Tag: multidisciplinary

  • IPBES. Global assessment report on biodiversity and ecosystem services of the Intergovernmental Science-Policy Platform on Biodiversity and Ecosystem Services. Zenodo https://doi.org/10.5281/ZENODO.3831673 (2019).

  • Laurance, W. F., Sayer, J. & Cassman, K. G. Agricultural expansion and its impacts on tropical nature. Trends Ecol. Evol. 29, 107–116 (2014).

    Article 
    PubMed 

    Google Scholar
     

  • Guillaume, T. et al. Carbon costs and benefits of Indonesian rainforest conversion to plantations. Nat. Commun. 9, 2388 (2018).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Rembold, K., Mangopo, H., Tjitrosoedirdjo, S. S. & Kreft, H. Plant diversity, forest dependency and alien plant invasions in tropical agricultural landscapes. Biol. Conserv. 213, 234–242 (2017).

    Article 

    Google Scholar
     

  • Barnes, A. D. et al. Direct and cascading impacts of tropical land-use change on multi-trophic biodiversity. Nat. Ecol. Evol. 1, 1511–1519 (2017).

    Article 
    PubMed 

    Google Scholar
     

  • Turner, E. C. & Foster, W. A. The impact of forest conversion to oil palm on arthropod abundance and biomass in Sabah, Malaysia. J. Trop. Ecol. 25, 23–30 (2009).

    Article 

    Google Scholar
     

  • Currie, D. J. Energy and large-scale patterns of animal- and plant-species richness. Am. Nat. 137, 27–49 (1991).

    Article 

    Google Scholar
     

  • Potapov, A. M., Klarner, B., Sandmann, D., Widyastuti, R. & Scheu, S. Linking size spectrum, energy flux and trophic multifunctionality in soil food webs of tropical land-use systems. J. Anim. Ecol. 88, 1845–1859 (2019).

    Article 
    PubMed 

    Google Scholar
     

  • Schwarz, B. et al. Warming alters the energetic structure and function but not resilience of soil food webs. Nat. Clim. Change 7, 895–900 (2017).

    Article 

    Google Scholar
     

  • Brown, J. H., Gillooly, J. F., Allen, A. P., Savage, V. M. & West, G. B. Toward a metabolic theory of ecology. Ecology 85, 1771–1789 (2004).

    Article 

    Google Scholar
     

  • Barnes, A. D. et al. Energy flux: the link between multitrophic biodiversity and ecosystem functioning. Trends Ecol. Evol. 33, 186–197 (2018).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Barnes, A. D. et al. Consequences of tropical land use for multitrophic biodiversity and ecosystem functioning. Nat. Commun. 5, 5351 (2014).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Thakur, M. P. Climate warming and trophic mismatches in terrestrial ecosystems: the green–brown imbalance hypothesis. Biol. Lett. 16, 20190770 (2020).

    Article 
    PubMed Central 

    Google Scholar
     

  • Wardle, D. A. et al. Ecological linkages between aboveground and belowground biota. Science 304, 1629–1633 (2004).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • de Vries, F. T. et al. Soil food web properties explain ecosystem services across European land use systems. Proc. Natl Acad. Sci. USA 110, 14296–14301 (2013).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Barnes, A. D. et al. Biodiversity enhances the multitrophic control of arthropod herbivory. Sci. Adv. 6, eabb6603 (2020).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Scheu, S. Plants and generalist predators as links between the below-ground and above-ground system. Basic Appl. Ecol. 2, 3–13 (2001).

    Article 

    Google Scholar
     

  • Rosenberg, et al. The global biomass and number of terrestrial arthropods. Sci. Adv. 9, eabq4049 (2023).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Bar-On, Y. M., Phillips, R. & Milo, R. The biomass distribution on Earth. Proc. Natl Acad. Sci. USA 115, 6506–6511 (2018).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Drescher, J. et al. Ecological and socio-economic functions across tropical land use systems after rainforest conversion. Phil. Trans. R. Soc. B 371, 20150275 (2016).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Ellwood, M. D. F. & Foster, W. A. Doubling the estimate of invertebrate biomass in a rainforest canopy. Nature 429, 549–551 (2004).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Petersen, H. & Luxton, M. A comparative analysis of soil fauna populations and their role in decomposition processes. Oikos 39, 288–388 (1982).

    Article 

    Google Scholar
     

  • Dial, R. J., Ellwood, M. D. F., Turner, E. C. & Foster, W. A. Arthropod abundance, canopy structure and microclimate in a Bornean lowland tropical rain forest. Biotropica 38, 643–652 (2006).

    Article 

    Google Scholar
     

  • Raich, J. W., Clark, D. A., Schwendenmann, L. & Wood, T. E. Aboveground tree growth varies with belowground carbon allocation in a tropical rainforest environment. PLoS ONE 9, e100275 (2014).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Jochum, M. et al. Decreasing stoichiometric resource quality drives compensatory feeding across trophic levels in tropical litter invertebrate communities. Am. Nat. 190, 131–143 (2017).

    Article 
    PubMed 

    Google Scholar
     

  • Stork, N. E. How many species of insects and other terrestrial arthropods are there on Earth? Annu. Rev. Entomol. 63, 31–45 (2018).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Terborgh, J., Robinson, S. K., Parker, T. A., Munn, C. A. & Pierpont, N. Structure and organization of an Amazonian forest bird community. Ecol. Monogr. 60, 213–238 (1990).

    Article 

    Google Scholar
     

  • Mueller, K. E. et al. Light, earthworms and soil resources as predictors of diversity of 10 soil invertebrate groups across monocultures of 14 tree species. Soil Biol. Biochem. 92, 184–198 (2016).

    Article 
    CAS 

    Google Scholar
     

  • Krashevska, V., Klarner, B., Widyastuti, R., Maraun, M. & Scheu, S. Impact of tropical lowland rainforest conversion into rubber and oil palm plantations on soil microbial communities. Biol. Fertil. Soil. 51, 697–705 (2015).

    Article 
    CAS 

    Google Scholar
     

  • Grass, I. et al. Trade-offs between multifunctionality and profit in tropical smallholder landscapes. Nat. Commun. 11, 1186 (2020).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Edwards, D. P. et al. Selective-logging and oil palm: multitaxon impacts, biodiversity indicators and trade-offs for conservation planning. Ecol. Appl. 24, 2029–2049 (2014).

    Article 
    MathSciNet 
    PubMed 

    Google Scholar
     

  • Prabowo, W. E. et al. Bird responses to lowland rainforest conversion in Sumatran smallholder landscapes, Indonesia. PLoS ONE 11, e0154876 (2016).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Ramos, D. et al. Rainforest conversion to rubber and oil palm reduces abundance, biomass and diversity of canopy spiders. PeerJ 10, e13898 (2022).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Kulmatiski, A. & Beard, K. H. Long-term plant growth legacies overwhelm short-term plant growth effects on soil microbial community structure. Soil Biol. Biochem. 43, 823–830 (2011).

    Article 
    CAS 

    Google Scholar
     

  • Le Provost, G. et al. Contrasting responses of above- and belowground diversity to multiple components of land-use intensity. Nat. Commun. 12, 3918 (2021).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Zhou, Z., Krashevska, V., Widyastuti, R., Scheu, S. & Potapov, A. Tropical land use alters functional diversity of soil food webs and leads to monopolization of the detrital energy channel. eLife 11, e75428 (2022).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Potapov, A. et al. Oil palm and rubber expansion facilitates earthworm invasion in Indonesia. Biol. Invasions 23, 2783–2795 (2021).

    Article 

    Google Scholar
     

  • Potapov, A. M. et al. Functional losses in ground spider communities due to habitat structure degradation under tropical land-use change. Ecology 101, e02957 (2020).

    Article 
    PubMed 

    Google Scholar
     

  • Rakotomalala, A. A. N. A., Ficiciyan, A. M. & Tscharntke, T. Intercropping enhances beneficial arthropods and controls pests: a systematic review and meta-analysis. Agric. Ecosyst. Environ. 356, 108617 (2023).

    Article 
    CAS 

    Google Scholar
     

  • Camarretta, N. et al. Using airborne laser scanning to characterize land-use systems in a tropical landscape based on vegetation structural metrics. Remote Sens. 13, 4794 (2021).

    Article 

    Google Scholar
     

  • Tscharntke, T. et al. Conservation biological control and enemy diversity on a landscape scale. Biol. Control 43, 294–309 (2007).

    Article 

    Google Scholar
     

  • Corley, R. H. V. & Tinker, P. B. H. The Oil Palm (John Wiley & Sons, 2015).

  • Potapov, A. M. Multifunctionality of belowground food webs: resource, size and spatial energy channels. Biol. Rev. Camb. Philos. Soc. 97, 1691–1711 (2022).

    Article 
    PubMed 

    Google Scholar
     

  • Krashevska, et al. Micro-decomposer communities and decomposition processes in tropical lowlands as affected by land use and litter type. Oecologia 187, 255–266 (2018).

    Article 
    PubMed 

    Google Scholar
     

  • Hyodo, F. et al. Gradual enrichment of 15N with humification of diets in a below-ground food web: relationship between 15N and diet age determined using 14C. Funct. Ecol. 22, 516–522 (2008).

    Article 

    Google Scholar
     

  • Hannula, S. E. & Morriën, E. Will fungi solve the carbon dilemma? Geoderma 413, 115767 (2022).

    Article 
    CAS 

    Google Scholar
     

  • Susanti, W. I., Pollierer, M. M., Widyastuti, R., Scheu, S. & Potapov, A. Conversion of rainforest to oil palm and rubber plantations alters energy channels in soil food webs. Ecol. Evol. 9, 9027–9039 (2019).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Rooney, N. & McCann, K. S. Integrating food web diversity, structure and stability. Trends Ecol. Evol. 27, 40–46 (2012).

    Article 
    PubMed 

    Google Scholar
     

  • Hyodo, F., Uchida, T., Kaneko, N. & Tayasu, I. Use of radiocarbon to estimate diet ages of earthworms across different climate regions. Appl. Soil Ecol. 62, 178–183 (2012).

    Article 

    Google Scholar
     

  • Garnier, P., Makowski, D., Hedde, M. & Bertrand, M. Changes in soil carbon mineralization related to earthworm activity depend on the time since inoculation and their density in soil. Sci. Rep. 12, 13616 (2022).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Angst, G. et al. Earthworms as catalysts in the formation and stabilization of soil microbial necromass. Glob. Change Biol. 28, 4775–4782 (2022).

    Article 

    Google Scholar
     

  • Joly, F.-X. et al. Detritivore conversion of litter into faeces accelerates organic matter turnover. Commun. Biol. 3, 660 (2020).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Tao, F. et al. Microbial carbon use efficiency promotes global soil carbon storage. Nature 618, 981–985 (2023).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Buchkowski, R. W. & Lindo, Z. Stoichiometric and structural uncertainty in soil food web models. Funct. Ecol. 35, 288–300 (2021).

    Article 
    CAS 

    Google Scholar
     

  • Potapov, A. M. et al. Feeding habits and multifunctional classification of soil-associated consumers from protists to vertebrates. Biol. Rev. Camb. Philos. Soc. 97, 1057–1117 (2022).

    Article 
    PubMed 

    Google Scholar
     

  • Ashton‐Butt, A. et al. Replanting of first‐cycle oil palm results in a second wave of biodiversity loss. Ecol. Evol. 9, 6433–6443 (2019).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Tao, H.-H. et al. Application of oil palm empty fruit bunch effects on soil biota and functions: a case study in Sumatra, Indonesia. Agric. Ecosyst. Environ. 256, 105–113 (2018).

    Article 

    Google Scholar
     

  • Darras, K. F. A. et al. Reducing fertilizer and avoiding herbicides in oil palm plantations—ecological and economic valuations. Front. For. Glob. Change 2, 65 (2019).

  • Teuscher, M. et al. Experimental biodiversity enrichment in oil-palm-dominated landscapes in Indonesia. Front. Plant Sci. 7, 1538 (2016).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Ashraf, M. et al. Alley-cropping system can boost arthropod biodiversity and ecosystem functions in oil palm plantations. Agric. Ecosyst. Environ. 260, 19–26 (2018).

    Article 

    Google Scholar
     

  • Margono, B. A., Potapov, P. V., Turubanova, S., Stolle, F. & Hansen, M. C. Primary forest cover loss in Indonesia over 2000–2012. Nat. Clim. Change 4, 730–735 (2014).

    Article 

    Google Scholar
     

  • Allen, K., Corre, M. D., Kurniawan, S., Utami, S. R. & Veldkamp, E. Spatial variability surpasses land-use change effects on soil biochemical properties of converted lowland landscapes in Sumatra, Indonesia. Geoderma 284, 42–50 (2016).

    Article 
    CAS 

    Google Scholar
     

  • Sohlström, E. H. et al. Applying generalized allometric regressions to predict live body mass of tropical and temperate arthropods. Ecol. Evol. 8, 12737–12749 (2018).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Darras, K. et al. BioSounds: an open-source, online platform for ecoacoustics. F1000 Res. 9, 1224 (2020).

  • Wilman, H. et al. EltonTraits 1.0: species-level foraging attributes of the world’s birds and mammals. Ecology 95, 2027–2027 (2014).

    Article 

    Google Scholar
     

  • Azhar, A. et al. Rainforest conversion to cash crops reduces abundance, biomass and species richness of parasitoid wasps in Sumatra, Indonesia. Agric. For. Entomol. 24, 506–515 (2022).

    Article 
    MathSciNet 

    Google Scholar
     

  • Nazarreta, R. et al. Rainforest conversion to smallholder plantations of rubber or oil palm leads to species loss and community shifts in canopy ants (Hymenoptera: Formicidae). Myrmecol. News 30, 175–186 (2020).

  • Kasmiatun, et al. Rainforest conversion to smallholder cash crops leads to varying declines of beetles (Coleoptera) on Sumatra. Biotropica 55, 119–131 (2023).

    Article 

    Google Scholar
     

  • Mawan, A. et al. Response of arboreal Collembola communities to the conversion of lowland rainforest into rubber and oil palm plantations. BMC Ecol. Evol. 22, 144 (2022).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Klarner, B. et al. Trophic niches, diversity and community composition of invertebrate top predators (Chilopoda) as affected by conversion of tropical lowland rainforest in Sumatra (Indonesia). PLoS ONE 12, e0180915 (2017).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Potapov, A. M., Scheu, S. & Tiunov, A. V. Trophic consistency of supraspecific taxa in below-ground invertebrate communities: comparison across lineages and taxonomic ranks. Funct. Ecol. 33, 1172–1183 (2019).

    Article 

    Google Scholar
     

  • Petersen, H. Estimation of dry weight, fresh weight and calorific content of various collembolan species. Pedobiologia 15, 222–243 (1975).

  • Mercer, R. D., Gabriel, A. G. A., Barendse, J., Marshall, D. J. & Chown, S. L. Invertebrate body sizes from Marion Island. Antarct. Sci. 13, 135–143 (2001).

    Article 

    Google Scholar
     

  • Hale, C. M., Reich, P. B. & Frelich, L. E. Allometric equations for estimation of ash-free dry mass from length measurements for selected European earthworm species (Lumbricidae) in the Western Great Lakes region. Am. Midl. Nat. 151, 179–185 (2004).

    Article 

    Google Scholar
     

  • Brose, U. et al. Foraging theory predicts predator–prey energy fluxes. J. Anim. Ecol. 77, 1072–1078 (2008).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Brose, U. et al. Predator traits determine food-web architecture across ecosystems. Nat. Ecol. Evol. 3, 919–927 (2019).

    Article 
    PubMed 

    Google Scholar
     

  • Gauzens, B. et al. fluxweb: an R package to easily estimate energy fluxes in food webs. Methods Ecol. Evol. 10, 270–279 (2019).

    Article 

    Google Scholar
     

  • Peschel, K., Norton, R., Scheu, S. & Maraun, M. Do oribatid mites live in enemy-free space? Evidence from feeding experiments with the predatory mite Pergamasus septentrionalis. Soil Biol. Biochem. 38, 2985–2989 (2006).

    Article 
    CAS 

    Google Scholar
     

  • Ehnes, R. B., Rall, B. C. & Brose, U. Phylogenetic grouping, curvature and metabolic scaling in terrestrial invertebrates. Ecol. Lett. 14, 993–1000 (2011).

    Article 
    PubMed 

    Google Scholar
     

  • Meijide, A. et al. Impact of forest conversion to oil palm and rubber plantations on microclimate and the role of the 2015 ENSO event. Agric. For. Meteorol. 252, 208–219 (2018).

    Article 

    Google Scholar
     

  • Jochum, M. et al. For flux’s sake: general considerations for energy-flux calculations in ecological communities. Ecol. Evol. 11, 12948–12969 (2021).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Bates, D., Mächler, M., Bolker, B. & Walker, S. Fitting linear mixed-effects models using lme4. J. Stat. Softw. 67, 1–48 (2015).

  • Fox, J. & Weisberg, S. An R Companion to Applied Regression (Sage, 2011).

  • Zuur, A. F., Ieno, E. N., Walker, N., Saveliev, A. A. & Smith, G. M. Mixed Effects Models and Extensions in Ecology with R (Springer Science & Business Media, 2009).

  • Pinheiro, J. & Bates, D. M. Mixed-Effects Models in S and S-PLUS (Springer, 2000).

  • Digel, C., Curtsdotter, A., Riede, J., Klarner, B. & Brose, U. Unravelling the complex structure of forest soil food webs: higher omnivory and more trophic levels. Oikos 123, 1157–1172 (2014).

    Article 

    Google Scholar
     

  • Wolkovich, E. M. Reticulated channels in soil food webs. Soil Biol. Biochem. 102, 18–21 (2016).

    Article 
    CAS 

    Google Scholar
     

[ad_2]

Source link

  • Online images amplify gender bias

    [ad_1]

    Here we outline the computational and experimental techniques we use to compare gender bias in online images and texts. We begin by describing the methods of data collection and analyses developed for the observational component of our study. Then we detail the study design deployed in our online search experiment. The preregistration for our online experiment is available at https://osf.io/3jhzx. Note that this study is a successful replication of a previous study with a nearly identical design, except the original study did not include a control condition nor several versions of the text condition; the preregistration of the previous study is available at https://osf.io/26kbr.

    Observational methods

    Data collection procedure for online images

    Our crowdsourcing methodology consisted of four steps (Extended Data Fig. 1). First, we gathered all social categories in WordNet, a canonical lexical database of English. WordNet contained 3,495 social categories, including occupations (such as ‘physicist’) and generic social roles (such as ‘colleague’). Second, we collected the images associated with each category from both Google and Wikipedia. Third, we used Python’s OpenCV—a popular open-source deep learning framework—to extract the faces from each image; this algorithm automatically isolates each face and extracts a square including the entire face and minimal surrounding context. Using OpenCV to extract faces helped us to ensure that each face in each image was separately classified in a standardized manner, and to avoid subjective biases in coders’ decisions for which face to focus on and categorize in each image. Fourth, we hired 6,392 human coders from MTurk to classify the gender of the faces. Following earlier work, each face was classified by three unique annotators16,17, so that the gender of each face (‘male’ or ‘female’) could be identified based on the majority (modal) gender classification across three coders (we also gave coders the option of labelling the gender of faces as ‘non-binary’, but this option was only chosen in 2% of cases, so we excluded these data from our main analyses and recollected all classifications until each face was associated with three unique coders using either the ‘male’ or the ‘female’ label). Although coders were asked to label the gender of the face presented, our measure is agnostic to which features the coders used to determine their gender classifications; they may have used facial features, as well as features relating to the aesthetics of expressed gender such as hair or accessories. Each search was implemented from a fresh Google account with no prior history. Searches were run in August 2020 by ten distinct data servers in New York City. This study was approved by the Institutional Review Board at the University of California, Berkeley, and all participants provided informed consent.

    To collect images from Google, we followed earlier work by retrieving the top 100 images that appeared when using each of the 3,495 categories to search for images using the public Google Images search engine16,17,18 (Google provides roughly 100 images for its initial search results). To collect images from Wikipedia, we identified the images associated with each social category in the 2021 Wikipedia-based Image Text Dataset (WIT)27. WIT maps all images across Wikipedia to textual descriptions on the basis of the title, content and metadata of the active Wikipedia articles in which they appear. WIT contained images associated with 1,523 social categories from WordNet across all English Wikipedia articles (see Supplementary Information section A.1.1 for details on our Wikipedia analysis). The coders identified 18% of images as not containing a human face; these were removed from our analyses. We also asked all annotators to complete an attention check, which involved choosing the correct answer to the common-sense question “What is the opposite of the word ‘down’?” from the following options: ‘Fish’, ‘Up’, ‘Monk’ and ‘Apple’. We removed the data from all annotators who failed an attention check (15%), and we continued collecting classifications until each image was associated with the judgements of three unique coders, all of whom passed the attention check.

    Collecting human judgements of social categories

    We hired a separate sample of 2,500 human coders from MTurk to complete a survey study in which they were presented with social categories (five categories per task) and asked to evaluate each category by means of the following question (each category was assessed by 20 unique human coders): “Which gender do you most expect to belong to this category?” This was answered as a scalar with a slider ranging from −1 (females) to 1 (males). All MTurkers were prescreened such that only US-based MTurkers who were fluent in English were invited to participate in this task.

    Demographics of human coders

    The human coders were all adults based in the USA who were fluent in English. Supplementary Table 1 indicates that our main results are robust to controlling for the demographic composition of our human coders. Among our coders, 44.2% identified as female, 50.6% as male and 3.2% as non-binary; the remainder preferred not to disclose. In terms of age, 42.6% identified as being 18–24 years, 22.9% as 25–34, 32.5% as 35–54, 1.6% as 55–74 and less than 1% as more than 75. In terms of race, 46.8% identified as Caucasian, 11.6% as African American, 17% as Asian, 9% as Hispanic and 10.3% as Native American; the remainder identified as either mixed race or preferred not to disclose. In terms of political ideology, 37.2% identified as conservative, 33.8% as liberal, 20.3% as independent and 3.9% as other; the remainder preferred not to disclose. In terms of annual income, 14.3% reported making less than US$10,000, 33.4% reported US$10,000–50,000, 22.7% reported US$50,000–75,000, 14.9% reported US$75,000–100,000, 10.5% reported US$100,000–150,000, 2.8% reported US$150,000–250,000 and less than 1% reported more than US$250,000; the remainder preferred not to disclose. In terms of the highest level of education acquired by each annotator, 2.7% selected ‘Below High School’, 17.5% selected ‘High School’, 29.2% selected ‘Technical/Community College’, 34.5% selected ‘Undergraduate degree’, 14.8% selected ‘Master’s degree’ and less than 1% selected ‘Doctorate degree’; the remainder preferred not to disclose.

    Constructing a gender dimension in word embedding space

    Our method for measuring gender associations in text relies on the fact that word embedding models use the frequency of co-occurrence among words in text (for example, whether they occur in the same sentence) to position words in an n-dimensional space, such that words that co-occur together more frequently are represented as closer together in this n-dimensional space. The ‘embedding’ for a given word refers to the specific position of this word in the n-dimensional space constructed by the model. The cosine distance between word embeddings in this vector space provides a robust measure of semantic similarity that is widely used to unpack the cultural meanings associated with categories13,22,31. To construct a gender dimension in word embedding space, we adopt the methodology recently developed by Kozlowski et al.22. In their paper, Kozlowski et al.22 construct a gender dimension in embedding space along which different categories can be positioned (for example, their analysis focuses on types of sport). They start by identifying two clustered regions in word embedding space corresponding to traditional representations of females and males, respectively. Specifically, the female cluster consists of the words ‘woman’, ‘her’, ‘she’, ‘female’ and ‘girl’, and the male cluster consists of the words ‘man’, ‘his’, ‘he’, ‘male’ and ‘boy’. Then, for each of the 3,495 social categories in WordNet, we calculated the average cosine distance between this category and both the female and the male clusters. Each category, therefore, was associated with two numbers: its cosine distance with the female cluster (averaged across its cosine distance with each term in the female cluster), and its cosine distance with the male cluster (averaged across its cosine distance with each term in the male cluster). Taking the difference between a category’s cosine distance with the female and male clusters allowed each category to be positioned along a −1 (female) to 1 (male) scale in embedding space. The category ‘aunt’, for instance, falls close to −1 along this scale, whereas the category ‘uncle’ falls close to 1 along this scale. Of the categories in WordNet, 2,986 of them were associated with embeddings in the 300-dimensional word2vec model of Google News, and could therefore be positioned along this scale. All of our results are robust to using different terms to construct the poles of this gender dimension (Supplementary Fig. 18). However, our main analyses use the same gender clusters as ref. 22.

    To compute distances between the vectors of social categories represented by bigrams (such as ‘professional dancer’), we used the Phrases class in the Gensim Python package, which provided a prebuilt function for identifying and calculating distances for bigram embeddings. This method works by identifying an n-dimensional vector of middle positions between the vectors corresponding separately to each word in the bigram (for example, ‘professional’ and ‘dancer’). This technique then treats this middle vector as the singular vector corresponding to the bigram ‘professional dancer’ and is thereby used to calculate distances from other category vectors. This same method was applied to the construction of embeddings for all bigram categories in all models.

    To maximize the similarity between our text-based and image-based measures of gender association, we adopted the following three techniques. First, we normalized our textual measure of gender associations using minimum–maximum normalization, which ensured that a compatible range of values was covered by both our text-based and image-based measures of gender association. This is helpful because the distribution of gender associations for the image-based measure stretched to both ends of the −1 to 1 continuum as a result of certain categories being associated with 100% female faces or 100% male faces. By contrast, although the textual measure described above contains a −1 (female) to 1 (male) scale, the most female category in our WordNet sample has a gender association of −0.42 (‘chairwoman’), and the most male category has a gender association of 0.33 (‘guy’). Normalization ensures that the distribution of gender associations in the image- and text-based measures both equally cover the −1 to 1 continuum, so that paired comparisons between these scales (matched at the category level) can directly examine the relative ranking of a category’s gender association in each measure. Minimum–maximum normalization is given by the following equation:

    $$\widetilde{{x}_{i}}=\frac{\left({x}_{i}-{x}_{\min }\right)}{\left({x}_{\max }-{x}_{\min }\right)}$$

    (1)

    where xi represents the gender association of category xi ([−1,1]), xmin represents the category with the lowest gender score, xmax represents the category with the highest gender score, and \(\widetilde{{x}_{i}}\) represents the normalized gender association of category xi. To preserve the −1 to 1 scale in applying minimum–maximum normalization, we applied this procedure separately for male-skewed categories (that is, all categories with a gender association above 0), such that xmin represents the least male of the male categories and xmax represents the most male of the male categories. We applied this same procedure to the female-skewed categories, except that, because the female scale is −1 to 0, xmin represents the most female of the female categories and xmax represents the least female. For this reason, after the 0–1 female scale was constructed, we multiplied the female scores by −1 so that −1 represented the most female of the female categories and 0 represented the least. We then appended the female-normalized (−1 to 0) and male-normalized (0 to 1) scales. Both the male and female scales before normalization contained categories with values within four decimal points of zero (|x| < 0.0001), such that this normalization technique had no effect of arbitrarily pushing certain categories towards 0. Instead, the above technique has the advantage of stretching out the text-based measure of gender association to ensure that a substantial fraction of categories reach all the way to the −1 female region and all the way to the 1 male region of the continuum, similar to the distribution of values for the image-based measure.

