PVM challenge

    Mice were infected with a single dose of PVM (50 PFU in PBS) intranasally and treated with a daily dose of intranasal rLIF(1 μg) or PBS. All tissues were harvested on day 8 postinfection.

    Mice were infected with a single dose of PVM (50 PFU in PBS) intranasally and, on day 8, postinfection intravenous CD45 labelling was performed by injection of 3 μg of anti-CD45 antibody (in 200 μl of PBS) via the tail vein. Mice were then culled 3 min after injection and tissues harvested.

    FTY720 and PVM challenge

    Mice were infected with a single dose of PVM (50 PFU in PBS) intranasally and injected intraperitoneally daily with either FTY720 (ref. 34) (25 μg in 250 µl; Enzo Life Sciences) or PBS. All tissues were harvested on day 8 postinfection.

    Tissue processing

    BAL isolation

    Mice were culled at the experimental endpoint, tracheae were exposed and BAL was performed by flushing the lungs three times with 0.5 ml of PBS. The fluid obtained was centrifuged at 350g for 5 min; supernatants were stored at −20 °C for cytokine detection.

    Serum isolation

    Mice were culled at the experimental endpoint and whole blood was collected. Blood samples were allowed to clot for 2 h at room temperature. Samples were centrifuged at 2,000g for 10 min and serum was collected and stored at −20 °C. For immunoglobulin enzyme-linked immunosorbent assay (ELISA), serum was diluted 1/50.

    Viral load

    Mice were culled at the experimental endpoint, and one lung lobe was snap-frozen in trizol (Invitrogen) and stored at −80 °C for RNA purification.

    Tissue preparation

    Lung tissue was predigested with 750 U ml−1 collagenase I (Gibco) and 0.3 mg ml−1 DNase I (Sigma-Aldrich) before obtaining a single-cell suspension at 37 °C for 30 min; tissue was then passed through a 70 μm cell strainer. For lymphocyte enrichment, a single-cell lung suspension was centrifuged through 30% Percoll (GE Healthcare) at 800g for 15 min. Spleen, thymus and mediastinal LN single-cell suspensions were prepared by passing tissue through a 70 μm cell strainer and lysing red blood cells. Single-bone marrow cell suspensions were prepared by flushing the femur and tibia with endotoxin-free PBS and lysing red blood cells.

    Flow cytometry

    Single-cell suspensions were incubated with fluorochrome- or biotin-conjugated antibodies in the presence of anti-CD16/CD32 antibody (Fc block, clone 2.4G2), followed by fluorochrome-conjugated streptavidin where necessary. All samples were costained with a cell viability dye (Fixable dye eFluor780, Invitrogen) and analysed on either a 5-5-laser LSRFortessa system (BD Biosciences, BD FACSDiva software v.6.2) or spectral cytometer ID7000 (Sony Biotechnology). Either FACSAria Fusion systems or iCyt Synergy (70 μm nozzle, Sony Biotechnology) was used for cell sorting. Precision Count Beads (BioLegend) were used to calculate cell numbers. Intracellular transcription factor staining was performed using the Foxp3 staining kit (eBioscience) according to the manufacturer’s instructions. For lymphocyte intracellular cytokine staining, cells were cultured with complete RPMI supplemented with Cell Stimulation Cocktail or protein transport inhibitors (eBioscience) for 4 h at 37 °C. Intracellular cytokine staining was performed using BD Cytofix/Cytoperm Plus reagents (BD Biosciences) following the manufacturer’s instructions. The expression of LEC CCL21 was detected by additional staining with goat anti-mouse CCL21 (R&D systems) and anti-goat-Alexa 488 (Invitrogen), with no stimulation, and using BD Cytofix/Cytoperm Plus reagents (BD Biosciences) following the manufacturer’s instructions.

    For intracellular phospho-STAT3 staining, cells were fixed with 2% paraformaldehyde (PFA) for 15 min and overnight permeabilization with 90% methanol at −20 °C, followed by incubation with fluorochrome antibodies diluted in 2% bovine serum albumin PBS.

    Flow cytometric analysis, including unsupervised dimensionality reduction and clustering, was performed using FlowJo, LLC v.10 (BD) and associated plug-ins. Unless otherwise stated, pDCs are defined as LiveCD45+CD11b−F4/80−CD317+SiglecH+. Myeloid cells include cDCs and CD11b− cDCs as LiveCD45+CD11b−CD11chighSiglecF−MHCIIhigh; CD11b+ cDCs as LiveCD45+CD11c−/intm SiglecF−Ly6G−CD19−TCRb−MHCIIhigh; monocytes as LiveCD45+CD11b+ SiglecF−Ly6G−F4/80+MHCII−; and alveolar macrophages as CD45+CD11c+F4/80+SiglecF+. Eosinophils are defined as CD45+CD11c−F4/80−CD11b+Gr1int SiglecF+; and neutrophils as CD45+CD11c−F4/80−CD11b+Ly6GhighSiglecF−. T cells are defined as LiveCD45+TCRb+ and B cells as LiveCD45+CD19+TCRb−; CD4+ T cells as CD45+CD3+CD4+ and ILC2s as CD45+Lin−(CD3,CD4,CD8,CD19,CD11b,CD11c,FcεR1) CD127+ICOS+. Endothelial cells are defined as LiveCD45−CD31+, LECs as LiveCD45−CD31+PDPN+ and BECs as LiveCD45−CD31+ PDPN−.