    Experimental methods

    Participant pool

    For this experiment, a nationally representative sample of participants (n = 600) was recruited from the popular crowdsourcing platform Prolific, which provides a vetted panel of high-quality human participants for online research. No statistical methods were used to determine this sample size. A total of 575 participants completed the task, exhibiting an attrition rate of 4.2%. We only examine data from participants who completed the experiment. Our main results report the outcomes associated with the Image, Text and Control conditions (n = 423); in the Supplementary Information, we report the results of an extra version of the Text condition involving the generic Google search bar (n = 150; Supplementary Fig. 26). We only examine data from participants who completed the task. To recruit a nationally representative sample, we used Prolific’s prescreening functionality designed to provide a nationally representative sample of the USA along the dimensions of sex, age and ethnicity. Participants were invited to partake in the study only if they were based in the USA, fluent English speakers and aged more than 18 years. A total of 50.8% of participants were female (no participants identified as non-binary). All participants provided informed consent before participating. This experiment was run on 5 March 2022.

    Participant experience

    Extended Data Fig. 2 presents a schematic of the full experimental design. This experiment was approved by the Institutional Review Board at the University of California, Berkeley. In this experiment, participants were randomized to one of four conditions: (1) the Image condition (in which they used the Google Image search engine to retrieve images of occupations), (2) the Google News Text condition (in which they used the Google News search engine, that is, news.google.com, to retrieve textual descriptions of occupations), (3) the Google Neutral Text condition (in which they used the generic Google search engine, that is, google.com, to retrieve textual descriptions of occupations) and (4) the Control condition (in which they were asked at random to use either Google Images or the neutral (standard) Google search engine to retrieve descriptions of random, non-gendered categories, such as ‘apple’). Note that, in the main text, we report the experimental results comparing the Image, Control and Google News Text conditions; we present the results concerning the Google Neutral Text condition as a robustness test in the Supplementary Information (Supplementary Fig. 26).

    After uploading a description for a given occupation, participants used a −1 (female) to 1 (male) scale to indicate which gender they most associate with this occupation. In this way, the scale participants used to indicate their gender associations was identical to the scale we used to measure gender associations in our observational analyses of online images and text. In the control condition, participants were asked to indicate which gender they associate with a given randomly selected occupation after uploading a description for an unrelated category. Participants in all conditions completed this sequence for 22 unique occupations (randomly sampled from a broader set of 54 occupations). These occupations were selected to include occupations from science, technology, engineering and mathematics, and the liberal arts. Each occupation that was used as a stimulus could also be associated with our observational data concerning the gender associations measured in images from Google Images and the texts of Google News. Here is the full preregistered list of occupations used as stimuli: immunologist, mathematician, harpist, painter, piano player, aeronautical engineer, applied scientist, geneticist, astrophysicist, professional dancer, fashion model, graphic designer, hygienist, educator, intelligence analyst, logician, intelligence agent, financial analyst, chief executive officer, clarinetist, chiropractor, computer expert, intellectual, climatologist, systems analyst, programmer, poet, astronaut, professor, automotive engineer, cardiologist, neurobiologist, English professor, number theorist, marine engineer, bookkeeper, dietician, model, trained nurse, cosmetic surgeon, fashion designer, nurse practitioner, art teacher, singer, interior decorator, media consultant, art student, dressmaker, English teacher, literary agent, social worker, screen actor, editor-in-chief, schoolteacher. The set of occupations that participants evaluated was identical across conditions.

    Once each participant completed this task for 22 occupations, they were then asked to complete an IAT designed to measure the implicit bias towards associating men with science and women with liberal arts33,34,35,38. The IAT was identical across conditions (‘Measuring implicit bias using the IAT’). In total, the experiment took participants approximately 35 minutes to complete. Participants were compensated at the rate of US $15 per hour for their participation.

    Measuring implicit bias using the IAT

    The IAT in our experiment was designed using the iatgen tool33 (https://iatgen.wordpress.com/). The IAT is a psychological research tool for measuring mental associations between target pairs (for example, different races or genders) and a category dimension (for example, positive–negative, science–liberal arts). Rather than measuring what people explicitly believe through self-report, the IAT measures what people mentally associate and how quickly they make these associations. The IAT has the following design (description borrowed from iatgen)33: “The IAT consists of seven ‘blocks’ (sets of trials). In each trial, participants see a stimulus word on the screen. Stimuli represent ‘targets’ (for example, insects and flowers) or the category (for example, pleasant–unpleasant). When stimuli appear, the participant ‘sorts’ the stimulus as rapidly as possible by pressing with either their left or right hand on the keyboard (in iatgen, the ‘E’ and ‘I’ keys). The sides with which one should press are indicated in the upper left and right corners of the screen. The response speed is measured in milliseconds.” For example, in some sections of our study, a participant might press with the left hand for all male + science stimuli and with their right hand for all female + liberal arts stimuli.

    The theory behind the IAT is that the participant will be fast at sorting in a manner that is consistent with one’s latent associations, which is expected to lead to greater cognitive fluency in one’s intuitive reactions. For example, the expectation is that someone will be faster when sorting flowers + pleasant stimuli with one hand and insects + unpleasant with the other, as this is (most likely) consistent with people’s implicit mental associations (example borrowed from iatgen). Yet, when the category pairings are flipped, people should have to engage in cognitive work to override their mental associations, and the task should be slower. The degree to which one is faster in one section or the other is a measure of one’s implicit bias.

    In our study, the target pairs we used were ‘male’ and ‘female’ (corresponding to gender), and the category dimension referred to science–liberal arts. To construct the IAT, we followed the design used by Rezaei38. For the male words in the pairs, we used the following terms: man, boy, father, male, grandpa, husband, son, uncle. For the female words in the pairs, we used the following terms: woman, girl, mother, female, grandma, wife, daughter, aunt. For the science category, we used the following words: biology, physics, chemistry, math, geology, astronomy, engineering, medicine, computing, artificial intelligence, statistics. For the liberal arts category, we used the following words: philosophy, humanities, arts, literature, English, music, history, poetry, fashion, film. Extended Data Figs. 3–6 illustrate the four main IAT blocks that participants completed (as per standard IAT design, participants were also shown blocks 2, 3 and 4, with the left–right arrangement of targets reversed). Participants completed seven blocks in total, sequentially. The IAT instructions for Extended Data Fig. 3 state, “Place your left and right index fingers on the E and I keys. At the top of the screen are 2 categories. In the task, words and/or images appear in the middle of the screen. When the word/image belongs to the category on the left, press the E key as fast as you can. When it belongs to the category on the right, press the I key as fast as you can. If you make an error, a red X will appear. Correct errors by hitting the other key. Please try to go as fast as you can while making as few errors as possible. When you are ready, please press the [Space] bar to begin.” These instructions are repeated throughout all blocks in the task.

    To measure implicit bias based on participants’ reaction times during the IAT, we adopted the following standard approach (used by iatgen). We combined the scores across all four blocks (blocks 3, 4, 6 and 7 in iatgen). Some participants are also faster than others, adding statistical ‘noise’ as a result of variance in overall reaction times. Thus, instead of comparing within-person differences in raw latencies, this difference is standardized at the participant level, dividing the within-person difference by a ‘pooled’ standard deviation. This pooled standard deviation uses the standard deviation of what are called the practice and critical blocks combined. This yields a D score. In iatgen, a positive D value indicates association in the form of target A + positive, target B + negative, which in our case is male + science, female + liberal arts), whereas a negative D value indicates the opposite bias (target A + negative, target B + positive, which in our case is male + liberal arts, female + science), and a zero score indicates no bias.

    Our main experimental results evaluate the relationship between the participants’ explicit and implicit gender associations and the strength of gender associations in the Google images and textual descriptions they encountered during the search task. The strength of participants’ explicit gender associations is calculated as the absolute value of the number they input using the −1 (female) to 1 (male) scale after each occupation they classified (Extended Data Fig. 2). Participants’ implicit bias is measured by the D score of their results on the IAT designed to detect associations between men and science and women and liberal arts. To measure the strength of gender associations in the Google images that participants encountered, we calculated the gender parity of the faces uploaded across all participants who classified a given occupation. For example, we identified the responses of all participants who provided image search results for the occupation ‘geneticist’, and we constructed the same gender dimensions as described in the main text, such that −1 represents 100% female faces, 0 represents 50% female (male) faces and 1 represents 100% male faces. To identify the gender of the faces of the images that participants uploaded, we recruited a separate panel of MTurk workers (n = 500) who classified each face (there were 3,300 images in total). Each face was classified by two unique MTurkers; if they disagreed in their gender assignment, a third MTurk worker was hired to provide a response, and the gender identified by the majority was selected. We adopted an analogous approach to annotating the gender of the textual descriptions that participants uploaded in the text condition. These annotators identified whether each textual or visual description uploaded by participants was female (1), neutral (0) or male (1). Each textual description was coded as male, female or neutral on the basis of whether it used male or female pronouns or names to describe the occupation (for example, referred to a ‘doctor’ as ‘he’); textual descriptions were identified as neutral if they did not ascribe a particular gender to the occupation described. We were then able to calculate the same measure of gender balance in the textual descriptions uploaded for each occupation as we applied in our image analysis.

    Reporting summary

    Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

    [ad_2]

    Source link

  • Rapid spin changes around a magnetar fast radio burst

    [ad_1]

  • Kouveliotou, C. et al. An X-ray pulsar with a superstrong magnetic field in the soft γ-ray repeater SGR1806−20. Nature 393, 235–237 (1998).

    Article 
    CAS 

    Google Scholar
     

  • Kaspi, V. M. & Beloborodov, A. M. Magnetars. Annu. Rev. Astron. Astrophys. 55, 261–301 (2017).

    Article 
    CAS 

    Google Scholar
     

  • CHIME/FRB Collaboration A bright millisecond-duration radio burst from a Galactic magnetar. Nature 587, 54–58 (2020).

    Article 

    Google Scholar
     

  • Mereghetti, S. et al. INTEGRAL discovery of a burst with associated radio emission from the magnetar SGR 1935+2154. Astrophys. J. Lett. 898, L29 (2020).

    Article 
    CAS 

    Google Scholar
     

  • Bochenek, C. D. et al. A fast radio burst associated with a Galactic magnetar. Nature 587, 59–62 (2020).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Giri, U. et al. Comprehensive Bayesian analysis of FRB-like bursts from SGR 1935+2154 observed by CHIME/FRB. Preprint at https://arxiv.org/abs/2310.16932 (2023).

  • Maan, Y., Leeuwen, J. V., Straal, S. & Pastor-Marazuela, I. GBT detection of bright 5 GHz radio bursts from SGR 1935+2154, coincident with X-ray and 600 MHz bursts. The Astronomer’s Telegram 15697 (2022).

  • Espinoza, C. M., Lyne, A. G., Stappers, B. W. & Kramer, M. A study of 315 glitches in the rotation of 102 pulsars. Mon. Not. R. Astron. Soc. 414, 1679–1704 (2011).

    Article 

    Google Scholar
     

  • Yu, M. et al. Detection of 107 glitches in 36 southern pulsars. Mon. Not. R. Astron. Soc. 429, 688–724 (2013).

    Article 

    Google Scholar
     

  • Basu, A. et al. The Jodrell Bank glitch catalogue: 106 new rotational glitches in 70 pulsars. Mon. Not. R. Astron. Soc. 510, 4049–4062 (2022).

    Article 
    CAS 

    Google Scholar
     

  • Younes, G. et al. Magnetar spin-down glitch clearing the way for FRB-like bursts and a pulsed radio episode. Nat. Astron. 7, 339–350 (2023).

    Article 

    Google Scholar
     

  • Israel, G. L. et al. The discovery, monitoring and environment of SGR J1935+2154. Mon. Not. R. Astron. Soc. 457, 3448–3456 (2016).

    Article 
    CAS 

    Google Scholar
     

  • Younes, G. et al. X-ray and radio observations of the magnetar SGR J1935+2154 during its 2014, 2015, and 2016 outbursts. Astrophys. J. 847, 85 (2017).

    Article 

    Google Scholar
     

  • Younes, G. et al. NICER view of the 2020 burst storm and persistent emission of SGR 1935+2154. Astrophys. J. Lett. 904, L21 (2020).

    Article 
    CAS 

    Google Scholar
     

  • Mereghetti, S. et al. INTEGRAL detection of a burst from SGR J1935+2154. GRB Coord. Netw. Circ. No. 32675 (2022).

  • Palm, D. M. Multiple bursts from SGR J1935+2154. The Astronomer’s Telegram 15667 (2022).

  • Younes, G. et al. NICER detection of over 100 bursts and enhanced persistent emission from SGR 1935+2154. The Astronomer’s Telegram 15674 (2022).

  • Livingstone, M. A. et al. X-ray and radio timing of the pulsar in 3C 58. Astrophys. J. 706, 1163–1173 (2009).

    Article 

    Google Scholar
     

  • Dib, R. & Kaspi, V. M. 16 yr of RXTE monitoring of five anomalous X-ray pulsars. Astrophys. J. 784, 37 (2014).

    Article 

    Google Scholar
     

  • Hu, C. P. & Ng, C. Y. On the connection between radiative outbursts and timing irregularities in magnetars. Astron. Nachr. 340, 340–345 (2019).

    Article 

    Google Scholar
     

  • Ge, M.-Y. et al. Spin evolution of the magnetar SGR J1935+2154. Res. Astron. Astrophys. 24, 015016 (2024).

  • Younes, G. et al. Broadband X-ray burst spectroscopy of the fast-radio-burst-emitting Galactic magnetar. Nat. Astron. 5, 408–413 (2021).

    Article 

    Google Scholar
     

  • Enoto, T. et al. Magnetar broadband X-ray spectra correlated with magnetic fields: Suzaku archive of SGRs and AXPs combined with NuSTAR, Swift, and RXTE. Astrophys. J. Suppl. Ser. 231, 8 (2017).

    Article 

    Google Scholar
     

  • Zhou, P. et al. Revisiting the distance, environment and supernova properties of SNR G57.2+0.8 that hosts SGR 1935+2154. Astrophys. J. 905, 99 (2020).

    Article 
    CAS 

    Google Scholar
     

  • Anderson, P. W. & Itoh, N. Pulsar glitches and restlessness as a hard superfluidity phenomenon. Nature 256, 25–27 (1975).

    Article 

    Google Scholar
     

  • Link, B. & Epstein, R. I. Thermally driven neutron star glitches. Astrophys. J. 457, 844 (1996).

    Article 
    CAS 

    Google Scholar
     

  • Eichler, D. & Shaisultanov, R. Dynamical oscillations and glitches in anomalous X-ray pulsars. Astrophys. J. Lett. 715, L142–L145 (2010).

    Article 
    CAS 

    Google Scholar
     

  • Thompson, C., Lyutikov, M. & Kulkarni, S. R. Electrodynamics of magnetars: implications for the persistent X-ray emission and spin-down of the soft gamma repeaters and anomalous X-ray pulsars. Astrophys. J. 574, 332–355 (2002).

    Article 

    Google Scholar
     

  • Hu, K., Baring, M. G., Harding, A. K. & Wadiasingh, Z. High-energy photon opacity in the twisted magnetospheres of magnetars. Astrophys. J. 940, 91 (2022).

    Article 

    Google Scholar
     

  • Wadiasingh, Z. & Timokhin, A. Repeating fast radio bursts from magnetars with low magnetospheric twist. Astrophys. J. 879, 4 (2019).

    Article 
    CAS 

    Google Scholar
     

  • Gendreau, K. C. et al. The Neutron star Interior Composition Explorer (NICER): design and development. Proc. SPIE 9905, 99051H (2016).

  • Bachetti, M. et al. Timing calibration of the NuSTAR X-ray telescope. Astrophys. J. 908, 184 (2021).

    Article 
    CAS 

    Google Scholar
     

  • Scargle, J. D., Norris, J. P., Jackson, B. & Chiang, J. Studies in astronomical time series analysis. VI. Bayesian block representations. Astrophys. J. 764, 167 (2013).

    Article 

    Google Scholar
     

  • Buccheri, R. et al. Search for pulsed gamma-ray emission from radio pulsars in the COS-B data. Astron. Astrophys. 128, 245–251 (1983).

    CAS 

    Google Scholar
     

  • Olausen, S. A. & Kaspi, V. M. The McGill Magnetar Catalog. Astrophys. J. Suppl. Ser. 212, 6 (2014).

    Article 

    Google Scholar
     

  • Ray, P. S. et al. Precise γ-ray timing and radio observations of 17 Fermi γ-ray pulsars. Astrophys. J. Suppl. Ser. 194, 17 (2011).

    Article 

    Google Scholar
     

  • Foreman-Mackey, D., Hogg, D. W., Lang, D. & Goodman, J. emcee: the MCMC hammer. Publ. Astron. Soc. Pac. 125, 306 (2013).

    Article 

    Google Scholar
     

  • Luo, J. et al. PINT: a modern software package for pulsar timing. Astrophys. J. 911, 45 (2021).

    Article 

    Google Scholar
     

  • Remillard, R. A. et al. An empirical background model for the NICER X-ray timing instrument. Astron. J. 163, 130 (2022).

    Article 
    CAS 

    Google Scholar
     

  • Wilms, J., Allen, A. & McCray, R. On the absorption of X-rays in the interstellar medium. Astrophys. J. 542, 914–924 (2000).

    Article 
    CAS 

    Google Scholar
     

  • Haskell, B. & Melatos, A. Models of pulsar glitches. J. Mod. Phys. D 24, 1530008 (2015).

    Article 
    MathSciNet 
    CAS 

    Google Scholar
     

  • Link, B., Epstein, R. I. & Lattimer, J. M. Pulsar constraints on neutron star structure and equation of state. Phys. Rev. Lett. 83, 3362–3365 (1999).

    Article 
    CAS 

    Google Scholar
     

  • Andersson, N., Glampedakis, K., Ho, W. C. G. & Espinoza, C. M. Pulsar glitches: the crust is not enough. Phys. Rev. Lett. 109, 241103 (2012).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Chamel, N. Crustal entrainment and pulsar glitches. Phys. Rev. Lett. 110, 011101 (2013).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Ho, W. C. G., Espinoza, C. M., Antonopoulou, D. & Andersson, N. Pinning down the superfluid and measuring masses using pulsar glitches. Sci. Adv. 1, e1500578 (2015).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Alpar, M. A., Anderson, P. W., Pines, D. & Shaham, J. Giant glitches and pinned vorticity in the VELA and other pulsars. Astrophys. J. Lett. 249, L29–L33 (1981).

    Article 

    Google Scholar
     

  • Mahlmann, J. F. et al. Electromagnetic fireworks: fast radio bursts from rapid reconnection in the compressed magnetar wind. Astrophys. J. Lett. 932, L20 (2022).

    Article 

    Google Scholar
     

  • Wolfson, R. Shear-induced opening of the coronal magnetic field. Astrophys. J. 443, 810 (1995).

    Article 

    Google Scholar
     

  • Potekhin, A. Y. Electron conduction in magnetized neutron star envelopes. Astron. Astrophys. 351, 787–797 (1999).


    Google Scholar
     

  • Baring, M. G. & Harding, A. K. Resonant Compton upscattering in anomalous X-ray pulsars. Astrophys. Space Sci. 308, 109–118 (2007).

    Article 

    Google Scholar
     

  • Fernández, R. & Thompson, C. Resonant cyclotron scattering in three dimensions and the quiescent nonthermal X-ray emission of magnetars. Astrophys. J. 660, 615–640 (2007).

    Article 

    Google Scholar
     

  • Wadiasingh, Z., Baring, M. G., Gonthier, P. L. & Harding, A. K. Resonant inverse Compton scattering spectra from highly magnetized neutron stars. Astrophys. J. 854, 98 (2018).

    Article 

    Google Scholar
     

  • Baring, M. G., Wadiasingh, Z. & Gonthier, P. L. Cooling rates for relativistic electrons undergoing Compton scattering in strong magnetic fields. Astrophys. J. 733, 61 (2011).

    Article 

    Google Scholar
     

  • Wadiasingh, Z. et al. The fast radio burst luminosity function and death line in the low-twist magnetar model. Astrophys. J. 891, 82 (2020).

    Article 
    CAS 

    Google Scholar
     

  • [ad_2]

    Source link

  • Critical transitions in the Amazon forest system

    [ad_1]

  • Science Panel for the Amazon. Amazon Assessment Report 2021 (2021); www.theamazonwewant.org/amazon-assessment-report-2021/.

  • IPCC. Climate Change 2021: The Physical Science Basis (eds Masson-Delmotte, V. et al.) https://www.ipcc.ch/report/ar6/wg1/#FullReport (Cambridge Univ. Press, 2021).

  • Armstrong McKay, D. et al. Exceeding 1.5 °C global warming could trigger multiple climate tipping points. Science 377, abn7950 (2022).

    Article 

    Google Scholar
     

  • Staal, A. et al. Forest-rainfall cascades buffer against drought across the Amazon. Nat. Clim. Change 8, 539–543 (2018).

    Article 
    ADS 

    Google Scholar
     

  • Cano, I. M. et al. Abrupt loss and uncertain recovery from fires of Amazon forests under low climate mitigation scenarios. Proc. Natl Acad. Sci. USA 119, e2203200119 (2022).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Parry, I. M., Ritchie, P. D. L. & Cox, P. M. Evidence of localised Amazon rainforest dieback in CMIP6 models. Earth Syst. Dynam. 13, 1667–1675 (2022).

    Article 
    ADS 

    Google Scholar
     

  • Bromham, L. et al. Global predictors of language endangerment and the future of linguistic diversity. Nat. Ecol. Evol. 6, 163–173 (2022).

    Article 
    PubMed 

    Google Scholar
     

  • Gomes, V. H. F., Vieira, I. C. G., Salomão, R. P. & ter Steege, H. Amazonian tree species threatened by deforestation and climate change. Nat. Clim. Change 9, 547–553 (2019).

    Article 
    ADS 

    Google Scholar
     

  • Cámara-Leret, R., Fortuna, M. A. & Bascompte, J. Indigenous knowledge networks in the face of global change. Proc. Natl Acad. Sci. USA 116, 9913–9918 (2019).

    Article 
    ADS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Scheffer, M., Carpenter, S., Foley, J. A., Folke, C. & Walker, B. Catastrophic shifts in ecosystems. Nature 413, 591–596 (2001).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Rockstrom, J. et al. A safe operating space for humanity. Nature 461, 472–475 (2009).

    Article 
    ADS 
    PubMed 

    Google Scholar
     

  • Scheffer, M. et al. Creating a safe operating space for iconic ecosystems. Science 347, 1317–1319 (2015).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • van Nes, E. H. et al. What do you mean, ‘tipping point’? Trends Ecol. Evol. 31, 902–904 (2016).

    Article 
    PubMed 

    Google Scholar
     

  • Lenton, T. M. et al. Tipping elements in the Earth’s climate system. Proc. Natl Acad. Sci. USA 105, 1786–1793 (2008).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Flores, B. M. & Staal, A. Feedback in tropical forests of the Anthropocene. Global Change Biol. 28, 5041–5061 (2022).

    Article 
    CAS 

    Google Scholar
     

  • Scheffer, M. Critical Transitions in Nature and Society (Princeton Univ. Press, 2009).

  • Scheffer, M. et al. Anticipating critical transitions. Science 338, 344–348 (2012).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Holling, C. S. Engineering Resilience versus Ecological Resilience (National Academy Press, 1996).

  • Hoorn, C. et al. Amazonia through time: Andean uplift, climate change, landscape evolution, and biodiversity. Science 330, 927–931 (2010).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Wang, X. et al. Hydroclimate changes across the Amazon lowlands over the past 45,000 years. Nature 541, 204–207 (2017).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Kukla, T. et al. The resilience of Amazon tree cover to past and present drying. Global Planet. Change 202, 103520 (2021).

    Article 

    Google Scholar
     

  • Clement, C. R. et al. Disentangling domestication from food production systems in the neotropics. Quaternary 4, 4 (2021).

    Article 

    Google Scholar
     

  • Mayle, F. E. & Power, M. J. Impact of a drier Early–Mid-Holocene climate upon Amazonian forests. Phil. Trans. R. Soc. B 363, 1829–1838 (2008).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Montoya, E. & Rull, V. Gran Sabana fires (SE Venezuela): a paleoecological perspective. Quat. Sci. Rev. 30, 3430–3444 (2011).

    Article 
    ADS 

    Google Scholar
     

  • Rull, V., Montoya, E., Vegas-Vilarrúbia, T. & Ballesteros, T. New insights on palaeofires and savannisation in northern South America. Quat. Sci. Rev. 122, 158–165 (2015).

    Article 
    ADS 

    Google Scholar
     

  • Rossetti, D. F. et al. Unfolding long-term Late Pleistocene-Holocene disturbances of forest communities in the southwestern Amazonian lowlands. Ecosphere 9, e02457 (2018).

    Article 

    Google Scholar
     

  • Prance, G. T. & Schubart, H. O. R. Notes on the vegetation of Amazonia I. A preliminary note on the origin of the open white sand campinas of the lower Rio Negro. Brittonia 30, 60 (1978).

    Article 

    Google Scholar
     

  • Wright, J. L. et al. Sixteen hundred years of increasing tree cover prior to modern deforestation in Southern Amazon and central Brazilian savannas. Glob. Change Biol. 27, 136–150 (2021).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • van der Sleen, P. et al. No growth stimulation of tropical trees by 150 years of CO2 fertilization but water-use efficiency increased. Nat. Geosci. 8, 24–28 (2015).

    Article 
    ADS 

    Google Scholar
     

  • Smith, M. N. et al. Empirical evidence for resilience of tropical forest photosynthesis in a warmer world. Nat. Plants 6, 1225–1230 (2020).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Marengo, J. A., Jimenez, J. C., Espinoza, J.-C., Cunha, A. P. & Aragão, L. E. O. Increased climate pressure on the agricultural frontier in the Eastern Amazonia–Cerrado transition zone. Sci. Rep. 12, 457 (2022).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Tavares, J. V. et al. Basin-wide variation in tree hydraulic safety margins predicts the carbon balance of Amazon forests. Nature 617, 111–117 (2023).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Boulton, C. A., Lenton, T. M. & Boers, N. Pronounced loss of Amazon rainforest resilience since the early 2000s. Nat. Clim. Change 12, 271–278 (2022).

    Article 
    ADS 

    Google Scholar
     

  • Doughty, C. E. et al. Tropical forests are approaching critical temperature thresholds. Nature 621, 105–111 (2023).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Xu, C., Kohler, T. A., Lenton, T. M., Svenning, J.-C. & Scheffer, M. Future of the human climate niche. Proc. Natl Acad. Sci. USA 117, 11350–11355 (2020).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Sullivan, M. J. P. et al. Long-term thermal sensitivity of Earth’s tropical forests. Science 368, 869–874 (2020).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Zemp, D. C. et al. Self-amplified Amazon forest loss due to vegetation-atmosphere feedbacks. Nat. Commun. 8, 14681 (2017).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Bullock, E. L., Woodcock, C. E., Souza, C. Jr & Olofsson, P. Satellite-based estimates reveal widespread forest degradation in the Amazon. Global Change Biol. 26, 2956–2969 (2020).

    Article 
    ADS 

    Google Scholar
     

  • Lapola, D. M. et al. The drivers and impacts of Amazon forest degradation. Science 379, eabp8622 (2023).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Feng, Y., Negrón-Juárez, R. I., Romps, D. M. & Chambers, J. Q. Amazon windthrow disturbances are likely to increase with storm frequency under global warming. Nat. Commun. 14, 101 (2023).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Anderson, L. O. et al. Vulnerability of Amazonian forests to repeated droughts. Phil. Trans. R. Soc. B 373, 20170411 (2018).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Staal, A. et al. Feedback between drought and deforestation in the Amazon. Environ. Res. Lett. 15, 044024 (2020).

    Article 
    ADS 

    Google Scholar
     

  • Alencar, A. A., Brando, P. M., Asner, G. P. & Putz, F. E. Landscape fragmentation, severe drought, and the new Amazon forest fire regime. Ecol. Appl. 25, 1493–1505 (2015).

    Article 
    PubMed 

    Google Scholar
     

  • Aragão, L. E. O. C. et al. 21st century drought-related fires counteract the decline of Amazon deforestation carbon emissions. Nat. Commun. 9, 536 (2018).

    Article 
    ADS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Silvério, D. V. et al. Intensification of fire regimes and forest loss in the Território Indígena do Xingu. Environ. Res. Lett. 17, 045012 (2022).

    Article 
    ADS 

    Google Scholar
     

  • Brienen, R. J. W. et al. Long-term decline of the Amazon carbon sink. Nature 519, 344–348 (2015).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Esquivel‐Muelbert, A. et al. Compositional response of Amazon forests to climate change. Glob. Change Biol. 25, 39–56 (2019).

    Article 
    ADS 

    Google Scholar
     

  • Gatti, L. V. et al. Amazonia as a carbon source linked to deforestation and climate change. Nature 595, 388–393 (2021).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Nepstad, D. et al. Inhibition of Amazon deforestation and fire by parks and Indigenous lands: inhibition of Amazon deforestation and fire. Conserv. Biol. 20, 65–73 (2006).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Botelho, J., Costa, S. C. P., Ribeiro, J. G. & Souza, C. M. Mapping roads in the Brazilian Amazon with artificial intelligence and Sentinel-2. Remote Sensing 14, 3625 (2022).

    Article 
    ADS 

    Google Scholar
     

  • Matricardi, E. A. T. et al. Long-term forest degradation surpasses deforestation in the Brazilian Amazon. Science 369, 1378–1382 (2020).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Ainsworth, E. A. & Long, S. P. What have we learned from 15 years of free‐air CO2 enrichment (FACE)? A meta‐analytic review of the responses of photosynthesis, canopy properties and plant production to rising CO2. New Phytol. 165, 351–372 (2005).

  • Kooperman, G. J. et al. Forest response to rising CO2 drives zonally asymmetric rainfall change over tropical land. Nat. Clim. Change 8, 434–440 (2018).

    Article 
    ADS 

    Google Scholar
     

  • Lapola, D. M., Oyama, M. D. & Nobre, C. A. Exploring the range of climate biome projections for tropical South America: the role of CO2 fertilization and seasonality: future biome distribution in South America. Global Biogeochem. Cycles 23, https://doi.org/10.1029/2008GB003357 (2009).

  • Brienen, R. J. W. et al. Forest carbon sink neutralized by pervasive growth-lifespan trade-offs. Nat. Commun. 11, 4241 (2020).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Lammertsma, E. I. et al. Global CO2 rise leads to reduced maximum stomatal conductance in Florida vegetation. Proc. Natl Acad. Sci. USA 108, 4035–4040 (2011).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Terrer, C. et al. Nitrogen and phosphorus constrain the CO2 fertilization of global plant biomass. Nat. Clim. Change 9, 684–689 (2019).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Ellsworth, D. S. et al. Elevated CO2 does not increase eucalypt forest productivity on a low-phosphorus soil. Nat. Clim. Change 7, 279–282 (2017).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Quesada, C. A. et al. Basin-wide variations in Amazon forest structure and function are mediated by both soils and climate. Biogeosciences 9, 2203–2246 (2012).

    Article 
    ADS 

    Google Scholar
     

  • Flores, B. M. et al. Soil erosion as a resilience drain in disturbed tropical forests. Plant Soil https://doi.org/10.1007/s11104-019-04097-8 (2020).

  • Longo, M. et al. Ecosystem heterogeneity and diversity mitigate Amazon forest resilience to frequent extreme droughts. New Phytol. 219, 914–931 (2018).

    Article 
    PubMed 

    Google Scholar
     

  • Levine, N. M. et al. Ecosystem heterogeneity determines the ecological resilience of the Amazon to climate change. Proc. Natl Acad. Sci. USA 113, 793–797 (2016).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Staver, A. C. et al. Thinner bark increases sensitivity of wetter Amazonian tropical forests to fire. Ecol. Lett. 23, 99–106 (2020).

    Article 
    PubMed 

    Google Scholar
     

  • Mattos, C. R. C. et al. Double stress of waterlogging and drought drives forest–savanna coexistence. Proc. Natl Acad. Sci. USA 120, e2301255120 (2023).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Flores, B. M. et al. Floodplains as an Achilles’ heel of Amazonian forest resilience. Proc. Natl Acad. Sci. USA 114, 4442–4446 (2017).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Marengo, J. A. & Espinoza, J. C. Extreme seasonal droughts and floods in Amazonia: causes, trends and impacts. Int. J. Climatol. 36, 1033–1050 (2016).

    Article 

    Google Scholar
     

  • Boers, N., Marwan, N., Barbosa, H. M. J. & Kurths, J. A deforestation-induced tipping point for the South American monsoon system. Sci. Rep. 7, 41489 (2017).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Alexander, C. et al. Linking Indigenous and scientific knowledge of climate change. BioScience 61, 477–484 (2011).

    Article 

    Google Scholar
     

  • Ford, J. D. et al. The resilience of Indigenous peoples to environmental change. One Earth 2, 532–543 (2020).

    Article 
    ADS 

    Google Scholar
     

  • Cooper, G. S., Willcock, S. & Dearing, J. A. Regime shifts occur disproportionately faster in larger ecosystems. Nat. Commun. 11, 1175 (2020).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Drijfhout, S. et al. Catalogue of abrupt shifts in Intergovernmental Panel on Climate Change climate models. Proc. Natl Acad. Sci. USA 112, E5777–E5786 (2015).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Salazar, L. F. & Nobre, C. A. Climate change and thresholds of biome shifts in Amazonia: climate change and Amazon biome shift. Geophys. Res. Lett. 37, https://doi.org/10.1029/2010GL043538 (2010).

  • Jones, C., Lowe, J., Liddicoat, S. & Betts, R. Committed terrestrial ecosystem changes due to climate change. Nat. Geosci. 2, 484–487 (2009).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Schellnhuber, H. J., Rahmstorf, S. & Winkelmann, R. Why the right climate target was agreed in Paris. Nat. Clim. Change 6, 649–653 (2016).

    Article 
    ADS 

    Google Scholar
     

  • Chai, Y. et al. Constraining Amazonian land surface temperature sensitivity to precipitation and the probability of forest dieback. npj Clim. Atmos. Sci. 4, 6 (2021).

    Article 
    ADS 

    Google Scholar
     

  • Brando, P. M. et al. Abrupt increases in Amazonian tree mortality due to drought-fire interactions. Proc. Natl Acad. Sci. USA 111, 6347–6352 (2014).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Berenguer, E. et al. Tracking the impacts of El Niño drought and fire in human-modified Amazonian forests. Proc. Natl Acad. Sci. USA 118, e2019377118 (2021).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Staal, A. et al. Hysteresis of tropical forests in the 21st century. Nat. Commun. 11, 4978 (2020).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Staver, A. C., Archibald, S. & Levin, S. A. The global extent and determinants of savanna and forest as alternative biome states. Science 334, 230–232 (2011).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Malhi, Y. et al. Exploring the likelihood and mechanism of a climate-change-induced dieback of the Amazon rainforest. Proc. Natl Acad. Sci. USA 106, 20610–20615 (2009).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Nobre, C. A. et al. Land-use and climate change risks in the Amazon and the need of a novel sustainable development paradigm. Proc. Natl Acad. Sci. USA 113, 10759–10768 (2016).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Burton, C. et al. South American fires and their impacts on ecosystems increase with continued emissions. Clim. Resil. Sustain. 1, e8 (2022).


    Google Scholar
     

  • Smith, C. C. et al. Old-growth forest loss and secondary forest recovery across Amazonian countries. Environ. Res. Lett. 16, 085009 (2021).

    Article 
    ADS 

    Google Scholar
     

  • Brando, P. M. et al. Prolonged tropical forest degradation due to compounding disturbances: Implications for CO2 and H2O fluxes. Glob. Change Biol. 25, 2855–2868 (2019).

    Article 
    ADS 

    Google Scholar
     

  • Mesquita, R. C. G., Ickes, K., Ganade, G. & Williamson, G. B. Alternative successional pathways in the Amazon Basin: successional pathways in the Amazon. J. Ecol. 89, 528–537 (2001).

    Article 

    Google Scholar
     

  • Jakovac, C. C., Peña-Claros, M., Kuyper, T. W. & Bongers, F. Loss of secondary-forest resilience by land-use intensification in the Amazon. J. Ecol. 103, 67–77 (2015).

    Article 

    Google Scholar
     

  • Barlow, J. & Peres, C. A. Fire-mediated dieback and compositional cascade in an Amazonian forest. Phil. Trans. R. Soc. B 363, 1787–1794 (2008).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Jakovac, A. C. C., Bentos, T. V., Mesquita, R. C. G. & Williamson, G. B. Age and light effects on seedling growth in two alternative secondary successions in central Amazonia. Plant Ecol. Divers. 7, 349–358 (2014).

    Article 

    Google Scholar
     

  • Mazzochini, G. G. & Camargo, J. L. C. Understory plant interactions along a successional gradient in Central Amazon. Plant Soil https://doi.org/10.1007/s11104-019-04100-2 (2020).

    Article 

    Google Scholar
     

  • Schnitzer, S. A. & Bongers, F. Increasing liana abundance and biomass in tropical forests: emerging patterns and putative mechanisms: Increasing lianas in tropical forests. Ecology Letters 14, 397–406 (2011).

    Article 
    PubMed 

    Google Scholar
     

  • Tymen, B. et al. Evidence for arrested succession in a liana-infested Amazonian forest. J Ecol 104, 149–159 (2016).

    Article 
    CAS 

    Google Scholar
     

  • da Silva, S. S. et al. Increasing bamboo dominance in southwestern Amazon forests following intensification of drought-mediated fires. For. Ecol. Manag. 490, 119139 (2021).

    Article 

    Google Scholar
     

  • Carvalho, A. Lde et al. Bamboo-dominated forests of the southwest Amazon: detection, spatial extent, life cycle length and flowering waves. PLoS ONE 8, e54852 (2013).

    Article 
    ADS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Adeney, J. M., Christensen, N. L., Vicentini, A. & Cohn‐Haft, M. White‐sand ecosystems in Amazonia. Biotropica 48, 7–23 (2016).

    Article 

    Google Scholar
     

  • Flores, B. M. & Holmgren, M. White-sand savannas expand at the core of the Amazon after forest wildfires. Ecosystems 24, 1624–1637 (2021).

    Article 

    Google Scholar
     

  • Veldman, J. W. & Putz, F. E. Grass-dominated vegetation, not species-diverse natural savanna, replaces degraded tropical forests on the southern edge of the Amazon Basin. Biol. Conserv. 144, 1419–1429 (2011).

    Article 

    Google Scholar
     

  • Silvério, D. V. et al. Testing the Amazon savannization hypothesis: fire effects on invasion of a neotropical forest by native cerrado and exotic pasture grasses. Phil. Trans. R. Soc. B 368, 20120427 (2013).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Rull, V. A palynological record of a secondary succession after fire in the Gran Sabana, Venezuela. J. Quat. Sci. 14, 137–152 (1999).

    Article 

    Google Scholar
     

  • Sakschewski, B. et al. Resilience of Amazon forests emerges from plant trait diversity. Nat. Clim. Change 6, 1032–1036 (2016).

    Article 
    ADS 

    Google Scholar
     

  • Hall, A., Cox, P., Huntingford, C. & Klein, S. Progressing emergent constraints on future climate change. Nat. Clim. Change 9, 269–278 (2019).

    Article 
    ADS 

    Google Scholar
     

  • Willcock, S., Cooper, G. S., Addy, J. & Dearing, J. A. Earlier collapse of Anthropocene ecosystems driven by multiple faster and noisier drivers. Nat. Sustain 6, 1331–1342 (2023).

    Article 

    Google Scholar
     

  • Davidson, E. A. et al. The Amazon basin in transition. Nature 481, 321–328 (2012).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Hecht, S. B. From eco-catastrophe to zero deforestation? Interdisciplinarities, politics, environmentalisms and reduced clearing in Amazonia. Envir. Conserv. 39, 4–19 (2012).

    Article 

    Google Scholar
     

  • Hirota, M., Holmgren, M., Van Nes, E. H. & Scheffer, M. Global resilience of tropical forest and savanna to critical transitions. Science 334, 232–235 (2011).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Hawes, J. E. et al. A large‐scale assessment of plant dispersal mode and seed traits across human‐modified Amazonian forests. J. Ecol. 108, 1373–1385 (2020).

    Article 

    Google Scholar
     

  • Flores, B. M. & Holmgren, M. Why forest fails to recover after repeated wildfires in Amazonian floodplains? Experimental evidence on tree recruitment limitation. J. Ecol. 109, 3473–3486 (2021).

    Article 

    Google Scholar
     

  • ter Steege, H. et al. Biased-corrected richness estimates for the Amazonian tree flora. Sci. Rep. 10, 10130 (2020).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Poorter, L. et al. Diversity enhances carbon storage in tropical forests: Carbon storage in tropical forests. Global Ecol. Biogeogr. 24, 1314–1328 (2015).

    Article 

    Google Scholar
     

  • Walker, B., Kinzig, A. & Langridge, J. Plant attribute diversity, resilience, and ecosystem function: the nature and significance of dominant and minor species. Ecosystems 2, 95–113 (1999).

    Article 

    Google Scholar
     

  • Elmqvist, T. et al. Response diversity, ecosystem change, and resilience. Front. Ecol. Environ. 1, 488–494 (2003).

    Article 

    Google Scholar
     

  • Esquivel-Muelbert, A. et al. Seasonal drought limits tree species across the Neotropics. Ecography 40, 618–629 (2017).

    Article 
    ADS 

    Google Scholar
     

  • Estes, J. A. et al. Trophic downgrading of planet Earth. Science 333, 301–306 (2011).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Garnett, S. T. et al. A spatial overview of the global importance of Indigenous lands for conservation. Nat. Sustain. 1, 369–374 (2018).

    Article 

    Google Scholar
     

  • Morcote-Ríos, G., Aceituno, F. J., Iriarte, J., Robinson, M. & Chaparro-Cárdenas, J. L. Colonisation and early peopling of the Colombian Amazon during the Late Pleistocene and the Early Holocene: new evidence from La Serranía La Lindosa. Quat. Int. 578, 5–19 (2021).

    Article 

    Google Scholar
     

  • Levis, C. et al. How people domesticated Amazonian forests. Front. Ecol. Evol. 5, 171 (2018).

    Article 

    Google Scholar
     

  • Clement, C. R. et al. The domestication of Amazonia before European conquest. Proc. R. Soc. B. 282, 20150813 (2015).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Levis, C. et al. Persistent effects of pre-Columbian plant domestication on Amazonian forest composition. Science 355, 925–931 (2017).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Coelho, S. D. et al. Eighty-four per cent of all Amazonian arboreal plant individuals are useful to humans. PLoS ONE 16, e0257875 (2021).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • de Souza, J. G. et al. Climate change and cultural resilience in late pre-Columbian Amazonia. Nat. Ecol. Evol. 3, 1007–1017 (2019).

    Article 
    PubMed 

    Google Scholar
     

  • Furquim, L. P. et al. Facing change through diversity: resilience and diversification of plant management strategies during the Mid to Late Holocene Transition at the Monte Castelo shellmound, SW Amazonia. Quaternary 4, 8 (2021).

    Article 

    Google Scholar
     

  • Schmidt, M. V. C. et al. Indigenous knowledge and forest succession management in the Brazilian Amazon: contributions to reforestation of degraded areas. Front. For. Glob. Change 4, 605925 (2021).

    Article 

    Google Scholar
     

  • Tomioka Nilsson, M. S. & Fearnside, P. M. Yanomami mobility and its effects on the forest landscape. Hum. Ecol. 39, 235–256 (2011).

    Article 

    Google Scholar
     

  • Cámara-Leret, R. & Bascompte, J. Language extinction triggers the loss of unique medicinal knowledge. Proc. Natl Acad. Sci. USA 118, e2103683118 (2021).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • DiMiceli, C. et al. MOD44B MODIS/Terra Vegetation Continuous Fields Yearly L3 Global 250 m SIN Grid V006. https://doi.org/10.5067/MODIS/MOD44B.006 (2015).

  • Sexton, J. O. et al. Global, 30-m resolution continuous fields of tree cover: Landsat-based rescaling of MODIS vegetation continuous fields with lidar-based estimates of error. Int. J. Digital Earth 6, 427–448 (2013).

    Article 
    ADS 

    Google Scholar
     

  • Staver, A. C. & Hansen, M. C. Analysis of stable states in global savannas: is the CART pulling the horse? – a comment. Global Ecol. Biogeogr. 24, 985–987 (2015).

    Article 

    Google Scholar
     

  • Funk, C. et al. The climate hazards infrared precipitation with stations—a new environmental record for monitoring extremes. Sci Data 2, 150066 (2015).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Mitchell, T. D. & Jones, P. D. An improved method of constructing a database of monthly climate observations and associated high-resolution grids. Int. J. Climatol. 25, 693–712 (2005).

    Article 

    Google Scholar
     

  • Giglio, L., Schroeder, W. & Justice, C. O. The collection 6 MODIS active fire detection algorithm and fire products. Remote Sens. Environ. 178, 31–41 (2016).

    Article 
    ADS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Livina, V. N., Kwasniok, F. & Lenton, T. M. Potential analysis reveals changing number of climate states during the last 60 kyr. Clim. Past 6, 77–82 (2010).

    Article 

    Google Scholar
     

  • Silverman, B. W. Density Estimation for Statistics and Data Analysis (Chapman & Hall/CRC Taylor & Francis Group, 1998).

  • Tuinenburg, O. A. & Staal, A. Tracking the global flows of atmospheric moisture and associated uncertainties. Hydrol. Earth Syst. Sci. 24, 2419–2435 (2020).

    Article 
    ADS 

    Google Scholar
     

  • Hersbach, H. et al. The ERA5 global reanalysis. Q. J. R. Meteorol. Soc. 146, 1999–2049 (2020).

    Article 
    ADS 

    Google Scholar
     

  • Tuinenburg, O. A., Theeuwen, J. J. E. & Staal, A. High-resolution global atmospheric moisture connections from evaporation to precipitation. Earth Syst. Sci. Data 12, 3177–3188 (2020).

    Article 
    ADS 

    Google Scholar
     

  • Oliveira, R. S. et al. Embolism resistance drives the distribution of Amazonian rainforest tree species along hydro‐topographic gradients. New Phytol. 221, 1457–1465 (2019).

    Article 
    PubMed 

    Google Scholar
     

  • Mattos, C. R. C. et al. Rainfall and topographic position determine tree embolism resistance in Amazônia and Cerrado sites. Environ. Res. Lett. 18, 114009 (2023).

    Article 
    ADS 

    Google Scholar
     

  • NASA JPL. NASA Shuttle Radar Topography Mission Global 1 arc second. https://doi.org/10.5067/MEaSUREs/SRTM/SRTMGL1.003 (2013).

  • Hess, L. L. et al. Wetlands of the Lowland Amazon Basin: Extent, Vegetative Cover, and Dual-season Inundated Area as Mapped with JERS-1 Synthetic Aperture Radar. Wetlands 35, 745–756 (2015).

    Article 

    Google Scholar
     

  • Eberhard, D. M., Simons, G. F. & Fennig, C. D. Ethnologue: Languages of the World. (SIL International, 2021).

  • [ad_2]

    Source link

  • Room-temperature quantum optomechanics using an ultralow noise cavity

    [ad_1]

    Fabrication of density-modulated membranes

    We use the soft clamping6,49,50,51,52,53 technique to realize ultrahigh mechanical quality factors. Our membrane design is inspired by those pioneered in ref. 7, but we use a different material for the nanopillars and a different fabrication process (see Supplementary Information for more details). We fabricated density-modulated PNC membranes by patterning amorphous silicon (aSi) nanopillars on a high aspect ratio Si3N4 membrane. In our PNC membranes, we fabricated pillars with diameters dpil = 300–800 nm, thickness of about 600 nm and nearest-neighbour distances apil = 1.0–2.0 μm. Amorphous silicon is grown with plasma-enhanced chemical vapour deposition (PECVD) at a temperature of 300 °C. Electron-beam lithography (FOx16 electron-beam resist) and dry etching (using a plasma of SF6 and C4F8) are used to pattern pillar arrays in aSi. Dry etching is stopped on a 6-nm layer of HfO2 (hafnium oxide) grown with atomic layer deposition (ALD) directly on top of Si3N4. HfO2 is used as an etch-stop layer because it is quite resistant to hydrofluoric acid (HF) etching, and the undercut created at the pillar base in the following process steps is limited. Undercut minimization is important to control the added dissipation induced by pillar motion (Supplementary Information). We remove the FOx mask and the residual etch-stop layer by dipping the wafer in HF 1% for about 3.5 min.

    After patterning the pillars, we encapsulate them in a PECVD SixNy layer to protect them during the silicon deep etching step. We first grow a thin (about 20 nm), protective layer of Al2O3 with ALD, to shield the membrane layer from plasma bombardment during PECVD. Then, approximately 125 nm of SixNy is grown at 300 °C, with 40 W of radio-frequency power exciting the plasma during deposition. This SixNy layer has been characterized to have a tensile stress of around +300 MPa at room temperature. The layer perfectly seals the nanopillars during immersion in hot KOH, without significant consumption.

    After patterning the pillars on the wafer frontside film, a thick (about 3 μm) layer of positive tone photoresist is spun on top for protection during the backside lithography process, which we perform with an MLA150 laser writer (Heidelberg Instruments). Optical lithography is followed by Si3N4 dry etching with a plasma of CHF3 and SF6. After the resist mask and protection layer removal with N-methyl-2-pyrrolidone (NMP) and O2 plasma, we deep-etch with KOH from the membrane windows while keeping the frontside protected, by installing the wafer in a watertight PEEK holder in which only the backside is exposed6. KOH 40% at 70 °C is used, and the etch is interrupted when about 30–40 μm of silicon remains. The wafer is then rinsed and cleaned with hot HCl of the residues formed during KOH etching. Then, the wafer is separated into individual dies with a dicing saw, and the process continues chipwise. Chips are again cleaned with NMP and O2 plasma, and the deep-etch is concluded with a second immersion in KOH 40% at a lower temperature of 55 °C, followed by cleaning in HCl. From the end of the KOH etching step, the composite membranes are suspended, and great care must be taken while displacing and immersing the samples in liquid. We dry the samples by moving them to an ultrapure isopropyl alcohol bath after water rinsing. Isopropyl alcohol has a high vapour pressure, and quickly evaporates from the chip interfaces, with few residues left behind.

    Finally, the PECVD nitride and Al2O3 layers can be removed selectively with wet etching in buffered HF. The chips are loaded in a Teflon carrier in which they are vertically mounted and immersed for about 3 min 20 s in BHF 7:1. It is crucial not to etch more than necessary to fully remove the encapsulation films: membranes become extremely fragile and the survival yield drops sharply when their thickness is reduced below around 15 nm. The membranes are then carefully rinsed, transferred in an ethanol bath and dried in a critical point dryer, in which the liquids can be evacuated gently and with little contamination.

    Fabrication and simulation of phononic-crystal-patterned mirrors

    The top and bottom mirror substrates are, respectively, fused silica and borosilicate glass, with a high-reflection coating sputtered on one face and an anti-reflection layer coating the other face. No layer for the protection of the optical coating is applied before machining. We use a dicing saw for glass machining to pattern a regular array of lines into the mirror substrates. The blade is continuously cooled by a pressurized water jet during the patterning process. The maximum cut depth allowed for our blade is 2.5 mm, and we constrain the designed PNC accordingly. We cut the flat bottom mirror from only one side (its thickness is only 1 mm), and the top mirror is patterned symmetrically with parallel cuts from both sides, as it is 4 mm thick. The relatively deep cuts in the top mirror need to be patterned over several passes, with gradually increasing depths. After patterning one mirror side, the piece is flipped and the other side is patterned after aligning to the first cuts, visible through the glass substrate. The lines are arranged in a square lattice for simplicity, although more complex patterns can be machined with the dicing saw. After the dicing process, the mirrors are subject to ultrasonic cleaning, while immersing first in acetone and then in isopropanol.

    We simulate the band diagrams of the unit cells of both the top and the bottom mirrors in COMSOL Multiphysics with the Structural Mechanics module. We optimized the lattice constant and cut depths to maximize the bandgap width, while centring the bandgap around 1 MHz and making sure that the remaining glass thickness is sufficient to maintain a reasonable level of structural stiffness. Details of the PNC dimensions are shown in the Supplementary Information. Owing to the finite size of the mirrors, we expect to observe edge modes within the mechanical bandgap frequency range. The thermal vibrations of these modes penetrate into the PNC structure with exponentially decaying amplitudes. To account for their noise contributions, we simulated the frequency noise spectrum of the MIM assembly (details shown in the Supplementary Information). The eigenfrequency solution confirmed the existence of edge modes with frequencies within the mechanical bandgap, but did not predict any significant contribution to the cavity frequency noise: the PNC is sufficiently large to reduce their amplitude at the cavity mode position.