    All flow cytometry data were processed and analysed using FlowJo v.10, RRID: https://scicrunch.org/resolver/SCR_008520.

    In vitro cultured cells

    Lung immune cell sorting

    Mouse ILC2s were purified from IL-33-treated lungs (see Methods for IL-33-induced type 2 lung inflammation) as LiveCD45+Lineage−IL-7Rα+ST2+KLRG1+; and pDCs were purified from IL-33-treated lungs (see Methods for IL-33-induced type 2 lung inflammation) as LiveCD45+F4/80−CD11b−CD317+SiglecH. Cells were snap-frozen in trizol for RNA purification, and conditioned medium was collected and stored at −20 °C.

    Mouse lung ILC2s and T cells for qPCR analysis were purified from PVM-challenged mice using the same gating strategy as for ILC2s: LiveCD45+Lineage−IL-7Rα+ST2+KLRG1+; CD4+ T cells as LiveCD45+TCRb+CD4+; CD8+ T cells as LiveCD45+TCRb+CD8+; BECs as LiveCD45−CD31+PDPN−; and LECs as LiveCD45−CD31+PDPN+. Purified cells were snap-frozen in trizol for RNA purification.

    ILC2 in vitro stimulation

    Purified ILC2s were cultured for 24 h with IL-7 (10 ng ml−1) and IL-2 (50 ng ml−1) with or without IL-33 (10 ng ml−1). Cells for RNA purification and conditioned media were collected and stored at −20 °C.

    pDC culture, purification and activation

    Bone marrow cells were obtained by flushing femurs and tibias with RPMI, followed by incubation with red blood cell lysis buffer for 5 min. Following washing, cells were cultured with RPMI containing 10% fetal calf serum, 1% penicillin/streptomycin, sodium pyruvate, non-essential amino acids, l-glutamine, β-mercaptoethanol and Flt3L (10 ng ml−1) for 7–10 days. Medium was refreshed on days 3 and 6. pDCs were sorted from bone marrow-derived cultures by fluorescent activated cell sorting as LiveCD45+CD11cintSiglecH+CD317+ cells. Purified pDCs were activated with CpG (6 μg ml−1, Invivogen) and treated with or without rLIF (500 ng ml−1) for 24 h.

    Chemotaxis assay

    Migration assays were performed using Millicell cell culture inserts (Merck Millipore) with 2–3 × 105 cells per well. Purified pDCs were activated with CpG (6 μg ml−1) and treated with or without rLIF (10 ng ml−1) for 24 h. Activated pDCs were placed in inserts with 5 μm pores for 3 h in the presence or absence of cytokine rLIF (500 or 1000 ng ml−1) or chemokine rCCL21 (R&D systems) at 150 ng ml−1. The number of migrating cells was then evaluated using a flow cytometer. The results are expressed as migration index (number of migrating cells in chemokine/number of migrating cells in medium).

    Lung LEC purification and culture

    The preparation of single-cell suspensions from lung tissues is described in ‘Tissue preparation’. CD31+ lung cells were isolated from lung cell suspension using magnetic beads (CD31 biotin, Streptavidin dynabeads)60. Isolated CD31+ lung cells were seeded onto 0.2% gelatin-coated, six-well plates and cultured on complete growth medium. consisting of ECGS (Corning), 20% fetal bovine serum, 1% penicillin/streptomycin, sodium pyruvate, non-essential amino acids and 25 mM HEPES, in a humidified incubator with a gas mixture of 21% O2 and 5% CO2 at 37 °C until 70–80% confluence was achieved (usually reached in 4–7 days). Endothelial cells were detached with Accutase (Stemcell Technologies) and purified using magnetic beads (podoplanin biotin, Streptavidin dynabeads). Purified LECs were seeded onto 0.2% gelatin-coated, six-well plates, cultured in complete growth medium and used for experiments.

    In vitro LEC treatment

    Isolated LECs were treated with or without rLIF for 6 or 24 h, detached using Accutase and stained for flow cytometry analysis.

    ELISA and MAGPIX Luminex Array

    Culture supernatant was collected and stored at −20 °C until analysis. Serum IgE was measured by ELISA (Invitrogen). LIF, IL-5, type I IFN, CCL19, CCL21, CCL25, CXCL9 and CXCL10 were measured using ProcartaPlex kits (Invitrogen).