    After patterning the PNC structures on the mirrors, we assembled a cavity with a spacer chip in place of a membrane and observed that the TE00 linewidth with the diced mirrors is identical to that of the original cavity. This indicates that our fabrication process does not cause measurable excess roughness or damage to the mirror surfaces. By contrast, when the assembly was clamped too tightly, excess cavity loss occurred because of significant deformation of the PNC mirrors, with a reduced stiffness. We mitigate this detrimental effect in the experiment by gently clamping the MIM cavity, with a spring compression sufficient to guarantee the structural stability of the assembly. We also ensure that the cavity mode is well-centred on the bottom mirror, to reduce the thermal noise contribution of the upper band-edge modes. For the MIM experiment discussed in the main text, we did not observe any mirror modes within the mechanical bandgap of the membrane chip. We can distinguish membrane modes from mirror modes by exploiting the fact that the coupling rates of membrane modes vary between different cavity resonances, whereas this is not the case for mirror modes.

    Nonlinear noise cancellation scheme

    At room temperature, the large thermal noise of the cavity, combined with the nonlinear cavity transduction response, results in a nonlinear mixing noise (TIN). This noise could lead to excess intracavity photon fluctuations and also to excess noise in optical detection. In the following, we discuss the strategy to cancel these effects in the fast-cavity limit (ωκ). Theoretical derivations and a discussion of the effect of a finite ω/κ ratio can be found in the Supplementary Information.

    In the experiment, we pump the cavity at the magic detuning, \(2\overline{\varDelta }/\kappa =-1/\sqrt{3}\), in which the nonlinear photon number noise is cancelled, to prevent excess oscillator heating due to nonlinear classical radiation pressure noise. To show the quantum correlations leading to optomechanical squeezing and conduct measurement-based state preparation, we need to perform measurements at arbitrary optical quadrature angles. Balanced homodyne detection provides the possibility of tuning the optical quadrature, but it does not offer enough degrees of freedom to cancel the nonlinear noise in detection. However, if the local oscillator is injected from a highly asymmetric beam splitter with a very small reflectivity (r 1) and the combined field is detected on a single photodiode, the photodetection nonlinearity is maintained and offers enough degrees of freedom to cancel the nonlinear noise in detection4 (for a derivation, see Supplementary Information). Specifically, simultaneous tuning of local oscillator amplitude and phase enables nonlinear mixing noise cancellation at arbitrary quadrature angles. In the fast-cavity limit, the cancellation condition is

    $$\begin{array}{l}\left|\frac{{\overline{a}}_{{\rm{sig}}}}{{\overline{a}}_{\hom }}\right|=2{\rm{Re}}\,\left[\frac{{{\rm{e}}}^{-{\rm{i}}\theta }}{{(-{\rm{i}}\overline{\varDelta }+\kappa /2)}^{2}}\right]\,\left[{\overline{\varDelta }}^{2}+{\left(\frac{\kappa }{2}\right)}^{2}\right]\\ \,=2\cos [\theta -2\arg ({\chi }_{{\rm{cav}}}(0))],\end{array}$$

    where \({\overline{a}}_{\hom }\approx {\overline{a}}_{{\rm{sig}}}+r{\overline{a}}_{{\rm{LO}}}\) is the coherent combination of the signal field \({\overline{a}}_{{\rm{sig}}}\) and the local oscillator field \({\overline{a}}_{{\rm{LO}}}\) (defined as the field before the beam splitter), θ = θhom − θsig is the quadrature rotation angle and \({\chi }_{{\rm{cav}}}(0)={\left(\kappa /2-i\overline{\varDelta }\right)}^{-1}\) is the cavity d.c. optical susceptibility.

    In the experiment, to detect a certain quadrature angle while cancelling nonlinear noise, we lock the homodyne power at the corresponding combined field level \({I}_{\hom }=| {\overline{a}}_{\hom }{| }^{2}\). We then continuously vary the local oscillator power using a tunable neutral density filter until the noise in the mechanical bandgap is perfectly cancelled. The level of mixing noise is very sensitive to the local oscillator power, and therefore the cancellation point can serve as a good indicator of the measured quadrature angle θ. Knowing the field amplitudes \(| {\overline{a}}_{\hom }| ,| {\overline{a}}_{{\rm{sig}}}| \) and that \(\overline{\varDelta }=-\kappa /(2\sqrt{3})\), we can reconstruct the measured quadrature angle as the one satisfying the cancellation condition.

    A detailed characterization of the nonlinear mixing noise and an analysis of single-detector homodyne efficiency can be found in the Supplementary Information.

    Multimode Kalman filter

    The continuous position measurement of an oscillator at frequency Ωm can be viewed as a form of heterodyne measurement of two orthogonal mechanical quadratures of motion \(\widehat{X}\) and \(\widehat{Y}\) that rotate with frequency Ωm. IQ demodulation can then be carried out at the mechanical frequency Ωm. This results in two independent measurement channels of two orthogonal mechanical quadratures with independent measurement noise.

    We work in a parameter regime in which the measurement rate is significantly smaller than the frequency of the mechanical mode, such that we can perform IQ demodulation of the mechanical motion at Ωm to obtain the slowly varying \(\widehat{X},\widehat{Y}\) quadratures. Their evolution is described by decoupled quantum master equations33. In this parameter regime, only thermal coherent states are prepared through the measurement process. These states are essentially thermal states displaced from the origin of the phase space and belong to the larger group of Gaussian states.

    We operate in the fast-cavity limit Ωmκ, so the cavity dynamics are simplified in our modelling. After IQ demodulation, the normalized photocurrent signal is described by

    $${\bf{i}}(t){\rm{d}}t={\rm{d}}{\bf{W}}(t)+\sum _{i}\sqrt{4{\varGamma }_{{\rm{meas}}}^{i}}\langle {\widehat{{\bf{r}}}}_{i}\rangle (t){\rm{d}}t$$

    (1)

    where the subscript i denotes different mechanical modes, \({\bf{i}}=\left[\begin{array}{c}{i}_{X}\\ {i}_{Y}\end{array}\right]\), \({\widehat{{\bf{r}}}}_{i}=\left[\begin{array}{c}{\widehat{X}}_{i}\\ {\widehat{Y}}_{i}\end{array}\right]\) and \({\rm{d}}{\bf{W}}=\left[\begin{array}{c}{\rm{d}}{W}_{X}\\ {\rm{d}}{W}_{Y}\end{array}\right]\). The Wiener increment dWX,Y(t) = ξ(t)dt is defined in terms of an ideal unit Gaussian white noise process \(\langle \xi (t)\xi ({t}^{{\prime} })\rangle =\delta (t-{t}^{{\prime} })\).

    As the measurement is purely linear, the system remains in a Gaussian state54, and the dynamics are completely captured by the expectation values of the quadratures Xi, Yi and their covariance matrix C. We derive the time evolution of the quadrature expectation values as

    $${\rm{d}}\langle {\widehat{{\bf{r}}}}_{i}\rangle ={A}_{i}\langle {\widehat{{\bf{r}}}}_{i}\rangle {\rm{d}}t+2{B}_{i}{\rm{d}}{\bf{W}}(t),$$

    (2)

    where

    $${A}_{i}=\left[\begin{array}{cc}-{\varGamma }_{{\rm{m}}}^{i}\,/2 & {\varOmega }_{i}-{\varOmega }_{{\rm{m}}}\\ {\varOmega }_{{\rm{m}}}-{\varOmega }_{i} & -{\varGamma }_{{\rm{m}}}^{i}\,/2\end{array}\right]$$

    and

    $${B}_{i}=\left[\begin{array}{cc}{\sum }_{j}\sqrt{{\varGamma }_{{\rm{meas}}}^{j}}{C}_{{\widehat{X}}_{i}{\widehat{X}}_{j}} & {\sum }_{j}\sqrt{{\varGamma }_{{\rm{meas}}}^{j}}{C}_{{\widehat{X}}_{i}{\widehat{Y}}_{j}}\\ {\sum }_{j}\sqrt{{\varGamma }_{{\rm{meas}}}^{j}}{C}_{{\widehat{Y}}_{i}{\widehat{X}}_{j}} & {\sum }_{j}\sqrt{{\varGamma }_{{\rm{meas}}}^{j}}{C}_{{\widehat{Y}}_{i}{\widehat{Y}}_{j}}\end{array}\right].$$

    The covariance matrix elements \({C}_{\widehat{M}\widehat{N}}=\langle \widehat{M}\widehat{N}+\widehat{N}\widehat{M}\rangle /2-\langle \widehat{M}\rangle \langle \widehat{N}\rangle \) evolve as

    $$\begin{array}{l}{\dot{C}}_{{\widehat{M}}_{i}{\widehat{N}}_{j}}=-\frac{{\varGamma }_{{\rm{m}}}^{i}+{\varGamma }_{{\rm{m}}}^{j}}{2}{\dot{C}}_{{\widehat{M}}_{i}{\widehat{N}}_{j}}+{\delta }_{{\widehat{M}}_{i},{\widehat{N}}_{j}}{\varGamma }_{{\rm{th}}}^{i}+{\delta }_{M,N}\sqrt{{\varGamma }_{{\rm{qba}}}^{i}{\varGamma }_{{\rm{qba}}}^{j}}\\ \,\,+{(-1)}^{{\delta }_{M,Y}}({\varOmega }_{i}-{\varOmega }_{{\rm{m}}}){C}_{{\widehat{{\mathcal{M}}}}_{i}{\widehat{N}}_{j}}+{(-1)}^{{\delta }_{N,Y}}({\varOmega }_{j}-{\varOmega }_{{\rm{m}}}){C}_{{\widehat{M}}_{i}{\widehat{{\mathcal{N}}}}_{j}}\\ \,-4\left(\sum _{k}\sqrt{{\varGamma }_{{\rm{meas}}}^{k}}{C}_{{\widehat{M}}_{i}{\widehat{X}}_{k}}\right)\left(\sum _{l}\sqrt{{\varGamma }_{{\rm{meas}}}^{l}}{C}_{{\widehat{N}}_{j}{\widehat{X}}_{l}}\right)\\ \,-4\left(\sum _{k}\sqrt{{\varGamma }_{{\rm{meas}}}^{k}}{C}_{{\widehat{M}}_{i}{\widehat{Y}}_{k}}\right)\left(\sum _{l}\sqrt{{\varGamma }_{{\rm{meas}}}^{l}}{C}_{{\widehat{N}}_{j}{\widehat{Y}}_{l}}\right),\end{array}$$

    (3)

    where \(\widehat{{\mathcal{M}}}\) and \(\widehat{{\mathcal{N}}}\) are the canonical conjugate observables of \(\widehat{M}\) and \(\widehat{N}\).

    Equations (1)–(3) form a closed set of update equations given the measurement record i(t), and enable quadrature estimations of an arbitrary number of modes and their correlations. The thermal occupancy \({\bar{n}}_{{\rm{c}}{\rm{o}}{\rm{n}}{\rm{d}},i}\) of a specific mechanical mode is determined by the quadrature phase-space variances \({V}_{{\widehat{X}}_{i}}={C}_{{\widehat{X}}_{i}{\widehat{X}}_{i}}\) and \({V}_{{\widehat{Y}}_{i}}={C}_{{\widehat{Y}}_{i}{\widehat{Y}}_{i}}\), which are both equal to \({\bar{n}}_{{\rm{c}}{\rm{o}}{\rm{n}}{\rm{d}},i}+1/2\).

    We record the voltage output from the photodetector using an UHFLI lock-in amplifier (Zurich Instruments), digitizing the signal at a 14-MHz sampling rate for a total duration of 2 s, and we store the data digitally for post-processing. The noise power spectrum density of the digitized signal is compared with that simultaneously measured on a real-time spectrum analyser, to rule out signal-to-noise ratio degradation from the digitization noise. Details of an additional filtering step are discussed in the Supplementary Information. After filtering, only the 10 mechanical modes around the defect mode frequency Ωm are kept for the multimode state estimation study.

    To perform the multimode state estimation, we extract the required system parameters of the nearest 10 mechanical modes around Ωm by fitting the measured spectral noise density. We demodulate the signal at Ωm and feed the time-series signal i(t) to the discretized version of the update equation (2),

    $$\Delta \langle {\widehat{{\bf{r}}}}_{i}\rangle ={A}_{i}^{{\prime} }\langle {\widehat{{\bf{r}}}}_{i}\rangle \Delta t+2{B}_{i}\Delta {\bf{W}}(t)$$

    (4)

    to track all the 20 quadrature expectations at different times. Here, \({A}_{i}^{{\prime} }=\left[\begin{array}{cc}-{\varGamma }_{{\rm{m}}}^{{\prime} i}\,/2 & {\varOmega }_{i}^{{\prime} }-{\varOmega }_{{\rm{m}}}\\ {\varOmega }_{{\rm{m}}}-{\varOmega }_{i}^{{\prime} } & -{\varGamma }_{{\rm{m}}}^{{\prime} i}\,/2\end{array}\right]\) contains modified mechanical parameters:

    $$\begin{array}{l}{\varGamma }_{{\rm{m}}}^{{\prime} i}={\varGamma }_{{\rm{m}}}^{i}+2{\rm{Re}}\,\left[-\frac{1-\cos (({\varOmega }_{i}-{\varOmega }_{{\rm{m}}})\Delta t)}{\Delta t}\right]\\ {\varOmega }_{i}^{{\prime} }={\varOmega }_{i}-{\rm{Im}}\,\left[i({\varOmega }_{i}-{\varOmega }_{{\rm{m}}})-\frac{{{\rm{e}}}^{{\rm{i}}({\varOmega }_{i}-{\varOmega }_{{\rm{m}}})\Delta t}-1}{\Delta t}\right]\end{array}$$

    to compensate for the influence of discretization on the state estimation performance compared with an ideal continuous one.

    The evolution of the matrix Bi, involving 210 independent covariance matrix elements, can be computed independently from the sampled time-domain data. Therefore, we calculate it following equation (3), with an update rate of 140 MHz to mitigate the discretization effect, which is then used for the update equation (4) at the sampling rate of 14 MHz. The verification of the correct implementation of the multimode Kalman filter is shown in the Supplementary Information.

    To experimentally reconstruct the covariance matrix from the estimated quadrature data, we use the retrodiction method. The retrodiction method uses the measurement record in the future as a separate state estimation result. We derived the retrodiction update equations39 and found that they are identical to the prediction update equations, except with negative mechanical frequencies. As a result, we have the following relations between covariance matrix elements estimated by prediction and retrodiction (respectively identified by the superscripts p and r):

    $$\begin{array}{l}{C}_{{\widehat{X}}_{i}{\widehat{X}}_{j}}^{{\rm{p}}}={C}_{{\widehat{X}}_{i}{\widehat{X}}_{j}}^{{\rm{r}}}\\ \,{C}_{{\widehat{Y}}_{i}{\widehat{Y}}_{j}}^{{\rm{p}}}={C}_{{\widehat{Y}}_{i}{\widehat{Y}}_{j}}^{{\rm{r}}}\\ {C}_{{\widehat{X}}_{i}{\widehat{Y}}_{j}}^{{\rm{p}}}=-{C}_{{\widehat{X}}_{i}{\widehat{Y}}_{j}}^{{\rm{r}}}.\end{array}$$

    For each time trace slice (1 ms), we calculate the difference between the prediction and retrodiction results \({\langle \widehat{{\bf{r}}}\rangle }_{{\rm{r}}}-{\langle \widehat{{\bf{r}}}\rangle }_{{\rm{p}}}\), and calculate the covariance matrix as

    $$C=\frac{1}{2}\langle \langle \left({\langle \widehat{{\bf{r}}}\rangle }_{{\rm{r}}}-{\langle \widehat{{\bf{r}}}\rangle }_{{\rm{p}}}\right)\cdot {\left({\langle \widehat{{\bf{r}}}\rangle }_{{\rm{r}}}-{\langle \widehat{{\bf{r}}}\rangle }_{{\rm{p}}}\right)}^{\top }\rangle \rangle $$

    where is the statistical average over all the time trace slices, and \(\widehat{{\bf{r}}}=\left[\cdots ,{\widehat{X}}_{i},{\widehat{Y}}_{i},\cdots \right]\). The symbolT indicates the transposed vector.

    For a system consisting of several mechanical modes that are not sufficiently separated in frequency (Ωi − Ωj not significantly faster than any other rates in the system), cross-correlations between different mechanical modes emerge because of common measurement imprecision noise and common quantum backaction force. This generally leads to higher quadrature variance because of the effectively reduced measurement efficiency of individual modes. To decouple the mechanical oscillators that are interacting because of the spectral overlap and the measurement process, we define a new set of collective motional modes through a symplectic (canonical) transformation of quadrature basis U that diagonalizes the covariance matrix UCU = V (ref. 55). As the covariance matrix is real and symmetric, the elements of U are always real, which is required for real observables. The transformation can be understood as a normal mode decomposition of the collective Gaussian state that preserves the commutation relations, as opposed to conventional diagonalization using unitary matrices. This is represented by the requirement of the symplectic transformation UΩU = Ω, where \(\varOmega =\left[\begin{array}{cc}0 & {I}_{N}\\ -{I}_{N} & 0\end{array}\right]\) is the N-mode symplectic form and IN is the N × N identity matrix. We find that in the new quadrature basis based on the diagonalized covariance matrix, the defect mode is only weakly modified. The transformation coefficients for the defect mode are shown in the Supplementary Information.

    [ad_2]

    Source link

  • Observation of plaid-like spin splitting in a noncoplanar antiferromagnet

    [ad_1]

  • Žutić, I., Fabian, J. & Das Sarma, S. Spintronics: fundamentals and applications. Rev. Mod. Phys. 76, 323–410 (2004).

  • Dieny, B. et al. Opportunities and challenges for spintronics in the microelectronics industry. Nat. Electron. 3, 446–459 (2020).

    Article 

    Google Scholar
     

  • Datta, S. & Das, B. Electronic analog of the electro-optic modulator. Appl. Phys. Lett. 56, 665–667 (1990).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Liu, P., Li, J., Han, J., Wan, X. & Liu, Q. Spin-group symmetry in magnetic materials with negligible spin-orbit coupling. Phys. Rev. X 12, 021016 (2022).

    CAS 

    Google Scholar
     

  • Pekar, S. I. & Rashba, É. I. Combined resonance in crystals in inhomogeneous magnetic fields. Zh. Eksperim. Teor. Fiz. 47, 1927–1930 (1964).

    CAS 

    Google Scholar
     

  • Yuan, L. D., Wang, Z., Luo, J. W., Rashba, É. I. & Zunger, A. Giant momentum-dependent spin splitting in centrosymmetric low-Z antiferromagnets. Phys. Rev. B 102, 014422 (2020).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Šmejkal, L., González-Hernández, R., Jungwirth, T. & Sinova, J. Crystal time-reversal symmetry breaking and spontaneous Hall effect in collinear antiferromagnets. Sci. Adv. 6, eaaz8809 (2020).

    Article 
    ADS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Hayami, S., Yanagi, Y. & Kusunose, H. Momentum-dependent spin splitting by collinear antiferromagnetic ordering. J. Phys. Soc. Jpn. 88, 123702 (2019).

    Article 
    ADS 

    Google Scholar
     

  • Šmejkal, L., Sinova, J. & Jungwirth, T. Beyond conventional ferromagnetism and antiferromagnetism: a phase with nonrelativistic spin and crystal rotation symmetry. Phys. Rev. X 12, 031042 (2022).


    Google Scholar
     

  • Mazin, I. I., Koepernik, K., Johannes, M. D., González-Hernández, R. & Šmejkal, L. Prediction of unconventional magnetism in doped FeSb2. Proc. Natl Acad. Sci. 118, e2108924118 (2021).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Petrovykh, D. Y. et al. Spin-dependent band structure, Fermi surface, and carrier lifetime of permalloy. Appl. Phys. Lett. 73, 3459–3461 (1998).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Rashba, É. I. & Sheka, V. I. Symmetry of energy bands in crystals of wurtzite type II. Symmetry of bands with spin-orbit interaction included. Fiz. Tverd. Tela: Collected Papers 2, 62–76 (1959).


    Google Scholar
     

  • Dresselhaus, G. Spin-orbit coupling effects in zinc blende structures. Phys. Rev. 100, 580–586 (1955).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • González-Hernández, R. et al. Efficient electrical spin splitter based on nonrelativistic collinear antiferromagnetism. Phys. Rev. Lett. 126, 127701 (2021).

    Article 
    ADS 
    PubMed 

    Google Scholar
     

  • Bose, A. et al. Tilted spin current generated by the collinear antiferromagnet ruthenium dioxide. Nat. Electron. 5, 267–274 (2022).

    Article 
    CAS 

    Google Scholar
     

  • Bai, H. et al. Observation of spin splitting torque in a collinear antiferromagnet RuO2. Phys. Rev. Lett. 128, 197202 (2022).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Karube, S. et al. Observation of spin-splitter torque in collinear antiferromagnetic RuO2. Phys. Rev. Lett. 129, 137201 (2022).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Ghosh, S., Manchon, A. & Železný, J. Unconventional robust spin-transfer torque in noncollinear antiferromagnetic junctions. Phys. Rev. Lett. 128, 097702 (2022).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Šmejkal, L., Hellenes, A. B., González-Hernández, R., Sinova, J. & Jungwirth, T. Giant and tunneling magnetoresistance in unconventional collinear antiferromagnets with nonrelativistic spin-momentum coupling. Phys. Rev. X 12, 011028 (2022).

  • Shao, D. F., Zhang, S. H., Li, M., Eom, C. B. & Tsymbal, E. Y. Spin-neutral currents for spintronics. Nat. Commun. 12, 7061 (2021).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Qin, P. et al. Room-temperature magnetoresistance in an all-antiferromagnetic tunnel junction. Nature 613, 485–489 (2023).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Chen, X. et al. Octupole-driven magnetoresistance in an antiferromagnetic tunnel junction. Nature 613, 490–495 (2023).

  • Jungwirth, T., Marti, X., Wadley, P. & Wunderlich, J. Antiferromagnetic spintronics. Nat. Nanotechnol. 11, 231–241 (2016).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Baltz, V. et al. Antiferromagnetic spintronics. Rev. Mod. Phys. 90, 015005 (2018).

    Article 
    ADS 
    MathSciNet 
    CAS 

    Google Scholar
     

  • Ren, J. et al. Enumeration and representation of spin space groups. Preprint at https://arxiv.org/abs/2307.10369 (2023).

  • Chen, X., Ren, J., Li, J., Liu, Y. & Liu, Q. Spin space group theory and unconventional magnons in collinear magnets. Preprint at https://arxiv.org/abs/2307.12366 (2023).

  • Xiao, Z., Zhao, J., Li, Y., Shindou, R. & Song, Z. D. Spin space groups: full classification and applications. Preprint at https://arxiv.org/abs/2307.10364 (2023).

  • Jiang, Y. et al. Enumeration of spin-space groups: towards a complete description of symmetries of magnetic orders. Preprint at https://arxiv.org/abs/2307.10371 (2023).

  • Brinkman, W. F. & Elliott, R. J. Theory of spin-space groups. Proc. R. Soc. A 294, 343–358 (1966).

    ADS 
    CAS 

    Google Scholar
     

  • Litvin, D. B. & Opechowski, W. Spin groups. Physica 76, 538–554 (1974).

    Article 
    ADS 
    MathSciNet 
    CAS 

    Google Scholar
     

  • Litvin, D. B. Spin point groups. Acta Cryst. A 33, 279–287 (1977).

    Article 

    Google Scholar
     

  • Yang, J., Liu, Z.-X. & Fang, C. Symmetry invariants and classes of quasi-particles in magnetically ordered systems having weak spin-orbit coupling. Preprint at https://arxiv.org/abs/2105.12738 (2021).

  • Liu, P., Zhang, A., Han, J. & Liu, Q. Chiral Dirac-like fermion in spin-orbit-free antiferromagnetic semimetals. Innovation 3, 100343 (2022).

    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Zhang, A. et al. Chiral Dirac fermion in a collinear antiferromagnet. Chin. Phys. Lett. 40, 126101 (2023).

    Article 
    ADS 

    Google Scholar
     

  • Ma, H. Y. et al. Multifunctional antiferromagnetic materials with giant piezomagnetism and noncollinear spin current. Nat. Commun. 12, 2846 (2021).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Feng, Z. et al. An anomalous Hall effect in altermagnetic ruthenium dioxide. Nat. Electron. 5, 735–743 (2022).

    Article 
    CAS 

    Google Scholar
     

  • Ghimire, N. et al. Large anomalous Hall effect in the chiral-lattice antiferromagnet CoNb3S6. Nat. Commun. 9, 3280 (2018).

    Article 
    ADS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Ishizaka, I. et al. Giant Rashba-type spin splitting in bulk BiTeI. Nat. Mater. 10, 521–526 (2011).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Šmejkal, L., Sinova, J. & Jungwirth, T. Emerging research landscape of altermagnetism. Phys. Rev. X 12, 040501 (2022).


    Google Scholar
     

  • Ji, F. et al. Multichannel exchange-scattering spin polarimetry. Phys. Rev. Lett. 116, 177601 (2016).

    Article 
    ADS 
    PubMed 

    Google Scholar
     

  • Zha, H. et al. Improvement of image-type very-low-energy-electron-diffraction spin polarimeter. Rev. Sci. Instrum. 94, 073704 (2023).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Schrunk, B. et al. Emergence of Fermi arcs due to magnetic splitting in an antiferromagnet. Nature 603, 610–615 (2022).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Liu, Y., Li, J., Liu, P. & Liu, Q. Universal theory of spin-momentum-orbital-site locking. Preprint at https://arxiv.org/abs/2306.16312 (2023).

  • Železný, J., Zhang, Y., Felser, C. & Yan, B. Spin-polarized current in noncollinear antiferromagnets. Phys. Rev. Lett. 119, 187204 (2017).

    Article 
    ADS 
    PubMed 

    Google Scholar
     

  • Zhang, Y., Železný, J., Sun, Y., van den Brink, J. & Yan, B. Spin Hall effect emerging from a noncollinear magnetic lattice without spin–orbit coupling. New J. Phys. 20, 073028 (2018).

    Article 
    ADS 

    Google Scholar
     

  • Kimata, M. et al. Magnetic and magnetic inverse spin Hall effects in a non-collinear antiferromagnet. Nature 565, 627–630 (2019).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Xu, H. C. et al. Direct observation of the bandwidth control Mott transition in the NiS2−xSex multiband system. Phys. Rev. Lett. 112, 087603 (2014).

    Article 
    ADS 

    Google Scholar
     

  • Damascelli, A., Hussain, Z. & Shen, Z. X. Angle-resolved photoemission studies of the cuprate superconductors. Rev. Mod. Phys. 75, 473–541 (2003).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Shindou, R. & Nagaosa, N. Orbital ferromagnetism and anomalous Hall effect in antiferromagnets on the distorted fcc lattice. Phys. Rev. Lett. 87, 116801 (2001).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Halperin, B. Possible states for a three-dimensional electron gas in a strong magnetic field. Jpn. J. Appl. Phys. 26, 1913–1919 (1987).

    Article 
    CAS 

    Google Scholar
     

  • Hastings, J. M., Elliott, N. & Corliss, L. M. Antiferromagnetic structures of MnS2, MnSe2, and MnTe2. Phys. Rev. 115, 13–17 (1959).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Burlet, P. et al. Noncollinear magnetic structure of MnTe2. Phys. Rev. B 56, 14013 (1997).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Yang, Y. C. et al. High-resolution ARPES endstation for in situ electronic structure investigations at SSRF. Nucl. Sci. Tech. 32, 31 (2021).

    Article 

    Google Scholar
     

  • Mitsuhashi, T. et al. Influence of k broadening on ARPES spectra of the (110) and (001) surfaces of SrVO3 films. Phys. Rev. B 94, 125148 (2016).

  • Liu, W. J. et al. Multiple surface resonance electronic spin states in the strong topological metal Zr2Te2P. Phys. Rev. B 106, 245144 (2022).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Seibel, C. et al. Photoelectron spin polarization in the Bi2Te3(0001) topological insulator: initial- and final-state effects in the photoemission process. Phys. Rev. B 93, 245150 (2016).

    Article 
    ADS 

    Google Scholar
     

  • Bentmann, H. et al. Strong linear dichroism in spin-polarized photoemission from spin-orbit-coupled surface states. Phys. Rev. Lett. 119, 106401 (2017).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Hedrich, N. et al. Nanoscale mechanics of antiferromagnetic domain walls. Nat. Phys. 17, 574–577 (2021).

    Article 
    CAS 

    Google Scholar
     

  • Casola, F., van der Sar, T. & Yacoby, A. Probing condensed matter physics with magnetometry based on nitrogen-vacancy centres in diamond. Nat. Rev. Mat. 3, 17088 (2018).

    Article 
    CAS 

    Google Scholar
     

  • Levine, E. V. et al. Principles and techniques of the quantum diamond microscope. Nanophotonics 8, 1945–1973 (2019).

    Article 
    CAS 

    Google Scholar
     

  • Perdew, J. P., Burke, K. & Ernzerhof, M. Generalized gradient approximation made simple. Phys. Rev. Lett. 77, 3865 (1996).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Blöchl, P. E. Projector augmented-wave method. Phys. Rev. B 50, 17953 (1994).

    Article 
    ADS 

    Google Scholar
     

  • Kresse, G. & Furthmüller, J. Efficient iterative schemes for ab initio total-energy calculations using a plane-wave basis set. Phys. Rev. B 54, 11169 (1996).

  • Kresse, G. & Joubert, D. From ultrasoft pseudopotentials to the projector augmented-wave method. Phys. Rev. B 59, 1758 (1999).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Monkhorst, H. J. & Park, J. D. Special points for Brillouin-zone integrations. Phys. Rev. B 13, 5188 (1976).

    Article 
    ADS 
    MathSciNet 

    Google Scholar
     

  • Anisimov, V. I., Zaanen, J. & Andersen, O. K. Band theory and Mott insulators: Hubbard U instead of Stoner I. Phys. Rev. B 44, 943 (1991).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Dudarev, S. L., Botton, G. A., Savrasov, S. Y., Humphreys, C. J. & Sutton, A. P. Electron-energy-loss spectra and the structural stability of nickel oxide: an LSDA+U study. Phys. Rev. B 57, 1505 (1998).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Herath, U. et al. PyProcar: a Python library for electronic structure pre/post-processing. Comput. Phys. Commun. 251, 107080 (2020).

    Article 
    MathSciNet 
    CAS 

    Google Scholar
     

  • Marzari, N. & Vanderbilt, D. Maximally localized generalized Wannier functions for composite energy bands. Phys. Rev. B 56, 12847 (1997).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Mostofi, A. A. et al. wannier90: a tool for obtaining maximally-localised Wannier functions. Comput. Phys. Commun. 178, 685–699 (2008).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Mostofi, A. A. et al. An updated version of wannier90: a tool for obtaining maximally-localised Wannier functions. Comput. Phys. Commun. 185, 2309–2310 (2014).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Wu, Q., Zhang, S., Song, H.-F., Troyer, M. & Soluyanov, A. A. WannierTools: an open-source software package for novel topological materials. Comput. Phys. Commun. 224, 405–416 (2018).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • [ad_2]

    Source link

  • Autonomous transposons tune their sequences to ensure somatic suppression

    [ad_1]

    Cell culture and generation of stable cell lines

    Flp-In T-REx HEK293 (Thermo Fisher Scientific, catalogue no. R78007) cells were maintained according to the manufacturer’s recommendations. Cells were cultured in DMEM with glutamax supplemented by Na-Pyruvate and High Glucose (Thermo Fisher Scientific, catalogue no. 31966-021) in the presence of 10% fetal bovine serum (FBS; Thermo Fisher Scientific, catalogue no. 10270106) and penicillin/streptomycin (Thermo Fisher Scientific, catalogue no. 15140-122). Before their introduction, transgene cells were cultured at a final concentration of 100 µg ml−1 zeocin (Thermo Fisher Scientific, catalogue no. R250-01) and 15 µg ml−1 blasticidin (Thermo Fisher Scientific, catalogue no. A1113903). For generation of stable cell lines, pOG44 (Thermo Fisher Scientific, catalogue no. V600520) was cotransfected with pcDNA5/FRT/TO (Thermo Fisher Scientific, catalogue no. V652020) containing the gene of interest at a 9:1 ratio. Cells were transfected with Lipofectamine 2000 (Thermo Fisher Scientific, catalogue no. 11668019) on a six-well-plate format with 1 µg of DNA (that is, 900 ng of pOG44 and 100 ng of pcDNA5/FRT/TO + GOI) according to the transfection protocol provided by the manufacturer. All transgenes were cloned with an N-terminal His6-biotinylation sequence-His6 tandem (HBH) tag that allows rapid and ultraclean purification without the use of antibodies. We also added a 3× FLAG tag immediately before the HBH tag to increase the versatility of the construct, which we refer to as the 3FHBH tag. Twenty-four hours following transfection, cells were split among three wells of a six-well plate at dilution ratios of 1:6, 2:6 and 3:6 to allow efficient selection of hygromycin B (Thermo Fisher Scientific, catalogue no. 10687010). Hygromycin selection was started 48 h following the transfection time point, with a final concentration of 150 µg ml−1, and refreshed every 3–4 days until control, non-transfected cells on a separate plate were totally dead. Induction of the transgene was performed overnight at a final concentration of 0.1 µg ml−1 doxycycline (DOX). Cells were validated by immunoblotting of whole-cell lysates.

    An endogenous biotin acceptor peptide affinity tag and a FLAG tag were inserted into the Safb gene locus for mouse and fly cell lines using CRISPaint. The mouse Flp-In 3T3 cell line was purchased from Thermo Fisher Scientific (catalogue no. R76107) and cultured according to the manufacturer’s instructions. Vells were cultured in DMEM (Thermo Fisher Scientific, catalogue no. 31966-021) in the presence of 10% FBS (Thermo Fisher Scientific, catalogue no. 10270106) and penicillin/streptomycin (Thermo Fisher Scientific, catalogue no. 15140-122). The Drosophila S2R+ -MT::Cas9 cell line was purchased from DGRC (DGRC stock no. 268) and cultured in S2 medium (Thermo Fisher Scientific, catalogue no. 21720024) in the presence of 10% FBS (Thermo Fisher Scientific, catalogue no. 10270106). For CRISPaint56 constructs (see Supplementary Table 2 for a list of single-guide RNAs), cells were cotransfected with three plasmids according to the CRISPaint protocol on the six-well-plate format using FuGene HD (Promega, catalogue no. E2311). Twenty-four hours following transfection, cells were expanded on 10 cm culture plates to facilitate efficient selection of puromycin (Thermo Fisher Scientific, catalogue no. A1113803). Puromycin selection is provided in the tag construct and is driven by expression from the gene locus (in this case, either the mouse or fly Safb1 gene locus). Puromycin selection was started 48 h following transfection, at 1 µg ml−1 final concentration, and was refreshed every 2 days and, in total, was maintained until all untransfected 3T3 or S2 cells were dead. Cells were validated by immunoblotting of whole-cell lysates.

    The HeLa cell line (ACC57) was purchased from Deutsche Sammlung von Mikroorganismen und Zellkulturen and maintained in the same medium as the Flp-In 3T3 cell line, but with the addition of non-essential amino acids (Thermo Fisher Scientific, catalogue no. 11140050).

    Mouse N2A cells were maintained in DMEM, and stably expressing 3× FLAG-Cas9 or 3× FLAG-SAFB1 (Extended Data Fig. 10g) was created by cotransfection of cells with plasmids expressing the protein of interest (Cas9, SAFB1 or control) under the EF1alpha promoter flanked by PiggyBack inverted repeats, together with a plasmid expressing PiggyBac transposase. In this design, because neomycin resistance was coupled to transgene expression via an IRES element, cells were selected with 1 mg ml−1 geneticin until none remained in control transfected cells.

    Cell lines (human Flp-In T-REx HEK293, human HeLa, human HCT116, mouse Flp-In 3T3, mouse N2A and fly S2R+) were all purchased from vendors or repositories or provided by colleagues (as described above), and no further authentication of cell lines was performed following purchase. Routine mycoplasma contamination tests were performed on all cell lines using the Jena Biosciences Mycoplasma (PCR-based) detection kit (Jena Biosciences, no. PP-401).

    FLASH

    Cells on 15 cm dishes were washed with 6 ml of ice-cold PBS and UV-crosslinked with 0.199 mJ cm2 UV-C light, after which they were pelleted, snap-frozen in liquid nitrogen and stored at −80 °C until use. Pellets were resuspended in 600 µl of 1× native lysis buffer (NLB) with protease inhibitors and briefly sonicated in a Bioruptor water bath sonicator (30 s on, 30 s off, five cycles at 4 °C). Lysates were then centrifuged at 20,000 relative centrifugal force (rcf) for 10 min at 4 °C to remove insoluble material. Supernatant was transferred to a fresh tube with 25 µl of MyONE C1 streptavidin beads (Thermo) and incubated in a cold room with end-to-end rotation for 1 h. Beads were washed once with high-salt buffer (HSB), once with non-denaturing buffer (NDB), treated with 0.02 U µl−1 RNase I (Thermo) in 100 µl of NDB for 3 min at 37 °C and immediately placed on ice to stop the reaction. Beads were then washed once each with HSB and NDB. RNA ends were repaired with T4 polynucleotide kinase, after which barcoded s-oligos were ligated with T4 RNA ligase 1 for 90 min at 25 °C. The 3′ phosphate at the 3′ end of each s-oligo was removed with recombinant shrimp alkaline phosphatase (NEB, M0371) and beads were washed once each with lithium dodecyl sulfate buffer, protein lysis buffer and HSB, and finally with NDB. RNA was released by treatment with proteinase K and purified using Oligo Clean and Concentrator columns (Zymo). Reverse transcription was carried out with SuperScript III and samples then treated with RNase H (NEB) to phosphorylate the 5′-end of the cDNA molecule. Following a final round of purification with Oligo Clean and Concentrator columns (Zymo), cDNA was circularized with CircLigaseII (Lucigen) and amplified with Q5 polymerase (NEB). PCR products were purified with solid-phase reversible immobilization beads, quality controlled with Bioanalyzer and subjected to high-throughput sequencing.

    FLASH data processing

    Paired-end reads were merged with bbmerge.sh v. 38.72 using the following command: bbmerge.sh in1 = {R1.fastq.gz} in2 = {R2.fastq.gz} out = {merged.fastq.gz} outu1 = {unmerged.R1.fastq.gz} outu2 = {unmerged.R2.fastq.gz} ihist = {histogram.txt} adapter1=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCAACAATCTC adapter2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGG –mininsert=1. Short inserts (below 20 nt, following removal of the unique molecular identifier (UMI) and internal index) were removed with bbduk.sh v. 38.72 bbduk.sh in = {infile} out = {out} minlen=34. The UMI was removed from reads and written to the header with UMI_tools v.1.0.0: umi_tools extract –bc-pattern=NNNXXXXXXNNNNN -I {IN.fastq.gz} -−3prime –stdout = {OUT.fastq.gz}, followed by separation of replicates with flexbar v.3.5.0: flexbar -r INPUT.fastq.gz -b barcodes.fa –barcode-trim-end RTAIL –barcode-error-rate 0.2 –zip-output GZ. Reads were aligned first to abundant RNAs such as transfer RNA, small nuclear RNA, small nucleolar RNA and ribonuclear RNA, then to the genome with bowtie2 v.2.3.5: bowtie2 –no-unal –un-gz -L 16 –very-sensitive-local -x bt2_index -U fastq_in.fastq.gz -o bam_out.bam. Unaligned reads were remapped to the genome with bbmap.sh v.38.72 to capture spliced reads: bbmap.sh -Xmx50G in = {fastq_in} out = {bam_out} outu = {unmapped_out} ref = {reference.fa} sam=1.3 mappedonly=t mdtag=t trimreaddescriptions=t nodisk. Finally, PCR duplicates were removed using UMI-tools: umi_tools dedup -I in_bam -S out_bam –spliced-is-unique –soft-clip-threshold 3 –output-stats = {stats}. Coverage files were generated with bamCoverage v.3.3.1: bamCoverage -b bam –filterRNAstrand [forward | reverse] –binSize 1 –normalizeUsing CPM –exactScaling -o out_file.

    UMAP of FLASH data

    For construction of the UMAP, peak calling was carried out on all profiles using HOMER: findPeaks {tag_directory} -style factor -strand separate -o {peaks.txt} -i {background_tag_directory}. Peaks from all profiles were then merged with: mergePeaks -strand -d given -matrix {peaks1.txt peaks2.txt …} > merged.peaks.txt. A count matrix, using all alignments from all profiles against merged peaks, was then created with featureCounts v.2.0.1: featureCounts -F SAF -Q 10 –primary -s 1 -T 12 -a {merged_peaks} -o {merged_peaks.counts.txt} {all_bam_files}. The count matrix was imported into a Jupyter notebook with pandas: peaks = pd.read_csv(“merged_peaks.counts.txt”, sep = ”\t”, index_col = ”Geneid”), scaled with sklearn.preprocessing.StardardScaler: peaks_scaled = StandardScaler().fit_transform(peaks), which was then used to create the UMAP: peaks_scaled_mapper = umap.UMAP(n_neighbors=15, random_state=42).fit(peaks_scaled), and plotted using umap.plot.points function. Clusters were called with HDBSCAN: clusterable_embedding = umap.UMAP(n_neighbors=30, min_dist=0.0, n_components=14, random_state=42).fit_transform(peaks_scaled), then hdbscan_labels = hdbscan.HDBSCAN(min_samples=100, min_cluster_size=600, core_dist_n_jobs=1).fit_predict(clusterable_embedding).

    Sample and library preparation for RNA-seq

    Flp-In T-REx HEK293 and HeLa ACC57 cells were transfected at a final concentration of 5 nM each (in the case of triple knockdown, total siRNA concentration became 15 nM and hence single-knockdown transfections were increased to 15 nM with the addition of 10 nM negative control siRNA) using Silencer Select siRNAs (Thermo Fisher Scientific, catalogue no. 4427037 for 1 nM scale) and RNAiMAX (Thermo Fisher Scientific, catalogue no. 13778030) on six-well plates (around 200,000 were used per replicate). Silencer Select siRNAs are 21 nt long, chemically modified (the exact modification is proprietary; Thermo Fisher) and reduce overall off-target effects by up to 90% without compromising potency. This modification also exaggerates strand bias, which correlates with better knockdown, and therefore they are 5- to 100-fold more potent than other siRNAs. The siRNA ID for human SAFB1 is s12452, for SAFB2 is s18599 and for SLTM is s36384. Cells were harvested on the second day of knockdown.

    The Silencer Select siRNAs used were s29362 for MPP8 was s23449 for TASOR.

    Flp-In 3T3 cells were first reverse transfected (roughly 100,000 per replicate) with 5 nM siRNA, boosted with the same amount 24 h following knockdown (forward transfected) and harvested on the third day following initial transfection. The siRNA ID for mouse Safb1 is s104978, for Safb2 is s104977 and, because the human SLTM siRNA also targets mouse mRNA, the same siRNA was used.

    Drosophila S2R+ cells (DGRC no. 150) were transfected with control dsRNA against GFP or Saf-B using FuGENE HD (Promega) for 3 days, after which cells were harvested for RNA isolation.

    Total RNA from human, mouse or Drosophila cells was extracted with the Quick-RNA MicroPrep kit (Zymo). Polyadenylated RNA was isolated from total RNA with the Dynabeads mRNA Purification Kit (Thermo). Purification was carried out twice to enrich poly(A)+ RNA. Sequencing libraries were generated using the KAPA Stranded RNA-Seq Library Preparation Kit (Roche).

    Isolation of nuclear and cytoplasmic RNA for RNA-seq

    Forty-eight hours following siRNA transfection (control or SAFB1 + SAFB2 + SLTM, 5 nM each), approximately 1 million Flp-ln T-REx HEK293 cells per replicate were trypsinized and either used directly for RNA isolation (total sample) or resuspended with a buffer containing 0.5% Igepal CA-630 to separate nuclear and cytoplasmic fractions, as described in ref. 57. Nuclear and cytoplasmic RNAs were isolated with the Quick-RNA MicroPrep kit (Zymo). Ribo-depleted RNA-seq samples were prepared using the KAPA RNA HyperPrep Kit with RiboErase (HMR) (no. KK8560, Roche).

    Transient transfections in rescue experiments and sample preparation for qPCR detection

    SAFB triple knockdown was performed on Flp-In T-REx HEK293 cells as described above, and then FuGENE HD forward transfected with WT or truncation mutants as shown in Extended Data Fig. 7f while at the same time refreshing the medium 6 h following transfection of siRNAs. Transgenes were induced on day 1 of knockdown with 0.1 µg ml−1 DOX for 24 h. On day 2 of knockdown, total RNA extracts were prepared with the Zymo Quick-RNA Kit and first-strand cDNA synthesis was carried out with PrimerScript RT Master Mix (TaKaRa, no. RR036A). Quantitative real-time PCR was performed using the oligos listed in Supplementary Table 1 with the Blue S’Green qPCR Kit (Biozym, no. 331416).

    ONT direct RNA-seq

    Isolation of polyA-enriched mRNA from Flp-ln T-REx HEK293 cells treated with either control siRNA or siRNAs against SAFB1, SAFB2 and SLTM (5 nM each) for 2 days was carried out using the Dynabeads mRNA DIRECT purification kit (Thermo Fisher Scientific) following the manufacturer’s instructions, with minor modifications. In brief, approximately 4 × 106 cells were subjected to the standard protocol and hybridization of the beads/mRNA complex was carried out for 10 min on a Mini Rotator (Grant-bio). DNA containing supernatant was removed and the beads were resuspended with 2 × 2 ml of buffer A following a second wash step with 2 × 1 ml of buffer B. Purified RNA was eluted with 10 µl of preheated elution buffer (10 mM Tris-HCl pH 7.5) for 5 min at 80 °C. Quantification of isolated mRNA was performed using a Qubit Fluorometer together with the RNA HS Assay kit (Thermo Fisher Scientific). For direct RNA-seq, 700 ng of freshly isolated polyA-enriched mRNA was processed according to the manufacturer’s protocol (no. SQK-RNA002). Final sequencing libraries were then loaded on R9.4 flow cells and sequenced on MinION and PromethION sequencers.

    Retrotransposition assay

    The transfection and experimental timeline for the retrotransposition assay was followed as described in ref. 18. Initially around 200,000 HeLa cells were transfected, with the same siRNAs and under the conditions listed above, on a six-well plate with 5 nM final concentration each of negative control, SAFB1, SAFB2 and SLTM siRNAs. The following day, knockdown HeLa cells were transfected with 200 ng of plasmids pYX015 (based on JM111, which has a point mutation in ORF1p) for background control and pYX017 (pCAG-driven L1RP) for L1 activity in triplicates, using Lipofectamine 2000 on a 48-well plate in triplicate. Twenty-four hours following reporter construct transfection, 2.5 µg ml−1 puromycin selection was started and maintained for 3 days (that is, day 5 of knockdown). Cells were washed with PBS before lysing with 40 µl of passive lysis buffer from the Dual-Luciferase Reporter Assay System (Promega, catalogue no. E1960). Half of the lysate was transferred to a 96-well, reading-compatible plate and measured using an Omega Lumistar machine.

    RNA–FISH

    FISH was carried out in HCT116 cells transfected with control versus siRNAs against SAFB1 and SLTM (no SAFB2 expression was detected in HCT116 cells) for 48 h using the Stellaris RNA–FISH kit (https://www.biosearchtech.com/assets/bti_stellaris_protocol_adherent_cell.pdf). Probes against L1Hs were synthesized by LGC Biosearch Technologies (see Supplementary Table 2 for sequences). Probes against GAPDH were sourced from LGC Biosearch Technologies (SMF-2026-1), provided by M. Bothe. Probes were used at a concentration of 125 nM and hybridized for 16 h at 37 °C. Samples were imaged using a Leica Stellaris 8 confocal microscope.

    EMSA with recombinant Halo, Halo-SAFB1RRM and Halo-TRA2BRRM

    The RNA-binding domain of TRA2B (residues 111:201) and SAFB1 (residues 386:485) were cloned into a plasmid encoding 10× His-TEV-Halo. Three constructs (Halo only, Halo-TRA2BRRM and Halo-SAFB1RRM) were then expressed using BL21-CodonPlus(DE3)-RIL bacteria, which were induced when an optical density of roughly 0.6 was reached, with 0.2 mM isopropyl-ß-d-thiogalactopyranoside for 4 h at 37 °C, then collected by centrifugation. Bacteria were resuspended with lysis buffer (50 mM HEPES pH 8.0, 300 mM NaCl, 5 mM imidazole and 0.05% Igepal CA-630) and disrupted with a Branson sonifier, clarified by centrifugation and filtered through a 0.45 µm membrane. Cleared lysates were incubated with cOmplete His-Tag Purification Resin (Roche), washed extensively with lysis buffer and incubated with 0.5 µM OregonGreen (Promega) on beads in lysis buffer at room temperature for 30 min for fluorescent labelling of proteins. Beads were first washed extensively with lysis buffer, then with high-salt wash buffer (50 mM Tris.Cl pH 8.0, 1 M NaCl, 5 mM imidazole) and lastly with lysis buffer. Proteins were eluted with elution buffer (50 mM Tris.Cl pH 8.0, 100 mM KCl, 200 mM imidazole). Eluates were pooled, dithiothreitol (DTT, 1 mM final concentration) and TEV protease (home-made, 6× His-tagged, approximately 1:100) were added and samples dialysed against 25 mM Tris.Cl pH 7.4, 50 mM KCl, 5% glycerol and 1 mM DTT overnight in a cold room (about 8 °C). Dialysed eluates were then incubated with cOmplete His-Tag Purification Resin (Roche) for removal of TEV protease and undigested proteins, and flowthrough was centrifuged at 23,000 rcf for 30 min and filtered through a 0.22 µm membrane to remove particulate matter. The UV spectra showed no significant absorption at 260 nm and were used to quantify purified proteins, which were then normalized and their quality checked with PAGE and Coomassie staining (Fig. 4a). Concentrations used in EMSAs were: Halo-TRA2BRRM (lanes 2–6: 3.6, 7.2, 14.4, 57.6 and 102.4 µM, respectively); Halo-SAFBRRM (lanes 7–11: 3.6, 7.2, 14.4, 57.6 and 102.4 µM, respectively); and Halo (lane 12: 102.4 µM). Lane 1 contained only those probes with no added protein.

    The RNA probes were prepared by in vitro transcription. Briefly, a plasmid containing the relevant sequence TAATACGACTCACTATAGGGAAGAAGAAGAAGAAGAAGAAGAT^ATC, in which the T7 promoter sequence is underlined, was digested with EcoRV (site of digestion, indicating that the last nucleotide of the final RNA is marked—indicated by ^), purified and in vitro transcribed using a HighYield T7 RNA Synthesis Kit (Jena Biosciences, no. RNT-101) with either 1 mM (final) CTP/UTP/GTP/ATP or 1 mM CTP/UTP/GTP and 1 mM N6-Methyl-ATP (Jena Biosciences, no. RNT-112-S), completely replacing ATP. RNA was cleaned up using SPRI beads to remove the plasmid and other potential high-molecular-weight products, then with the OCC-5 kit (Zymo). RNA was then oxidized using freshly prepared sodium periodate (250 mM in water, final concentration 10 mM; Sigma, no. 311448) in 60 mM NaOAc pH 5.5 for 1 h on ice, with tubes kept in the dark. After a further clean-up with OCC-5, RNA was then labelled with CF 647 Hydrazide (Sigma, no. SCJ4600046; 10 mM in water, 0.8 mM final concentration in approximately 120 mM NaOAc, pH 5.5) at room temperature overnight. RNA was purified with OCC-5, eluted in water and normalized to 5 µM. EMSAs were carried out in 25 mM Tris.Cl pH 7.4, 50 mM KCl, 5% glycerol and 1 mM DTT with an RNA probe of around 100 nM and the indicated concentration of the protein of interest. Following incubation of RNA and proteins on ice for 30 min, mixtures were loaded directly on a Nature 8% polyacrylamide gel cast with 0.5× Tris-borate-EDTA (final) and run in 0.5× Tris-borate-EDTA in a cold room for 45 min at 100 V (gels were prerun at 100 V for 15 min). Proteins and RNA were sequentially visualized on the same gel using a Typhoon Scanner with appropriate excitation lasers and emission filters.

    In vitro unmethylated and methylated RNA-binding assay

    Nuclei were isolated from wt-HCT116 cells using a buffer containing 0.5% Igepal CA-630, following Lubelsky and Ulitsky57, and snap-frozen in liquid nitrogen until use. Nuclei were resuspended with 500 µl of 25 mM Tris.Cl pH 7.4, 150 mM KCl, 2 mM MgCl2, 0.5% Igepal CA-630, 5% glycerol, 5 mM β-mercaptoethanol, 1× protease inhibitors and 1× PhosSTOP and sonicated with a Branson sonifier. Next, 15 µl of TURBO-DNase was added followed by incubation at 25 °C for 20 min and then by the slow addition to the lysate of 1.5 m of base buffer (25 mM Tris.Cl pH 7.4, 50 mM KCl, 5% glycerol) to bring the KCl concentration to 75 mM and Igepal CA-630 concentration to 0.125% (final). Lysate was incubated with 50 µl of Pierce Control Agarose Resin (no. 26150) for 20 min, with rotation in a cold room, and spun down at full speed for 10 min at 4 °C to remove insoluble material. A 949 bp fragment of L1 ORF2 was amplified from pYX017 using primers AATAATACGACTCACTATAGCGTATCACCACCGATCCCACAG (T7 promoter underlined) and GGCTGAGACGATGGGGTTTT and in vitro transcribed using a HighYield T7 RNA Synthesis Kit (Jena Biosciences, no. RNT-101) with either 1 mM (final) CTP/UTP/GTP/ATP or 1 mM CTP/UTP/GTP and 1 mM N6-methyl-ATP (Jena Biosciences, no. RNT-112-S), completely replacing ATP. RQ1 DNase (Promega) was added to each reaction with incubation for for 20 min at 37 °C, after which RNA was cleaned up using RCC-25 (Zymo) and oxidized with freshly prepared sodium periodate (250 mM in water, final concentration 10 mM; Sigma, no. 311448) in 60 mM NaOAc pH 5.5 for 1 h on ice, with tubes kept in the dark. After a further clean-up with RCC-25, RNA was then labelled with biotin Hydrazide (Sigma, no. 87639; 50 mM in DMSO, 2 mM final concentration in approximately 120 mM NaOAc, pH 5.5) at room temperature overnight. RNA was purified with RCC-25, eluted in water and quantified with Nanodrop, then 5 µg of each RNA or buffer was incubated with 25 µl of MyONE C1 streptavidin beads in base buffer + 0.1% Igepal CA-630 for 1 h at room temperature and washed twice with base buffer + 0.1% Igepal CA-630. The nuclear lysate was incubated with these beads for 1 h at 16 °C, with shaking at 1,100 rpm. Beads were washed and transferred from fresh tubes with base buffer + 0.1% Igepal CA-630. Proteins bound to the beads were eluted with base buffer + 0.1% Igepal CA-630 + 2 µl of RNaseA + T1 (no. EN0551, Thermo Fisher Scientific) for 30 min at 30 °C and demonstrated by immunoblotting.