    Virus neutralization assay

    Sera from PVM-rechallenged mice were diluted in a 1:10 ratio and heat-inactivated at 55 °C for 30 min. An equal volume of PVM at 500 PFU per well concentration (1:20 final serum dilution) was incubated with serum for 1 h at 37 °C and 5% CO2. BHK-21 cell monolayers (1 × 105 per well) were infected with the virus mixture and incubated for 72 h at 37 °C and 5% CO2. Before harvesting the cells were washed three times with PBS, snap-frozen in Trizol (Invitrogen) and stored at −80 °C for RNA purification.

    qPCR with reverse transcription

    RNA was purified using Direct-zol RNA Purification Kits. For assessment of viral load, frozen tissue samples were homogenized before RNA purification. Complementary DNA synthesis was performed using SuperScript IV Reverse Transcriptase and oligo d(T)20 (Invitrogen). PVM viral load was tested with forward primer 5′-GCCTGCATCAACACAGTGTGT and reverse primer 5′-GCCTGATGTGGCAGTGCTT38 in a SYBR green qPCR assay. For lung samples, the mouse HPRT gene was used as an internal control. For the PVM neutralization assay, the dCT for viral amplification was measured with respect to the hamster GAPDH gene. For other qPCR analyses, commercially available Taqman gene expression assays (Applied Biosystems; Extended Data Table 1) were used. Samples were run on the ViiA7 real-time PCR system (Applied Biosystems).

    RNA-seq

    Cells were sorted by flow cytometry into PBS and 50% fetal calf serum. and RNA was extracted using the RNeasy Plus Micro kit (Qiagen). Following assessment using a Bioanalyser (Agilent), RNA was processed for RNA-seq using Ovation RNA-seq System v.2 (Nugen), fragmented by a Covaris M220 ultrasonicator and bar-coded using Ovation Ultralow Library Systems (Nugen). Samples were sequenced using an Illumina HiSeq 4000 by running a single-read 50-base-pair protocol (Cancer Research UK, Cambridge Institute). Sequence data were trimmed to remove adaptors and sequences with a quality score below 30 using Trim Galore (v.0.50, Babraham Bioinformatics) and then aligned to the mouse genome (GRCm38) using STAR (v.2.6.0a); differential expression was calculated using DESeq2 (v.1.18.1).

    Bioinformatic identification of candidate ligands and receptor pairs

    Gene lists for cytokines and cytokine receptors were obtained by downloading Gene Ontology gene lists for ‘Cytokine Activity’ and ‘Cytokine Receptor Activity’ from the Mouse Genome Informatics website. The curated mouse CellTalkDB database of ligand–receptor pairs was used to identify interacting gene pairs between these gene lists61. Using R programming language, the dplyr package was utilized to filter the CellTalkDB database by the cytokine and cytokine receptor gene lists to remove non-cytokine-related ligand–receptor pairs. This filtered list of ligand–receptor pairs was then used to interrogate bulk RNA-seq data of pDCs and ILC2s isolated from mouse lung. Expression of cytokine ligand–receptor pairs in which expression of the receptor by pDCs was greater than 10 RPMK and expression of the ligand by ILC2s was greater than 10 RPKM was then extracted. Ligand–receptor pairs involving Cd44 or Cd74 were excluded from the analysis due to the high expression levels of these transcripts.

    Histology

    Tissue was fixed in 10% formalin overnight and paraffin embedded; sections were stained with haematoxylin and eosin. Lung histology sections were assessed by a researcher blinded to groupings and given a score between 0 and 5 based on the presence or absence of large cellular aggregates.

    Microscopy

    Mice were euthanized and received intracardiac perfusion with PBS, followed by 4% PFA (Invitrogen). Lung and LN were collected and fixed with 4% PFA overnight. Fixed tissues were washed with PBS and placed in 30% sucrose for 24 h. Subsequently these were embedded in Optimum Cutting Temperature compound (VWR, catalogue no. 25608-930), frozen in Isopentane and sectioned on a Leica CM1860 cryostat. Sections were incubated in a blocking solution (2% goat serum and 0.5% Triton X-100 in PBS) for 1 h at room temperature. Tissue sections were then incubated overnight at 4 °C with primary antibodies against CD3e, B220 and VEGFR3, then with secondary antibodies for 1 h at room temperature. Images were acquired with an Olympus VS200 slide scanner and processed and analysed using ImageJ2 v.2.14.0/1.5 f.

    Lung histology sections were assessed for TLS by a researcher blinded to groupings and given a score between 0 and 5 based on the pathology.

    Data and statistical analyses

    Statistical analysis was performed using GraphPad Prism v.10.0b software.

    Bulk RNA-seq data generated in this study have been deposited at the Gene Expression Omnibus (GEO) under accession number GSE243691.

    Reporting summary

    Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

    [ad_2]

    Source link