    RNA blotting

    HCT116 cells were transfected with 5 nM siRNA (as indicated in Fig. 2h) then, 48 h later, were either transfected with a plasmid encoding L1Hs and driven by a minimal EF1alpha (without an intron) promoter or mock transfected. Twenty-four hours later (72 h post siRNA transfection), cells were trypsinized and resuspended with a buffer containing 0.5% Igepal CA-630, essentially as described in ref. 57. The cytoplasmic fraction was purified with RNA Clean & Concentrator columns (Zymo), 2 µg of which was loaded onto 1.2% agarose gel and electroblotted to a nylon membrane. DIG-labelled probes against ORF2 were prepared with in vitro transcription (see Supplementary Table 2 for primers) and probe hybridization, washes and imumunodetection were carried out as described in the manual of the DIG Northern Starter Kit (Roche, no. 12 039 672 910).

    p-SR (1H4) and DHX9 FLASH in SAFB-depleted cells

    Flp-In T-REx HEK293 cells were transfected with either control siRNA or siRNAs against SAFB1, SAFB2 and SLTM 48 h following transfection, then washed with PBS and UV-crosslinked with 0.2 mJ cm2 UV-C light on ice. Nuclei were isolated as described in ref. 57, resuspended in 1× NLB + 5 mM MgCl2 with protease and phosphatase inhibitors and sonicated using a Branson sonifier. Following centrifugation, to remove insoluble material the supernatant was incubated with an agarose resin (Pierce, no. 26150) for 20 min in a cold room followed by further incubation with Dynabeads Protein G beads prebound to p-SR antibody (10 µl per IP; 1H4, Santa Cruz, no. sc-13509) for 90 min in a cold room. The supernatant from 1H4 IP was used for DHX9 IP (2.5 µl per IP; abcam, no. ab26271). The FLASH protocol was identical to that described above, except that all HSB washes were replaced with NLB and s-oligos were pre-dephosphorylated to skip the recombinant shrimp alkaline phosphatase treatment that could dephosphorylate SR proteins on the beads, potentially leading to their elution.

    RIP–qPCR

    Flp-In T-REx HEK293 cells were crosslinked with 0.2% formaldeyhde for 10 min at room temperature, extensively washed with PBS, resuspended with 1× NLB and sonicated using a Branson sonifier. The lysate was centrifuged at 23,000 rcf for 10 min at 4 °C to remove insoluble material and the supernatant then incubated with an agarose resin (Pierce, no. 26150) for 30 min in a cold room. Following brief centrifugation, the supernatant was used for IP with Dynabeads Protein G beads coupled to either an antibody against SAFB1 (10 µl per IP; Santa Cruz, no. sc-393403) or control IgG (Santa Cruz, no. sc-2025) overnight in a cold room. Beads were washed with 1× NLB and bead-bound RNA was eluted with proteinase K, as described above, purified using RCC-5 (Zymo) and utilized for RT–qPCR.

    Generation of the Dnmt3c-null allele

    Dnmt3C knockout animals were generated as described in ref. 58. For specific abolition of enzymatic activity we designed a sgRNA against the methyltransferase domain of Dnmt3C targeted to exon 15 with the following protospacer sequence: 5′-GGACATCTCACGATTCCTGG-3′. P0 animals were genotyped using Sanger sequencing following PCR with primers 5′-CTGGCCGGCTCTTCTTTGAG-3′ and 5′-GGAAATCATTCCCACCTGTCAGC-3′. The founding animal was chosen based on a 31 bp deletion, which resulted not only in a frameshift mutation beginning at codon 598 but simultaneous removal of a PfoI restriction enzyme digestion site for straightforward genotyping. The founder mutation was subsequently backcrossed into the C57BL/6 J background. Homozygous knockout males were validated as infertile, with significantly smaller and disordered testes by P42, as reported previously51. The generation of these experimental animals was regulated following ethical review by Yale University Institutional Animal Care and Use Committee (protocol no. 2020-20357) and was performed according to governmental and public health service requirements. No sample size selection, randomization or blinding was performed.

    Direct antibody labelling

    The Mix-n-Stain CF488 A Antibody Labelling Kit (Biotium, no. 92253) and Mix-n-Stain CF555 Antibody Labelling Kit (Biotium, no. 92254) were used to label rabbit antihuman SAFB1/SAFB antibody (LSBio, LS-C286411) and rabbit anti-LINE-1-ORF1p antibody (abcam, no. ab216324), respectively. The standard protocol listed on the product website was followed, including the ultrafiltration protocol, with minor modifications. In brief, 25–35 μg of antibody was placed in the ultrafiltration vial provided and centrifuged at 14,000g for 2 min to remove all liquid. Depending on the initial amount of antibody, antibodies were eluted in 1× PBS to a final concentration of 0.75 ng μl−1 and the appropriate volume of 10X Mix-n-Stain Reaction Buffer added. The entire solution was transferred to the vial containing the dye and the labelling reaction allowed to proceed at room temperature (22–23 °C) in the dark for 30 min. Finally, 150 μl of storage buffer was added to each reaction with storage in aliquots of 50 μl at −20 °C until use.

    Testis sectioning and Immunofluorescence microscopy

    Testes from P25 Dnmt3C homozygous and heterozygous mutant males were dissected and embedded in O.C.T. compound (Tissue-Tek). Using cryosectioning, 8 μm sections were obtained with a Leica CM3050S and spotted onto Fisherbrand Superfrost Plus Microscope Slides (Fisher Scientific, no. 12-550-15) and stored at −80 °C until use. For immunofluorescence detection, slides were thawed at room temperature for over 10 min before fixing in 4% paraformaldehyde for 8 min. Permeabilization and blocking were performed at room temperature for 1 h with blocking buffer (5% bovine serum albumin (BSA), 0.2% Triton X-100 and PBS). Sections were incubated with directly labelled antibodies overnight at 4 °C, followed by three 5 min washes in 1× PBS and mounting with VECTASHIELD PLUS Antifade Mounting Medium and DAPI (Vector Laboratories, no. H-2000). Images were acquired using a Leica THUNDER Imaging System at ×40 magnification.

    Mass spectrometry

    Flp-In T-REx HEK293 cells stably expressing SAFB1, SAFB2 or SLTM (same cell lines used for FLASH) were induced with 0.1 µg ml−1 DOX for 16 h in triplicate, lightly crosslinked with formaldehyde (0.016% final) at room temperature for 10 min, extensively washed with PBS, resuspended with HMGT-K200 buffer (25 mM HEPES-KOH pH 7.4, 10 mM MgCl2, 10% glycerol, 0.2% Tween-20) and homogenized using a water bath sonicator. Following centrifugation, supernatants were then incubated with MyONE C1 streptavidin beads to pull down proteins of interest. Beads were washed with HMGT-K200, 20 mM Tris-Cl pH 7.4 and 1 M NaCl and finally with 20 mM Tris-Cl pH 7.4 and 50 mM NaCl, then submitted to the in-house MS-facility for further processing. Silver gel staining was performed using a SilverQuest Silver Staining Kit (Thermo Fisher Scientific, no. LC6070) for SAFB1 to ensure that conditions were sufficiently stringent in comparison with GFP pulldown (Extended Data Fig. 7b).

    On-beads digest and mass spectrometry analysis

    Twelve samples were boiled at 95 °C and 500 rpm for 10 min, followed by tryptic digest including reduction and alkylation of cysteines. The reduction was performed by the addition of tris(2-carboxyethyl)phosphine at a final concentration of 5.5 mM at 37 °C on a rocking platform (500 rpm) for 30 min. To perform alkylation, chloroacetamide was added at a final concentration of 24 mM at room temperature on a rocking platform (500 rpm) for 30 min. Proteins were then digested with 200 ng of trypsin (Roche) per sample, shaking at 800 rpm and 37 °C for 18 h. Samples were acidified by the addition of 1.3 µl of 100% formic acid (2% final concentration), centrifuged and placed on a magnetic rack. Supernatants containing the digested peptides were transferred to a new low-protein-binding tube. Peptide desalting was performed on self-packed C18 columns in a Tip. Eluates were lyophilized and reconstituted in 19 µl of 5% acetonitrile and 2% formic acid in water, briefly vortexed and sonicated in a water bath for 30 s before injection into nano-liquid chromatography–tandem mass spectrometry (nano-LC–MS/MS).

    LC–MS/MS instrument settings for shotgun proteome profiling and data analysis

    LC–MS/MS was carried out by nanoflow reverse-phase liquid chromatography (Dionex Ultimate 3000, Thermo Scientific) coupled online to a Q-Exactive HF Orbitrap mass spectrometer (Thermo Scientific), as reported previously59. In brief, LC separation was performed using a PicoFrit analytical column (75 μm internal diameter × 50 cm length, 15 µm Tip ID; New Objectives) and packed in house with 3 µm of C18 resin (Reprosil-AQ Pur, Dr Maisch). Peptides were eluted using a gradient from 3.8 to 38% solvent B in solvent A over 120 min at a flow rate of 266 nl min−1. Solvent A was 0.1% formic acid and solvent B comprised 79.9% acetonitrile, 20% H2O and 0.1% formic acid. Nanoelectrospray was generated by the application of 3.5 kV. A cycle of one full Fourier transformation scan mass spectrum (300–1,750 m/z, resolution 60,000 at m/z 200, automatic gain control target 1 × 106) was followed by 12 data-dependent MS/MS scans (resolution of 30,000, automatic gain control target 5 × 105) with a normalized collision energy of 25 eV. To avoid repeated sequencing of the same peptides, a dynamic exclusion window of 30 s was used.

    Raw MS data were processed with MaxQuant software (v.1.6.17.0) and searched against the human proteome database UniProtKB UP000005640 (containing 75,074 protein entries, released May 2020). The parameters of MaxQuant database searching were a false discovery rate of 0.01 for proteins and peptides, a minimum peptide length of seven amino acids, a first-search mass tolerance for peptides of 20 ppm and a main search tolerance of 4.5 ppm. A maximum of two missed cleavages was allowed for the tryptic digest. Cysteine carbamidomethylation was set as a fixed modification whereas N-terminal acetylation and methionine oxidation were set as variable modifications. The MaxQuant-processed output files can be found in Supplementary Table 3, showing peptide and protein identification, accession numbers, percentage sequence coverage of the protein and q-values.

    IP

    Native whole-cell extracts prepared using 0.5× NLB were incubated with ProtG Dynabeads (Life Technologies, no. 10004D) coupled to 1 μg of either SAFB antibody (‘Antibodies’) or IgG (mouse; Santa Cruz, no. sc-2025) in a cold room for 150 min. Beads were washed twice in 0.5× NLB for 5 min then once with NDB. RNase-treated samples were resuspended in 90 µl of NDB to which 10 µl of RNaseA + T1 mix (Thermo Scientific, no EN0551) was added. Samples were then incubated at 20 °C for 15 min and washed twice with 0.5× NLB. Elution from the beads was performed in 1× protein-loading dye by incubation for 5 min at 95 °C with shaking. Interaction partners were detected using the antibodies against proteins shown in Extended Data Fig. 7 (‘Antibodies’).

    Immunofluorescence

    Cells were crosslinked with 4% methanol-free formaldehyde in PBS at room temperature for 10 min, permeabilized with 0.5% Triton X for 10 min then blocked with 5% BSA in PBS for 30 min at room temperature. Primary antibodies (further details in ‘Antibodies’) were diluted in PBS with 0.1% Triton X and 1% BSA and incubated with fixed cells at 4 °C for about 16 h. Fluorescently labelled secondary antibodies with the appropriate serotype were used to demonstrate target proteins. Hoechst 33342 was used to stain DNA.

    Antibodies

    The following antibodies were used: AFB1 (Santa Cruz, no. sc-393403), SAFB2 (Santa Cruz, no. sc-514963), SAFB1/2 (HET) (human: Merck/Sigma-Aldrich, no. sc05-588; mouse: LSBio, no. LS-C2886411), SLTM (Invitrogen, no. PA5-59154), ORF1p (human: abcam, no. ab230966; mouse: abcam, no. ab216324), TASOR (Sigma-Aldrich, no. HPA006735), 1H4 (p-SR) (Merck/Sigma-Aldrich, no. MABE50), RBM12B (Bethyl, no. A305-871A-T), RBMX (Cell Signaling Technology, no. 14794 S), NCOA5 (Bethyl, no. A300-790A-T), ZNF638 (Sigma-Aldrich, no. ZRB1186), ZNF326 (Santa Cruz, no. sc-390606), TRA2B (Bethyl, no. A305-011A-M), U2AF2 (U2AF65; Santa Cruz, no. sc-53942), TUBULIN (Santa Cruz, no. sc-32293), SRRM1 (abcam, no. ab221061), SRRM2 (SC35) (Sigma-Aldrich, no. S4045), SON (Sigma-Aldrich, no. HPA023535), DHX9 (abcam, no. ab183731), U1-70K (SySy, no. 203011), PRP8 (Santa Cruz, no. sc-55533), RNAPII (Creative Biolabs, no. CBMAB-XB0938-YC), IgG normal mouse (Santa Cruz, no. sc-2025), SRSF1 (Santa Cruz, no. sc-33652), SRSF2 (abcam, no. ab204916), SRSF3 (Elabscience, no. E-AB-32966), SRSF7 (MBL, no. RN079PW), RB1 (Cell Signaling Technology, no. 9309 S), TRA2B (Santa Cruz, no. sc-166829) and YTHDC1 (Proteintech, no. 14392-1-AP).

    TE expression analysis

    RNA-seq data from human (HEK293, HeLa, HCT116), mouse (3T3) and Drosophila (S2) cells were mapped to their respective genome (hg38, mm10 and dm6, respectively) using the snakePipes non-coding-RNA-seq pipeline60. Internally this pipeline uses TEtranscripts23, which estimates both gene and TE transcript abundance in RNA-seq data and conducts differential expression analysis on the resultant count tables, which is carried out by DESeq2 (ref. 61). The outputs of this analysis can be found in Supplementary Tables 4–11.

    SAFB peak annotation and TE enrichment

    Overlapping SAFB1, SAFB2 and SLTM regions called by HOMER on FLASH data were merged using the function IRanges::reduce(), resulting in a single set of 29,806 SAFB-bound genomic intervals (SAFB peaks), 23,136 of which were located inside GENCODE-annotated genes (within-gene SAFB peaks). All GENCODE v.29 genes located on standard chromosomes were used as a control set (n = 58,721). repeatMasker annotation was downloaded from the UCSC genome browser, and the fraction of total length contributed by different transposable elements was calculated for 23,136 SAFB peaks and 58,721 GENCODE-annotated genes, separately for TEs inserted in sense and antisense orientation. Enrichment was calculated for a subset of sense and antisense TEs by dividing the TE fraction in peaks (that is, observed TE fraction) by that in whole genes (that is, fraction expected if SAFB peaks were distributed randomly on transcripts), followed by log2-transformation of values.

    Short-read RNA-seq data analysis

    Raw RNA-seq reads were subject to adaptor and quality trimming using cutadapt 4.1. Default options were used, except for -q 16 –trim-n -m 25 -a AGATCGGAAGAGC -A AGATCGGAAGAGC.

    Trimmed reads from human and mouse cell lines were mapped to human GRCh38 (HEK293, HeLa and HCT116 cell lines) and mouse GRCm38 (3T3 cell line) genomes using the STAR 2.7.9a aligner62. To improve the sensitivity of spliced read detection and quantification, mapping was done in two passes. In the first pass, all reads were mapped simultaneously to the STAR genome index built with GENCODE gene models (v.29 for human, v.19 for mouse) using default options, with the exception of –outFilterMismatchNoverReadLmax 0.05 –outSAMtype None. In the second pass, each sequenced library was mapped to a genome index with GENCODE gene models extended with new splice junctions detected in the first pass (–sjdbFileChrStartEnd pass1.SJ.out.tab). Other non-default STAR options used included –outFilterMismatchNoverReadLmax 0.05 –quantMode GeneCounts –alignIntronMax 1000000 –alignMatesGapMax 2000000 –sjdbOverhang 100 –limitSjdbInsertNsj 2000000.

    Trimmed reads from the fruitfly S2 cell line were mapped to the dm6 genome assembly using STAR 2.7.4a, and reads were counted using featureCounts (subread package v.2.0.0).

    Differential gene expression

    Differential gene expression analysis was performed using the DESeq2 package61 on reverse-stranded gene counts from the STAR alignment step. Genes with fewer than ten mapped reads were discarded; lfcThreshold = 1 and alpha = 0.05 were used for calling of differentially expressed genes, and results were shrunk using lfcShrink(…, type = “ashr”).

    Differential exon usage

    To avoid assignment of exonic reads to SAFB peaks, within-gene SAFB peak fragments or entire peaks overlapping GENCODE v.29-annotated exons were masked and ignored in exon usage analysis. The 22,129 peaks remaining (intronic SAFB peaks) were assigned to their host genes and RNA-seq reads were counted on both annotated exons and intronic SAFB peaks using the function Rsubread::featureCounts() with default arguments, except for countMultiMappingReads = FALSE, strandSpecific = 2, juncCounts = TRUE, and isPairedEnd = TRUE. Differentially expressed SAFB peaks were identified using the DEXSeq R package63 and, for each gene, the peak with the lowest DEXSeq P value was used as a reference for gene fragmentation. In total, 5,394 affected genes were fragmented into pre- and post-peak parts. Exonic read counts were aggregated separately for pre- and post-peak fragments and their differential expression measured using DESeq. Genes hosting SAFB peaks with DEXSeq Padjusted < 0.05 and log-fold change above 2 were classified as (genes with) upregulated peaks (n = 878) whereas those hosting peaks with DEXSeq Padjusted > 0.05 and log-fold change between −0.5 and 0.5 were used as the control set (n = 1,457).

    Differential splice junction usage

    The number of RNA-seq reads supporting each splice junction was counted in the second STAR alignment pass (SJ.out.tab file). Splice junctions that could not be unambiguously assigned a host gene, or that were supported by fewer than ten reads in total across all treatments and replicates in a given cell line, were ignored. Differentially used splice junctions were identified using DEXSeq, with default settings; splice junctions were treated as feature IDs and host genes as group IDs.

    Splice site strength quantification

    For each gene in the human genome, the probability of each nucleotide acting as a splice donor or acceptor was estimated using SpliceAI26, with default options. SpliceAI scores were matched to splice junctions detected and quantified by STAR.

    Splice site to TE distance measurement

    Distances between splice sites and nearest upstream or downstream TEs were calculated for a set of ten repeat families (L1, L2, Alu, SVA, ERVL, ERV1, TcMar-Tigger, MIR, Simple_repeat, hAT_Charlie) as follows: (1) all GENCODE genes were flattened using the function IRanges::reduce() in R; (2) STAR-detected splice junctions and repetitive elements outside annotated genes were dropped; and (3) for each remaining splice donor and acceptor, the distance (in nucleotides) to the nearest sense or antisense TE within the same flattened gene was measured separately for each of the ten repeat families. Donors and acceptors within TEs were assigned the distance of 0 nt.

    New splice acceptors within SAFB peaks in human tissues

    The number of reads supporting splice junctions in the GTEx consortium tissue data was extracted using the recount3 R package64. Tissues with fewer than 1 billion spliced reads were excluded from further analysis. Alternative splicing was quantified in an intron-centric manner—that is, splicing index was calculated separately for each splice donor and acceptor. We extracted all splice junctions located within an annotated human gene, with splice donor annotated in GENCODE v.29 and splice acceptor sited within a fully intronic SAFB peak (npeaks = 16,929). A further 21,693 such splice junctions were filtered for junction where the donor participated in multiple events, had a splicing index above 1% in at least one tissue and was supported by at least 500 reads in all 27 tissues (that is, used ubiquitously), resulting in a highly stringent set of of 1,104 splice junctions.

    p-SR and DHX9 FLASH analysis

    FLASH reads uniquely mapping to the hg38 genome were counted using featureCounts on two custom gene annotation reference sets. The first of these contained exons and SAFB peaks, with exons prioritized over SAFB peaks in the case of overlaps. SAFB peaks were assigned to their host genes and treated as exons for read counting. The second reference contained genes fully fragmented into exons, repetitive elements and introns, with exons prioritized over repeats and introns, and repeats prioritized over introns where their genomic coordinates were overlapping. Whereas the first reference allows for increased sensitivity when quantifying FLASH signal on known SAFB-binding regions, the latter sacrifices sensitivity (because it contains many short genomic fragments) for the power of recognizing regions of increased binding outside of SAFB peaks, or in SAFB peaks not called by the peak-calling software. DEXSeq analysis was performed separately on exon/peak and exon/repeat/intron counts. Regions with adjusted P < 0.05 were considered differentially bound.

    Alternative polyadenylation sites

    Aligned ONT direct RNA-seq performed on control and triple KD samples was screened for their end coordinates, under the assumption that these are derived from the close proximity of a polyadenylation site. Genomic coordinates of this collection of almost 1.5 million single-nucleotide-resolution read end sites were extended by 50 nt upstream and downstream, and overlapping intervals were collapsed into a total of 274,330 putative polyadenylation regions. The number of control and triple KD reads ending in each of these regions was counted and, for each gene, the fraction of ONT reads ending in each of its polyadenylation regions was calculated separately for control and triple KD libraries. Genes supported by at least 20 reads in which the contribution of at least one polyA isoform was changed by at least 20 percentage points between triple KD and control were considered differentially polyadenylated. In total, 14,148 genes (4,433 of genomic length over 50 kb) were supported by 20 or more reads, and 247 (231 longer than 50 kb) showed differential polyA site usage.

    Locus-specific L1 quantification

    Raw reads from HEK293 fractionation RNA-seq libraries were aligned to the hg38 genome using bwa aln, and alignments further processed with L1EM65, both with default options. L1EM counts from categories ‘only’, ‘3prunon’ and ‘passive_sense’ were summed. These total read counts were combined with read counts on individual genes (GENCODE v.29 annotation), and DESeq2 differential gene expression analysis was performed together on gene and L1 counts, treating L1 elements as independent genes.

    Reporting summary

    Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

    [ad_2]

    Source link

  • Bone marrow plasma cells require P2RX4 to sense extracellular ATP

    [ad_1]

  • Radbruch, A. et al. Competence and competition: the challenge of becoming a long-lived plasma cell. Nat. Rev. Immunol. 6, 741–750 (2006).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Jarvis, M. F. & Khakh, B. S. ATP-gated P2X cation-channels. Neuropharmacology 56, 208–215 (2009).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Borges da Silva, H. et al. The purinergic receptor P2RX7 directs metabolic fitness of long-lived memory CD8(+) T cells. Nature 559, 264–268 (2018).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Burnstock, G. P2X ion channel receptors and inflammation. Purinergic Signal. 12, 59–67 (2016).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Ishikawa, M. et al. Pannexin 3 functions as an ER Ca(2+) channel, hemichannel and gap junction to promote osteoblast differentiation. J. Cell Biol. 193, 1257–1274 (2011).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Ishikawa, M. et al. Pannexin 3 and connexin 43 modulate skeletal development through their distinct functions and expression patterns. J. Cell Sci. 129, 1018–1030 (2016).

    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Wilmore, J. R., Jones, D. D. & Allman, D. Protocol for improved resolution of plasma cell subpopulations by flow cytometry. Eur. J. Immunol. 47, 1386–1388 (2017).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Jones, D. D. et al. mTOR has distinct functions in generating versus sustaining humoral immunity. J. Clin. Invest. 126, 4250–4261 (2016).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Cassese, G. et al. Plasma cell survival is mediated by synergistic effects of cytokines and adhesion-dependent signals. J. Immunol. 171, 1684–1690 (2003).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Burnstock, G. Purine and pyrimidine receptors. Cell. Mol. Life Sci. 64, 1471–1483 (2007).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Hohenegger, M. et al. Gsalpha-selective G protein antagonists. Proc. Natl Acad. Sci. USA 95, 346–351 (1998).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Jones, C. A. et al. Functional characterization of the P2X(4) receptor orthologues. Br. J. Pharmacol. 129, 388–394 (2000).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Heng, T. S., Painter, M. W. & The Immunological Genome Project Consortium. The Immunological Genome Project: networks of gene expression in immune cells. Nat. Immunol. 9, 1091–1094 (2008).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Tabula Sapiens Consortium. The tabula sapiens: a multiple-organ, single-cell transcriptomic atlas of humans. Science 376, eabl4896 (2022).

    Article 

    Google Scholar
     

  • Hobeika, E. et al. Testing gene function early in the B cell lineage in mb1-cre mice. Proc. Natl Acad. Sci. USA 103, 13789–13794 (2006).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Khalil, A. M., Cambier, J. C. & Shlomchik, M. J. B cell receptor signal transduction in the GC is short-circuited by high phosphatase activity. Science 336, 1178–1181 (2012).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Ahuja, A., Anderson, S. M., Khalil, A. & Shlomchik, M. J. Maintenance of the plasma cell pool is independent of memory B cells. Proc. Natl Acad. Sci. USA 105, 4802–4807 (2008).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Yannoutsos, N. et al. A cis element in the recombination activating gene locus regulates gene expression by counteracting a distant silencer. Nat. Immunol. 5, 443–450 (2004).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Hoyer, B. F. et al. Short-lived plasmablasts and long-lived plasma cells contribute to chronic humoral autoimmunity in NZB/W mice. J. Exp. Med. 199, 1577–1584 (2004).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Morris, S. C., Cheek, R. L., Cohen, P. L. & Eisenberg, R. A. Autoantibodies in chronic graft versus host result from cognate T–B interactions. J. Exp. Med. 171, 503–517 (1990).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Koshimizu, T. A. et al. Characterization of calcium signaling by purinergic receptor-channels expressed in excitable cells. Mol. Pharmacol. 58, 936–945 (2000).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Bettigole, S. E. & Glimcher, L. H. Endoplasmic reticulum stress in immunity. Annu. Rev. Immunol. 33, 107–138 (2015).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Han, J. et al. ER-stress-induced transcriptional regulation increases protein synthesis leading to cell death. Nat. Cell Biol. 15, 481–490 (2013).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Puthalakath, H. et al. ER stress triggers apoptosis by activating BH3-only protein Bim. Cell 129, 1337–1349 (2007).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Wilmore, J. R. & Allman, D. Here, there and anywhere? Arguments for and against the physical plasma cell survival niche. J. Immunol. 199, 839–845 (2017).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Robinson, M. J. et al. Intrinsically determined turnover underlies broad heterogeneity in plasma-cell lifespan. Immunity 56, 1596–1612 (2023).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Benson, M. J. et al. Cutting edge: the dependence of plasma cells and independence of memory B cells on BAFF and APRIL. J. Immunol. 180, 3655–3659 (2008).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • O’Connor, B. P. et al. BCMA is essential for the survival of long-lived bone marrow plasma cells. J. Exp. Med. 199, 91–98 (2004).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Peperzak, V. et al. Mcl-1 is essential for the survival of plasma cells. Nat. Immunol. 14, 290–297 (2013).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Nikbakht, N., Migone, T. S., Ward, C. P. & Manser, T. Cellular competition independent of BAFF/B lymphocyte stimulator results in low frequency of an autoreactive clonotype in mature polyclonal B cell compartments. J. Immunol. 187, 37–46 (2011).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Vincent, F. B., Saulep-Easton, D., Figgett, W. A., Fairfax, K. A. & Mackay, F. The BAFF/APRIL system: emerging functions beyond B cell biology and autoimmunity. Cytokine Growth Factor Rev. 24, 203–215 (2013).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Mariathasan, S. et al. Cryopyrin activates the inflammasome in response to toxins and ATP. Nature 440, 228–232 (2006).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Suurvali, J., Boudinot, P., Kanellopoulos, J. & Ruutel Boudinot, S. P2X4: a fast and sensitive purinergic receptor. Biomed. J. 40, 245–256 (2017).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Fujisaki, J. et al. In vivo imaging of Treg cells providing immune privilege to the haematopoietic stem-cell niche. Nature 474, 216–219 (2011).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Glatman Zaretsky, A. et al. T regulatory cells support plasma cell populations in the bone marrow. Cell Rep. 18, 1906–1916 (2017).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Zinszner, H. et al. CHOP is implicated in programmed cell death in response to impaired function of the endoplasmic reticulum. Genes Dev. 12, 982–995 (1998).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Tellier, J. et al. Blimp-1 controls plasma cell function through the regulation of immunoglobulin secretion and the unfolded protein response. Nat. Immunol. 17, 323–330 (2016).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Slifka, M. K., Antia, R., Whitmire, J. K. & Ahmed, R. Humoral immunity due to long-lived plasma cells. Immunity 8, 363–372 (1998).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Raje, N. et al. Anti-BCMA CAR T-cell therapy bb2121 in relapsed or refractory multiple myeloma. N. Engl. J. Med. 380, 1726–1737 (2019).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Seckinger, A. et al. Target expression, generation, preclinical activity and pharmacokinetics of the BCMA-T cell bispecific antibody EM801 for multiple myeloma treatment. Cancer Cell 31, 396–410 (2017).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Neubert, K. et al. The proteasome inhibitor bortezomib depletes plasma cells and protects mice with lupus-like disease from nephritis. Nat. Med. 14, 748–755 (2008).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Obeng, E. A. et al. Proteasome inhibitors induce a terminal unfolded protein response in multiple myeloma cells. Blood 107, 4907–4916 (2006).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Woodle, E. S., Tremblay, S. & Driscoll, J. Targeting plasma cells with proteasome inhibitors: principles from primates. J. Am. Soc. Nephrol. 28, 1951–1953 (2017).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Cheng, Q. et al. Selective depletion of plasma cells in vivo based on the specificity of their secreted antibodies. Eur. J. Immunol. 50, 284–291 (2020).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Ralevic, V. & Burnstock, G. Receptors for purines and pyrimidines. Pharmacol. Rev. 50, 413–492 (1998).

    CAS 
    PubMed 

    Google Scholar
     

  • Iwamoto, T. et al. Pannexin 3 regulates intracellular ATP/cAMP levels and promotes chondrocyte differentiation. J. Biol. Chem. 285, 18948–18958 (2010).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Wolf, F. A., Angerer, P. & Theis, F. J. SCANPY: large-scale single-cell gene expression data analysis. Genome Biol. 19, 15 (2018).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Stuart, T. et al. Comprehensive integration of single-cell data. Cell 177, 1888–1902 (2019).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Lopez, R., Regier, J., Cole, M. B., Jordan, M. I. & Yosef, N. Deep generative modeling for single-cell transcriptomics. Nat. Methods 15, 1053–1058 (2018).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Traag, V. A., Waltman, L. & van Eck, N. J. From Louvain to Leiden: guaranteeing well-connected communities. Sci. Rep. 9, 5233 (2019).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • [ad_2]

    Source link

  • Non-Abelian topological order and anyons on a trapped-ion processor

    [ad_1]

  • Goldin, G. A., Menikoff, R. & Sharp, D. H. Comments on ‘general theory for quantum statistics in two dimensions’. Phys. Rev. Lett. 54, 603–603 (1985).

    Article 
    ADS 
    MathSciNet 
    CAS 
    PubMed 

    Google Scholar
     

  • Moore, G. & Seiberg, N. Classical and quantum conformal field theory. Commun. Math. Phys. 123, 177–254 (1989).

    Article 
    ADS 
    MathSciNet 

    Google Scholar
     

  • Moore, G. & Read, N. Nonabelions in the fractional quantum Hall effect. Nucl. Phys. B 360, 362–396 (1991).

    Article 
    ADS 
    MathSciNet 

    Google Scholar
     

  • Wen, X. G. Non-Abelian statistics in the fractional quantum Hall states. Phys. Rev. Lett. 66, 802–805 (1991).

    Article 
    ADS 
    MathSciNet 
    CAS 
    PubMed 

    Google Scholar
     

  • Kitaev, A. Y. Fault-tolerant quantum computation by anyons. Ann. Phys. 303, 2–30 (2003).

    Article 
    ADS 
    MathSciNet 
    CAS 

    Google Scholar
     

  • Nayak, C., Simon, S. H., Stern, A., Freedman, M. & Das Sarma, S. Non-Abelian anyons and topological quantum computation. Rev. Mod. Phys. 80, 1083–1159 (2008).

    Article 
    ADS 
    MathSciNet 
    CAS 

    Google Scholar
     

  • Wen, X.-G. Quantum Field Theory of Many-body Systems Oxford Graduate Texts (Oxford Univ. Press, 2010).

  • Leinaas, J. M. & Myrheim, J. On the theory of identical particles. Nuovo Cim. B 37, 1–23 (1977).

    Article 
    ADS 

    Google Scholar
     

  • Goldin, G. A., Menikoff, R. & Sharp, D. H. Representations of a local current algebra in nonsimply connected space and the Aharonov–Bohm effect. J. Math. Phys. 22, 1664–1668 (1981).

    Article 
    ADS 
    MathSciNet 

    Google Scholar
     

  • Wilczek, F. Quantum mechanics of fractional-spin particles. Phys. Rev. Lett. 49, 957–959 (1982).

    Article 
    ADS 
    MathSciNet 
    CAS 

    Google Scholar
     

  • Fowler, A. G., Mariantoni, M., Martinis, J. M. & Cleland, A. N. Surface codes: towards practical large-scale quantum computation. Phys. Rev. A 86, 032324 (2012).

    Article 
    ADS 

    Google Scholar
     

  • Nakamura, J., Liang, S., Gardner, G. C. & Manfra, M. J. Direct observation of anyonic braiding statistics. Nat. Phys. 16, 931–936 (2020).

    Article 
    CAS 

    Google Scholar
     

  • Bartolomei, H. et al. Fractional statistics in anyon collisions. Science 368, 173–177 (2020).

    Article 
    ADS 
    MathSciNet 
    CAS 
    PubMed 

    Google Scholar
     

  • Satzinger, K. J. et al. Realizing topologically ordered states on a quantum processor. Science 374, 1237–1241 (2021).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Semeghini, G. et al. Probing topological spin liquids on a programmable quantum simulator. Science 374, 1242–1247 (2021).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Ryan-Anderson, C. et al. Implementing fault-tolerant entangling gates on the five-qubit code and the color code. Preprint at https://arxiv.org/abs/2208.01863 (2022).

  • Iqbal, M. et al. Topological order from measurements and feed-forward on a trapped ion quantum computer. Preprint at https://arxiv.org/abs/2302.01917 (2023).

  • Foss-Feig, M. et al. Experimental demonstration of the advantage of adaptive quantum circuits. Preprint at https://arxiv.org/abs/2302.03029 (2023).

  • Pan, W. et al. Exact quantization of even-denominator fractional quantum Hall state at ν=5/2 Landau level filling factor. Phys. Rev. Lett. 83, 3530–3533 (1999).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Banerjee, M. et al. Observation of half-integer thermal Hall conductance. Nature 559, 205–210 (2018).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Ma, K. K. W., Peterson, M. R., Scarola, V. W. & Yang, K. in Encyclopedia of Condensed Matter Physics 2nd edn (ed. Chakraborty, T.) 324–365 (Academic Press, 2024); https://www.sciencedirect.com/science/article/pii/B9780323908009001359.

  • Willett, R. et al. Interference measurements of non-Abelian e/4 & Abelian e/2 quasiparticle braiding. Phys. Rev. X 13, 011028 (2023).

    CAS 

    Google Scholar
     

  • Feldman, D. E. & Halperin, B. I. Fractional charge and fractional statistics in the quantum Hall effects. Rep. Prog. Phys. 84, 076501 (2021).

    Article 
    MathSciNet 

    Google Scholar
     

  • Kitaev, A. Unpaired Majorana fermions in quantum wires. Phys. Uspekhi 44, 131–136 (2001).

    Article 
    ADS 

    Google Scholar
     

  • Microsoft Quantum InAs–Al hybrid devices passing the topological gap protocol. Phys. Rev. B 107, 245423 (2023).

    Article 
    ADS 

    Google Scholar
     

  • Bombin, H. Topological order with a twist: Ising anyons from an Abelian model. Phys. Rev. Lett. 105, 030403 (2010).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Andersen, T. I. et al. Non-Abelian braiding of graph vertices in a superconducting processor. Nature 618, 264–269 (2023).

    Article 

    Google Scholar
     

  • Xu, S. et al. Digital simulation of projective non-Abelian anyons with 68 superconducting qubits. Chin. Phys. Lett. 40, 060301 (2023).

    Article 
    ADS 

    Google Scholar
     

  • Cui, S. X., Hong, S.-M. & Wang, Z. Universal quantum computation with weakly integral anyons. Quantum Inf. Process. 14, 2687–2727 (2015).

    Article 
    ADS 
    MathSciNet 

    Google Scholar
     

  • Barkeshli, M. & Sau, J. D. Physical architecture for a universal topological quantum computer based on a network of Majorana nanowires. Preprint at https://arxiv.org/abs/1509.07135 (2015).

  • Barkeshli, M., Jian, C.-M. & Qi, X.-L. Theory of defects in Abelian topological states. Phys. Rev. B 88, 235103 (2013).

    Article 
    ADS 

    Google Scholar
     

  • Barkeshli, M., Jian, C.-M. & Qi, X.-L. Genons, twist defects, and projective non-Abelian braiding statistics. Phys. Rev. B 87, 045130 (2013).

    Article 
    ADS 

    Google Scholar
     

  • Cong, I., Cheng, M. & Wang, Z. Universal quantum computation with gapped boundaries. Phys. Rev. Lett. 119, 170504 (2017).

    Article 
    ADS 
    MathSciNet 
    PubMed 

    Google Scholar
     

  • Wineland, D. J. et al. Experimental issues in coherent quantum-state manipulation of trapped atomic ions. J. Res. Natl Inst. Stand. Technol. 103, 259–328 (1998).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Kielpinski, D., Monroe, C. & Wineland, D. J. Architecture for a large-scale ion-trap quantum computer. Nature 417, 709–711 (2002).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Moses, S. A. et al. A race track trapped-ion quantum processor. Phys. Rev. X 13, 041052 (2023).

  • Bravyi, S., Hastings, M. B. & Verstraete, F. Lieb–Robinson bounds and the generation of correlations and topological quantum order. Phys. Rev. Lett. 97, 050401 (2006).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Liu, Y.-J., Shtengel, K., Smith, A. & Pollmann, F. Methods for simulating string-net states and anyons on a digital quantum computer. PRX Quantum 3, 040315 (2022).

    Article 
    ADS 

    Google Scholar
     

  • Aharonov, D. & Touati, Y. Quantum circuit depth lower bounds for homological codes. Preprint at https://arxiv.org/abs/1810.03912 (2018).

  • Raussendorf, R., Bravyi, S. & Harrington, J. Long-range quantum entanglement in noisy cluster states. Phys. Rev. A 71, 062313 (2005).

    Article 
    ADS 

    Google Scholar
     

  • Bolt, A., Duclos-Cianci, G., Poulin, D. & Stace, T. Foliated quantum error-correcting codes. Phys. Rev. Lett. 117, 070501 (2016).

    Article 
    ADS 
    MathSciNet 
    CAS 
    PubMed 

    Google Scholar
     

  • Piroli, L., Styliaris, G. & Cirac, J. I. Quantum circuits assisted by local operations and classical communication: transformations and phases of matter. Phys. Rev. Lett. 127, 220503 (2021).

    Article 
    ADS 
    MathSciNet 
    CAS 
    PubMed 

    Google Scholar
     

  • Tantivasadakarn, N., Vishwanath, A. & Verresen, R. Hierarchy of topological order from finite-depth unitaries, measurement, and feedforward. PRX Quantum 4, 020339 (2023).

    Article 
    ADS 

    Google Scholar
     

  • Shi, B. Seeing topological entanglement through the information convex. Phys. Rev. Res. 1, 033048 (2019).

    Article 
    CAS 

    Google Scholar
     

  • Tantivasadakarn, N., Thorngren, R., Vishwanath, A. & Verresen, R. Long-range entanglement from measuring symmetry-protected topological phases. Preprint at https://arxiv.org/abs/2112.01519 (2022).

  • Verresen, R., Tantivasadakarn, N. & Vishwanath, A. Efficiently preparing Schrödinger’s cat, fractons and non-Abelian topological order in quantum devices. Preprint at https://arxiv.org/abs/2112.03061 (2022).

  • Bravyi, S., Kim, I., Kliesch, A. & Koenig, R. Adaptive constant-depth circuits for manipulating non-Abelian anyons. Preprint at https://arxiv.org/abs/2205.01933 (2022).

  • Tantivasadakarn, N., Verresen, R. & Vishwanath, A. Shortest route to non-Abelian topological order on a quantum processor. Phys. Rev. Lett. 131, 060405 (2023).

    Article 
    ADS 
    MathSciNet 
    CAS 
    PubMed 

    Google Scholar
     

  • Yoshida, B. Topological phases with generalized global symmetries. Phys. Rev. B 93, 155131 (2016).

    Article 
    ADS 

    Google Scholar
     

  • Potter, A. C. & Vasseur, R. Symmetry constraints on many-body localization. Phys. Rev. B 94, 224206 (2016).

    Article 
    ADS 

    Google Scholar
     

  • Senthil, T. Symmetry-protected topological phases of quantum matter. Annu. Rev. Condensed Matter Phys. 6, 299–324 (2015).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Briegel, H. J. & Raussendorf, R. Persistent entanglement in arrays of interacting particles. Phys. Rev. Lett. 86, 910–913 (2001).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Wang, C. & Levin, M. Topological invariants for gauge theories and symmetry-protected topological phases. Phys. Rev. B 91, 165119 (2015).

    Article 
    ADS 

    Google Scholar
     

  • Wang, J., Wen, X.-G. & Yau, S.-T. Quantum statistics and spacetime surgery. Phys. Lett. B 807, 135516 (2020).

    Article 
    MathSciNet 
    CAS 

    Google Scholar
     

  • Putrov, P., Wang, J. & Yau, S.-T. Braiding statistics and link invariants of bosonic/fermionic topological quantum matter in 2+1 and 3+1 dimensions. Ann. Phys. 384, 254–287 (2017).

    Article 
    ADS 
    MathSciNet 
    CAS 

    Google Scholar
     

  • Kulkarni, A., Mignard, M. & Schauenburg, P. A topological invariant for modular fusion categories. Preprint at https://arxiv.org/abs/1806.03158 (2021).

  • Dauphinais, G. & Poulin, D. Fault-tolerant quantum error correction for non-Abelian anyons. Commun. Math. Phys. 355, 519–560 (2017).

    Article 
    ADS 
    MathSciNet 

    Google Scholar
     

  • Lu, T.-C., Lessa, L. A., Kim, I. H. & Hsieh, T. H. Measurement as a shortcut to long-range entangled quantum matter. PRX Quantum 3, 040337 (2022).

    Article 
    ADS 

    Google Scholar
     

  • Zhu, G.-Y., Tantivasadakarn, N., Vishwanath, A., Trebst, S. & Verresen, R. Nishimori’s cat: stable long-range entanglement from finite-depth unitaries and weak measurements. Phys. Rev. Lett. 131, 200201 (2023).

  • Lee, J. Y., Ji, W., Bi, Z. & Fisher, M. P. A. Decoding measurement-prepared quantum phases and transitions: from Ising model to gauge theory, and beyond. Preprint at https://arxiv.org/abs/2208.11699 (2022).

  • Lu, T.-C., Zhang, Z., Vijay, S. & Hsieh, T. H. Mixed-state long-range order and criticality from measurement and feedback. PRX Quantum 4, 030318 (2023).

    Article 
    ADS 

    Google Scholar
     

  • Mochon, C. Anyon computers with smaller groups. Phys. Rev. A 69, 032306 (2004).

    Article 
    ADS 

    Google Scholar
     

  • [ad_2]

    Source link

  • Genetic determinants of micronucleus formation in vivo

    [ad_1]

    Animals

    All experiments were performed in accordance with UK Home Office regulations and the UK Animals (Scientific Procedures) Act of 2013 under UK Home Office licences. These licences were approved by the Wellcome Sanger Institute (WSI) Animal Welfare and Ethical Review Board. Mice were maintained in a specific-pathogen-free unit under a 12 h light and 12 h dark cycle with lights off at 19:30 and no twilight period. The ambient temperature was 21 ± 2 °C, and the humidity was 55 ± 10%. Mice were housed at 3–5 mice per cage (overall dimensions of caging: 365 mm × 207 mm × 140 mm (length × width × height), floor area, 530 cm2) in individually ventilated caging (Tecniplast, Sealsafe 1284L) receiving 60 air changes per hour. In addition to Aspen bedding substrate, standard environmental enrichment of Nestlets, a cardboard tube/tunnel and wooden chew blocks were provided. Mice were given water and diet ad libitum.

    Mouse generation

    A complete list of the mouse lines used in this study is provided in the Source Data. Most mouse mutants were generated using the well-validated ‘KO-first allele’. This strategy relies on the identification of an exon common to all transcript variants, upstream of which a LacZ cassette is inserted to make a constitutive KO/gene-trap known as a tm1a allele. In contrast to the tm1a allele, tm1b creates a frameshift mutation after Cre-mediated deletion of the loxP-flanked exon. Other allele types are also possible and have been described previously60. Mouse production was performed as described previously61. We maintained most mutant lines (73% of the mice tested in this study) on a pure inbred C57BL/6N background, with the other lines on mixed C57BL/6 backgrounds (for example, C57BL/6N;C57BL/6BrdTyrc-Brd). For the C57BL/6N background, a core colony was established using mice from Taconic Biosciences, which was refreshed at set generational points (typically ten generations) and cryopreserved at regular intervals to avoid genetic drift. The sex and age for all mice analysed is available in the Source Data. For tumour-watch studies, mice were aged for spontaneous tumour formation until they became moribund in keeping with the above-mentioned Home Office Guidelines. To ensure compliance, mice were examined twice daily for symptoms including weight loss, poor coat condition and hunched back. Tumour histology was analysed by a consultant pathologist to confirm cancer diagnoses. Mice were assigned randomly to groups on the basis of Mendelian inheritance. 

    In vivo MN screen

    The in vivo MN screen was performed according to a previously described protocol20. The samples were analysed on the LSRFortessa or Cytomics FC500 (Becton Dickinson) system with a minimum of 100,000 events collected per sample. The gating strategy used is shown in Supplementary Fig. 1. For the analysis of MN screening data, a mixed linear effect beta regression model exploring the effect of genotype on the percentage of MN, was used. This was implemented within R (glmmTMB, v.1.0.1). In detail, a regression model was fitted using flow.cytometer as a fixed effect to account for any differences arising from the instrumentation, while assay.date was fitted as a random effect to account for the variance introduced by batch (Y ~ genotype + flow.cytometer + (1|batch). The genotype effect and associated error were estimated as a marginal mean using the emmeans package (R; v.1.4.4). The significance of the genotype effect was assessed using a likelihood ratio test. Analysis code is available at GitHub.

    High-throughput phenotypic screen

    The high-throughput phenotyping pipeline used was a series of standardized tests conducted in accordance with standard operating procedures (available at IMPReSS (https://www.mousephenotype.org/impress/index) and were performed by the Mouse Genetics Project (MGP) at the Wellcome Sanger Institute (WSI). Tests covered a broad range of biological areas, including metabolism, cardiovascular, neurological and behavioural, bone, sensory and haematological systems, and plasma chemistry. Factors predicted to affect the variables were standardized where possible. If this was not possible, measures were taken to reduce potential biases, for example, the impact of different people performing the test (known as the minimized operator), and the time of day of the test, as defined by the Mouse Experimental Design Ontology (MEDO)62. The data captured with the MEDO ontology can be found at http://www.mousephenotype.org/about-impc/arrive-guidelines. Moreover, pre-established reasons were defined for quality-control failures (for example, insufficient sample, error with equipment during test) and detailed using IMPRESS, and the data inclusion/exclusion criteria were therefore standardized. All discarded data were retained and tracked in a database to enable quality-control-failed data to be audited. Phenotyping data were collected at regular intervals on age-, sex- and strain-matched WT (control) mice. On average, at least seven homozygote mice of each sex per KO line were generated for phenotyping. If no homozygotes were obtained from ≥28 offspring from heterozygote intercrosses at postnatal day 14 (P14), the line was declared homozygous lethal. Similarly, if less than 13% of the pups resulting from heterozygote intercrosses were homozygous at P14, the line was judged as being homozygous subviable. In this event, heterozygote mice were examined in the phenotyping screen. The random allocation of mice to experimental group (WT versus KO) was driven by Mendelian inheritance. Owing to the high-throughput nature of the phenotyping screen, blinding the operators to the identity of KO lines during phenotyping was not used as the cage cards used to identify the mice included genotype information. However, in a high-throughput environment without a defined hypothesis, the potential bias is minimized. In all cases, the individual mouse was considered to be the experimental unit. Further experimental design strategies (for example, exact definition of a control animal) are defined using a standardized ontology as described previously62 and are available from the IMPC portal (http://www.mousephenotype.org/about-impc/arrive-guidelines). For a few lines, phenotyping data were also generated on a mutant of the same gene at another IMPC phenotyping centre and used to augment/enrich phenotypes from WSI. In figures that show phenotyping data, if the same phenotype was assessed by multiple assays, the most statistically robust result is shown.

    Characterization of MN gene candidates in human datasets

    MN gene candidates were mapped to orthologous genes in the human genome using ENSEMBL and integrated with GWAS data on mosaic LOY26. This was performed using PAR-LOYq calls from 205,011 male participants from the UK Biobank study27. An enrichment analysis was performed across the whole dataset to test for the over-representation of MN genes at LOY GWAS loci. To do this, we first performed MAGMA analyses (v.1.08)28 using all genomic variants within each MN gene extracting gene-level associations to the LOY phenotype. Genes were annotated on the basis of their proximity to genome-wide significant loci (P < 5 × 10−8) associated with LOY, specifically if they were 500 kb up- or downstream of the LOY gene start or end position. Second, further MAGMA analyses were performed using only those variants that were predicted to have deleterious effects (for example, non-synonymous and loss of function). Genes exhibiting an FDR-corrected MAGMA P < 0.05 were considered to be significant. Finally, for genomic loci reaching at least a suggestive level of significance in the GWAS (P < 5 × 10−5), we performed SMR and HEIDI tests (v.1.02)63 using blood gene expression level data from the eQTLGen study64 and blood protein level data from the Fenland study65. For both datasets, we considered expression of a gene to be influenced by the same genomic variation as that seen in the LOY GWAS if the FDR-corrected P value for the SMR test was P < 0.05 and the P value for the HEIDI test was P > 0.01. Human genomic variation within or around the DSCC1 gene was further studied by querying associations towards the human-equivalent phenotypic traits to those observed in Dscc1-mutant mice. Specifically, GWAS on BMD66, body mass index, number of children ever born67 and LOY26 were used to ascertain gene-level associations using all available variants within the DSCC1 gene and to perform SMR and HEIDI tests against the eQTLGen data, as described above (Supplementary Table 4). For the same four traits, exome gene-burden tests were performed using phenotypic and genetic data from the UK Biobank study. Rare exome variants (minor allele frequency < 0.1%) were identified on the basis of their predicted consequence on protein function and, using VEP68 and LOFTEE69, high-confidence protein truncation variants within DSCC1 were collapsed and tested for associations towards the four traits using BOLT-LMM70,71 (Supplementary Table 4). Finally, a phenome-wide association study for common variants within DSCC1 was performed using the Open Targets Genetics Portal72 (Supplementary Table 4).

    HREM analysis

    For analysis with HREM, embryos were collected at E14.5 and fixed in Bouin’s solution overnight. After washing in PBS, the embryos were dehydrated in a graded series of methanol. They were then infiltrated and embedded in methacrylate resin (JB4, Polysciences Europe) and stained with eosin B and acridine orange, according to previously published protocols73. The polymerized resin blocks were analysed using HREM resulting in volume datasets with isotropic voxel sizes of 2.55–3 µm. Visualization and further analysis of the HREM data were performed using Amira v.6.7.0 (Thermo Fisher Scientific) and OsiriX (v.5.6, 64 bit, Pixmeo). The embryos were staged and systematically screened for abnormalities according to a standardized protocol74,75.

    Cell lines

    MEFs were prepared from E13.5 embryos, after timed matings between Dscc1+/− mice. In brief, embryos were dissected from the decidua, mechanically disrupted and cultured in DMEM supplemented with 10% fetal bovine serum (FBS), 1.0 mM l-glutamine, 0.1 mM minimal essential medium, non-essential amino acids and penicillin–streptomycin. The initial plating was defined as passage zero, and cells were subsequently maintained on a standard protocol76. SIRT1-KO HEK293 cells were obtained from Kerafast (ENH131‐FP). Cells were grown in DMEM supplemented with 10% FBS, penicillin–streptomycin and 1% GlutaMAX. RPE-1 DSCC1Δ/flox cells were obtained from Jallepalli Laboratory43, and RPE-1 TP53-KO and TP53/DSCC1-double-KO cells were obtained from the de Lange laboratory51; these cell lines were grown in DMEM supplemented with 10% FBS and 1% GlutaMAX. iPS cells were grown in Tesr-E8 supplemented with 10 μM Y-27632 ROCK inhibitor (Stem Cell). HAP1 cells77 were cultured in Iscove’s modified Dulbecco’s medium (Invitrogen), supplemented with 10% FCS (Clontech), 1% UltraGlutamin (Lonza) and 1% penicillin–streptomycin (Invitrogen). ∆PDS5A and ∆WAPL HAP1 cells were generated using CRISPR–Cas9 as described previously78,79. The CHP-212 neuroblastoma cell line (CRL-2273) was grown in RPMI with 10% FBS.

    Modification of human iPS cells was performed according to established protocols80. In brief, the Gene Editing facility at WSI generated the DSCC1-KD BOB/iPS lines. We believe these cells to be null with just 2–3% of protein expression retained (Extended Data Fig. 7) but, nonetheless, designate this a KD allele. An asymmetrical exon within the target gene was replaced with a puromycin cassette, and a frameshift indel was introduced into the other allele. A template vector containing an EF1a-puromycin cassette was constructed for each gene, incorporating two 1.5 kb homology arms designed to align with the sequence surrounding the targeted exon. Two guide RNAs (gRNAs) were designed for each exon (Extended Data Fig. 7). The template vector (2 μg), both gRNA vectors (3 μg) and hSpCas9 (4 μg) were transfected into 2 × 106 cells using the Human Stem Cell Nucleofector Kit 2 (VPH-5022, Lonza). Subsequently, cells were seeded in 10 cm2 dishes and, after 72 h, they underwent selection with 3 μg ml−1 puromycin. Single cells were then expanded and subjected to genotyping for the verification of a frameshift indel using Sanger sequencing. The resulting KO lines were cultured in the presence of 1 μg ml−1 puromycin (ant-pr-1, InvivoGen). All of the cell lines in the research laboratories that participated in this study are routinely tested for mycoplasma and STR profiled and/or validated on the basis of the presence of unique engineered alleles as described in the Reporting Summary.

    Chromosome preparation and FISH

    Metaphase preparations were performed using a standard protocol81. For M-FISH analysis, mouse-chromosome-specific DNA libraries were provided by the Flow Cytometry Core Facility of Wellcome Sanger Institute82. To make 10 tests of M-FISH probe, 500 μl of sonicated DNA was precipitated with 100 μl mouse Cot-1 DNA (Invitrogen) and resuspended in 120 μl hybridization buffer (50% formamide, 2× saline-sodium citrate (SSC), 10% dextran sulfate, 0.5 M phosphate buffer, 1× Denhardt’s solution, pH 7.4). Metaphase preparations were dropped onto precleaned microscopy slides, and then fixed in acetone (Sigma-Aldrich) for 10 min followed by dehydration through an ethanol series (70%, 90% and 100%). Metaphase spreads on slides were denatured by immersion in an alkaline denaturation solution (0.5 M NaOH, 1.0 M NaCl) for approximately 40 s, followed by rinsing in 1 M Tris-HCl (pH 7.4) solution for 3 min, 1× PBS for 3 min and dehydration through a 70%, 90% and 100% ethanol series. The M-FISH probe (10 μl for each 22 × 22 mm hybridization area) was denatured at 65 °C for 10 min before being applied onto the denatured slides. The hybridization area was sealed with a 22 × 22 mm2 coverslip and rubber cement. Hybridization was performed in a 37 °C incubator for 40–44 h. The post-hybridization washes included a 5 min stringent wash in 0.5× SSC at 75 °C, followed by a 5 min rinse in 2× SSC containing 0.05% Tween-20 (VWR) and a 2  min rinse in 1× PBS, both at room temperature. Finally, the slides were mounted with SlowFade Diamond Antifade Mountant containing 4′,6-diamidino-2-phenylindole (DAPI, Invitrogen). Images were visualized on the Zeiss AxioImager D1 fluorescence microscope equipped with narrow band-pass filters for DAPI, DEAC, FITC, CY3, TEXAS RED and CY5 fluorescence and an ORCA-EA CCD camera (Hamamatsu). M-FISH digital images were captured using the SmartCapture software (Digital Scientific UK) and processed using the SmartType Karyotyper software (Digital Scientific). At least 20 metaphases from each sample were fully karyotyped on the basis of M-FISH and enhanced DAPI banding.

    CRISPR–Cas9 screen and sequencing

    WT and DSCC1-KD iPS cells (1 × 108) were independently infected with a human genome-wide guide RNA (gRNA) lentiviral library83 that had been recloned to swap the puromycin-resistance cassette with a neomycin-resistance cassette. Both lines were infected at a multiplicity of infection of 0.1–0.2 and a library coverage of 500× in three independent replicates, which were kept independent throughout the screen. Three days after infection, 1 mg ml−1 G418 was added to the medium and cells were cultured for an additional 10 days. When cells required passaging, a minimum of 5 × 107 cells per technical replicate was maintained at a library coverage of 500×. From each replicate, PCR was performed to amplify the gRNA region, and gRNAs were sequenced as described previously83. Single-end Illumina sequencing reads of 19 nucleotides were counted for each gRNA. To identify depleted and enriched genes in the DSCC1-KD iPS cells the software package MAGeCK84 v.0.5.6 was used. Extensive quality control of the screen was performed, and this analysis is available at the GitHub for this project (https://github.com/team113sanger/Large-scale-analysis-of-genes-that-regulate-micronucleus-formation/tree/main/CRISPR_screen_QC).

    Mini-arrayed CRISPR analyses

    The CHP-212 cell line was transduced with the lentiviral Cas9 plasmid (Addgene, 52962) and selected with 5 µg ml−1 blasticidin (Thermo Fisher Scientific, 61120) for 5 days. To test the expression and cutting efficiency of Cas9, we took transformed and untransformed cells and further transduced them with a lentiviral BFP-GFP reporter virus (Addgene 67980). After 4 days, the cells were analysed using flow cytometry (CytoFLEX, Beckman Coulter) and the cutting and transduction efficiency were determined on the basis of the ratio of BFP- and GFP-positive cells as previously described85. Notably, we confirmed that cells continued to cycle and grow throughout the experiment.

    The sgRNA-BFP plasmids were from the arrayed Sanger Institute CRISPR library (Sigma-Aldrich, HSANGERV; the sequences are provided in Supplementary Table 6). Bacteria were grown in 5 ml of LB medium overnight and DNA was extracted using a DNA purification kit (Amresco) and AcroPrep Advance 96-well filter plates (Cytavia, 8032). DNA concentrations were measured using the Quant-iT PicoGreen dsDNA Reagent (10535213). For each gene, two DNA vectors containing unique sgRNAs were mixed at equal amounts and then diluted to the same concentrations and blinded. Virus was produced by transfection of the mix of sgRNAs and the packaging plasmids psPAX (Addgene, 12260) and pMD2.G (Addgene, 12259) into HEK293FT cells. Virus was collected 3 days after transfection, and the viral titre was determined by measuring BFP expression using flow cytometry (CytoFLEX, Beckman Coulter). For the arrayed targeting screen, cells were seeded into PhenoPlate 96-well plates (Perkin Elmer, 6055302), leaving the outer wells blank. After the cells had adhered, they were transduced with lentivirus at a multiplicity of infection of >80% (each gene is targeted by two distinct gRNAs to increase the KO efficiency to >80% in our hands). Cells were allowed to recover before the addition of 2 µg ml−1 of puromycin (Santa Cruz Biotechnology, sc-108071) for 48 h. After recovery, CHP-212 cells were treated with 12.5 µM of hydroxyurea (Merck, H8627) for three cell doublings and hTERT RPE-1 cells with 50 µM for 72 h (Supplementary Table 7 (HU titration)). Next, cells were fixed with 4% PFA (Alfa Aesar, 43368) and stained with TOPRO3 (Thermo Fisher Scientific, T3605). Cells were imaged using the Operetta CLS system (Perkin-Elmer) and analysed using the Harmony software (Imaging facility, CRUK Cambridge). A prescan (×5 air objective) of each well was performed to determine 180 fields of view of each well with the ideal seeding density. These fields of view were then reimaged using a ×40 water objective. For the analysis, z planes were transformed into a maximum projection, a sliding paraboloid filter was used, and the find nuclei and find cytoplasm functions were optimized to detect our cell lines in culture. Furthermore, the find spots function was used to find MN located in the cytoplasm. Other particles were excluded on the basis of staining intensity, roundness and size. Deblinding was performed after statistical analyses.

    SIRT1 KO rescue cell viability experiment

    HEK293 cells were grown in antibiotic free medium for two passages before seeding at a density of 1 × 104 cells per well in quintuplicate into 96-well plates. Then, 24 h later, ON-TARGETplus Human DSCC1 (79095) siRNA-SMARTpool (L-014300-00-0005) at 25 nM final concentration was added to the cells, along with 0.2 ml per well of Dharmafect 2 (Dharmacon) transfection reagent in serum-free medium. The next day, complete antibiotic-free medium was added. Then, 48 h after transfection, the medium was refreshed on all wells with complete antibiotic-free medium. Three days after transfection, the cell viability was determined using the Promega Cell Titer Glo 2.0 cell viability assay. Medium was aspirated from wells and 175 μl of medium along with 25 μl Cell-Titer Glo reagent were added to each well and left to incubate for 10 min at room temperature. Medium and cell viability reagent mixture (150 μl) was transferred to black-walled, clear and flat-bottom 96-well plates for reading. Luminescence was read on the CLARIOstar microplate reader (BMG LABTECH). Cell viability was calculated by normalizing to untransfected control wells.

    DSCC1 transcript analyses

    RNA extraction was performed using the Monarch total RNA miniprep kit (New England BioLabs). RNA was converted to cDNA using the High-Capacity RNA-to-cDNA kit (Thermo Fisher Scientific) using 500 ng of total RNA. Gene expression was measured on the QuantStudio 5 qPCR System (Thermo Fisher Scientific) using TaqMan gene expression assays for human DSCC1 (Hs00900361_m1) or mouse Dscc1 (Mm01195386_m1). TaqMan Universal Master Mix II with UNG-1 was used (Thermo Fisher Scientific; 4440038). Amplification parameters were as follows: 50 °C for 2 min; 95 °C for 10 min; followed by 40 cycles of 95 °C for 15 s and 60 °C for 60 s. Relative gene expression was determined on the basis of the ΔCt values between the gene of interest and housekeeping genes GAPDH (Hs02786624_g1) and 18S rRNA (Hs03003631_g1) using the Design & Analysis v.2.6.0 software from Applied Biosystems (Thermo Fisher Scientific).

    Antibodies

    The following antibodies were used: anti-CD71-FITC (SouthernBiotech, 1720-02, 0.5 mg ml−1, 1:500)20, anti-SIRT1 (rabbit, Cell Signalling, 2496S, 1:1,000), anti-centromere (Antibodies, 15-234-0001, 1:1,000), anti-rabbit Alexa 488 (Thermo Fisher Scientific, A11034, 1:2,000), goat anti-human Alexa 647 (Thermo Fisher Scientific, A21445, 1:2,000), anti-DSCC1 (H0079075-B01P, Novus Biologicals, 1:1,000), anti-HSP90 (F-8, Santa Cruz, 1:10,000), anti-HP1γ (05-690, Millipore, 1:1,000), goat-anti-mouse-PO (DAKO, P044701, 1:2,000), anti-SMC3 (Abcam, AB 9263, 1:250), anti-SMC3 (Thermo Fisher Scientific, A300-060A, 1:1,000), anti-acetyl SMC3 mouse (Sigma-Aldrich, MABE1073, 21A7, Lys105/106, 385016, 1:1,000), anti-p53 (Cell Signaling Technology, 1C12, 2524S), anti-acetyl p53 (p53-K382Ac, Abcam, ab75754, EPR358(2) to p53 acetyl K382, 1:1,000), anti-phosphorylated-histone H2A.X (Ser139) (JBW301, Sigma-Aldrich, 05-636-I, 1:1,000), anti-β-actin (Merck, A5441, 1:10,000, 5% milk), anti-GAPDH (6C5, Abcam, ab8245, 1:1,000), anti-p21 (Abcam, ab109520, 1:1,000). Uncropped western blots are provided in the Supplementary Information.

    Immunoprecipitation

    Flash-frozen cell pellets were thawed on ice and resuspended in 1 ml cell lysis buffer (25 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% NP-40, 5% glycerol) freshly supplemented with 1:100 Pierce Universal Nuclease (Thermo Fisher Scientific, 88702), 1 mM DTT (Thermo Fisher Scientific, A39255) and Halt protease (Thermo Fisher Scientific, 1860932) and phosphatase inhibitor (Roche, PhosSTOP, REF: 04906845001) and incubated on ice for 30 min. The lysis buffer was also used as wash buffer. Protein was collected by centrifugation (15,000 rcf, 10 min at 4 °C), the supernatant was transferred to a fresh tube and the pellet was discarded. The protein concentration was measured using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, 23225) according to the manufacturer’s protocol. To start the immunoprecipitation, beads (Thermo Fisher Scientific, Immunoprecipitation Kit Dynabeads Protein A, 10006D) were conjugated to the antibody according to the manufacturers protocol. After optimization, 50 µl of beads were used to conjugate 2 µg of total antibody. The protein sample was diluted (using the lysis buffer) to 1 mg ml−1 for immunoprecipitation and 1 ml of this sample was added to 50 μl of antibody conjugated beads. The protein–bead–antibody mixture was incubated on a rotator overnight at 4 °C. The sample was placed onto a magnet and the supernatant was transferred to a new tube (this was the flow-through that was retained to assess the antibody–bead uptake). The sample was washed on a rotator three times for 10 min in 1 ml lysis buffer at room temperature. In between the second and third wash, the sample was moved to a new Eppendorf tube to eliminate any proteins stuck to the tube. A single PBS wash was performed to the sample for 5 min on a rotator at room temperature, then the sample was placed onto the magnet for the supernatant to be removed. The result was assessed using western blotting. To prepare the reagents for this, 50 μl of 2× SDS loading buffer and 5 μl of 10× reducing buffer were added to the beads. The input and the flow-through were prepared by adding the correct amount of protein, 4× SDS loading buffer, 10× reducing buffer and lysis buffer to volume. These samples were boiled at 95 °C for 5 min then loaded onto the gel (Bio-Rad, 4–12% gel) and run at 180 V for 45 min.

    Full proteome analysis

    The samples were lysed in RIPA buffer plus HaltTM protease and phosphatase inhibitor cocktail (final concentration 2×, ThermoFisher Scientific) with probe sonication and heating. Samples were then centrifuged at 13,000 rpm for 15 min to remove the pellet. Protein concentrations were measured using a Pierce BCA protein assay (Thermo Fisher Scientific). A total of 100 µg of protein per sample was taken. Proteins were reduced by addition of TCEP (Tris(2-carboxyethyl) phosphine, Sigma-Aldrich), alkylated by iodoacetamide (Sigma-Aldrich) and then purified by trichloroacetic acid precipitation. Purified proteins were digested in 100 mM TEAB by trypsin (Thermo Fisher Scientific) at 1:25 (by weight) at 37 °C for 18 h. A total of 40 or 50 µg of peptides were labelled using 0.4 mg TMT10plex (Thermo Fisher Scientific) according to the manufacturer’s instructions. The samples were mixed, dried in a SpeedVac and then fractionated on the XBridge BEH C18 column (2.1 mm inner diameter (i.d.) × 150 mm, Waters) with a gradient of 5% acetonitrile/0.1% NH4OH (pH 10) to 35% CH3CN/0.1% NH4OH in 30 min (total cycle 60 min). The flow rate was at 200 µl min−1. The peptides were reconstituted in 0.1% formic acid/H2O and analysed on the Orbitrap Fusion hybrid mass spectrometer coupled with the Ultimate 3000 RSLCnano system (both from Thermo Fisher Scientific). The samples were first loaded and desalted onto a PepMap C18 nano trap (100 µm i.d. × 20 mm, 100 Å, 5 µm; Thermo Fisher Scientific), then peptides were separated on the PepMap C18 column (75 µm i.d. × 500 mm, 2 µm; Thermo Fisher Scientific) over a linear gradient of 4–33.6% CH3CN/0.1% formic acid in 180 min, with a cycle time of 210 min and a flow rate at 300 nl min−1. The MS acquisition used MS3-level quantification with Synchronous Precursor Selection (SPS) with the top speed 3 s cycle time. In brief, the Orbitrap full MS survey scan was m/z 380–1,500 with a resolution of 120,000 at m/z 200, with AGC set at 4 × 105 and 50 ms maximum injection time. Multiply charged ions (z = 2–6) with an intensity threshold at 5,000 were fragmented in an ion trap at 35% collision energy, with AGC set at 1 × 104 and 50 ms maximum injection time, and isolation width of 0.7 Da in quadrupole. The top ten MS2 fragment ions were SPS selected with an isolation width of 0.7 Da, and fragmented in higher-energy collisionally activated dissociation (HCD) at 60% normalized collision energy (NCE), and detected in the Orbitrap to obtain reporter ion intensities at a better accuracy. The resolution was set at 60,000, and the AGC set at 6 × 104 with maximum injection time at 105 ms. The dynamic exclusion was set 60 s with a ±7 ppm exclusion window. The raw files were processed using Proteome Discoverer v.2.4 (Thermo Fisher Scientific) using the Sequest HT search engine. Spectra were searched against fasta files of reviewed UniProt Homo sapiens entries (December 2021) and an in-house contamination database. The search parameters were as follows: trypsin with 2 maximum miss-cleavage sites; mass tolerances at 30 ppm for precursor and 0.6 Da for fragment ions; dynamic modifications of deamidated (N, Q) and oxidation (M); static modifications of carbamidomethyl (C) and TMT6plex (peptide N-terminus and K). Peptides were validated by Percolator with the q value set at 0.01 (strict) and 0.05 (relaxed). The TMT10plex reporter ion quantifier included 20 ppm integration tolerance on the most confident centroid peak at the MS3 level. Only unique peptides were used for quantification. The co-isolation threshold was set at 100%. Peptides with average reported S/N > 3 were used for protein quantification, and the SPS mass matches threshold was set at 50%.

    Chromatin enrichment and MS analysis

    Flash-frozen cell pellets were thawed on ice and resuspended in nuclear-extraction buffer (15 mM Tris-HCl pH 7.5, 60 mM KCl, 15 mM NaCl, 5 mM MgCl2, 1 mM CaCl2, 250 mM sucrose, 0.3% NP-40, freshly supplemented with 1 mM DTT and Halt protease and phosphatase inhibitor (Thermo Fisher Scientific)) and incubated on ice for 5 min. Nuclei were collected by centrifugation (600 rcf, 5 min at 4 °C), washed once with nuclear-extraction buffer without NP-40, pelleted again, then resuspended in prechilled hypotonic buffer (3 mM EDTA, 0.2 mM EGTA and freshly supplemented with 1 mM DTT and Halt protease and phosphatase inhibitor) and incubated on ice for 30 min to release chromatin. Chromatin was pelleted for 5 min at 1,700 rcf at 4 °C in a cooled centrifuge and subsequently washed twice with hypotonic buffer. Chromatin pellets were solubilized using probe sonication in lysis buffer 100 mM triethylammonium bicarbonate (TEAB), 1% sodium deoxycholate (SDC), 10% isopropanol, 50 mM NaCl, 1:1,000 Pierce Universal Nuclease (Thermo Fisher Scientific) supplemented with Halt protease and phosphatase inhibitor. The protein concentration was measured using the Quick Start Bradford protein assay (BioRad) according to the manufacturer’s protocol. A total of 5 mg of protein with an equal contribution from each individual sample was reduced with 5 mM Tris-2-carboxyethyl phosphine (TCEP) for 1 h, followed by alkylation with 10 mM iodoacetamide for 30 min, then digested by adding trypsin (Pierce) at final concentration 75 ng μl−1 to each sample followed by incubation for 18 h at room temperature. For chromatin proteomics, 15 μg of protein digest was taken from each sample and labelled with TMTpro multiplexing reagents (Thermo Fisher Scientific), according to the manufacturer’s protocol. SDC was precipitated with formic acid at a final concentration of 2% (v/v) and centrifuged for 5 min at 10,0000 rpm. Supernatant containing TMTpro-labelled peptides were dried with a centrifugal vacuum concentrator. The remaining peptides were cleaned up using Pierce Peptide Desalting Spin Columns (Thermo Fisher Scientific), and then dried using a speed vacuum. Acetylated peptides were enriched with the PTMScan HS Acetyl-Lysine Motif (Ac-K) Kit (Cell Signalling Technologies, 46784) according to the manufacturer’s instructions, dried using a speed vacuum, resuspended in 100 mM TEAB and labelled with TMTpro according to the manufacturer’s protocol. Acetyl-enriched peptides were fractionated using the Pierce High pH Reversed-Phase Peptide Fractionation Kit (Thermo Fisher Scientific, 84868) according to the manufacturer’s protocol, dried using a speed vacuum and resuspended in 0.1% trifluoroacetic acid (TFA). Before MS analysis of the chromatin proteome, TMTpro-labelled peptides were fractionated with high-pH reversed-phase (RP) chromatography using the Waters XBridge C18 column (2.1 mm × 150 mm, 3.5 μm) on the Dionex UltiMate 3000 high-performance liquid chromatography (HPLC) system. Mobile phase A was 0.1% ammonium hydroxide (v/v) and mobile phase B was 100% acetonitrile and 0.1% ammonium hydroxide (v/v). Peptide separation was performed with a gradient elution of 200 μl min−1 with the following steps: isocratic for 5 min at 5% phase B, gradient for 40 min to 35% phase B, gradient to 80% phase B in 5 min, isocratic for 5 min, and re-equilibrated to 5% phase B. The fractions were collected in a 96-well plate every 42 s to a total of 65 fractions, then concatenated into 12 fractions, dried and reconstituted in 0.1% TFA. The samples were analysed using a Real Time Search-SPS-MS3 method on the Orbitrap Ascend mass spectrometer coupled to a Dionex UltiMate 3000 system. From each fraction, an estimated amount of 3 μg of peptides per fraction was injected onto a C18 trapping column (Acclaim PepMap 100, 100 μm × 2 cm, 5 μm, 100 Å) at a flow rate of 10 μl min−1. The samples were processed via a 120 min low-pH gradient elution on a nanocapillary reversed-phase column (Acclaim PepMap C18, 75 μm × 50 cm, 2 μm, 100 Å) at 50 °C. MS1 scans were collected from the 400–1,600 m/z range in the Orbitrap with the following settings: resolution, 120,000; AGC, standard; injection time, auto; and including 2–6 precursor charge states. Dynamic exclusion was set to 45 s, repeat count of 1, mass tolerance of 10 ppm and the exclude isotope option was enabled. MS2 spectra were acquired in the ion trap at Turbo scan rate, HCD collision energy was set to 32% and 35 ms maximum-injection time was allowed. MS2 scans were searched against the human canonical and isoforms database (UniProt, 16 December 2022) using the Comet search engine in real time with the following filters: tryptic peptides with maximum of 1 missed cleavages, static modifications included Cys carbamidomethylation (+57.0215) and N-terminal/Lys TMTpro (+304.2071), variable modifications Asn/Gln deamidation (+0.984) and Met oxidation (+15.9949), with maximum of variable modifications set to 2; close-out was enabled with a maximum of 4 peptides per protein. Precursors matching these criteria were selected for SPS10-MS3 scans performed at an orbitrap resolution of 45,000 with the normalized HCD collision energy set to 55%, AGC set at 200% and 200 ms maximum injection time. Acetyl-enriched peptides were analysed using an MS2-HCD method with collision energy set to 35%, AGC set at 1 × 105 and 105 ms maximum injection time. The SequestHT and Comet search engines were used to analyse the acquired spectra in Proteome Discoverer v.3.0 (Thermo Fisher Scientific) for protein identification and quantification. For analysis of the chromatin proteome, the precursor mass was set to 20 ppm and fragment mass tolerance was 0.5 Da. Spectra were searched for fully tryptic peptides with a maximum of two missed cleavages. N-terminal/Lys TMTpro and carbamidomethyl at Cys were defined as static modifications. Dynamic modifications included oxidation of Met and deamidation of Asn/Gln. For peptides enriched for acetylated lysine, the precursor mass was set to 10 ppm and the fragment mass tolerance was set to 0.02 Da. Spectra were searched for fully tryptic peptides with a maximum of three missed cleavages. N-terminal TMTpro and carbamidomethyl at Cys were defined as static modifications, while dynamic modifications included oxidation of Met, deamidation of Asn/Gln, and TMTpro or acetyl at Lys. Peptide confidence was estimated using the Percolator node. Peptide FDR was set at 1% and validation was based on q value and a target–decoy database search. Spectra were searched against reviewed UniProt human protein entries. The reporter ion quantifier node included a TMTpro quantification method with an integration window tolerance of 15 ppm and an integration method based on the most confident centroid peak at the MS3 or MS2 level. Only unique peptides were used for quantification, considering protein groups for peptide uniqueness. Peptides with an average reporter signal-to-noise ratio of >3 were used for quantification. For the chromatin proteome, the data were normalized to total loading at the proteome level, whereas, for the respective acetylome, the data were corrected for loading for acetylated peptides only. Relative abundances were calculated by dividing normalized protein/peptide abundances by the average abundance of all TMTpro channels per biological replicate.

    Immunoblotting and immunofluorescence

    Cells were scraped from dishes in 2× SDS buffer (120 mM Tris-HCl pH 6.8, 4% SDS, 20% glycerol). After total protein quantification, equal protein amounts were run on 4–12% Bis-Tris NuPAGE precast gels, transferred to nitrocellulose membrane (GE Healthcare) and immunoblotted with the indicated antibodies. For chromatin fractionation, cells were washed with cold PBS and resuspended in CSK buffer (10 mM PIPES pH 7.0, 100 mM NaCl, 300 mM sucrose, 3 mM MgCl2, protein inhibitor cocktail (Roche, EDTA-free, 1 tablet per 10 ml), EGTA-free phosphatase inhibitors (1 mM NaF, 0.7 mM β-glycerol phosphate, 0.2 mM Na3VO4, 8.4 mM Na4P2O7), 0.7% Triton X-100), incubated on ice for 30 min and centrifuged at 20,000g for 10 min at 4 °C. The supernatant (soluble fraction) was collected and maintained on ice. The pellet was washed twice with cold PBS and sonicated (four pulses of 10 s at 30% amplitude with 10 s resting on ice between cycles) in CSK buffer. The protein concentration of soluble and chromatin fractions was determined using the Bradford assay and Laemmli buffer was added to the samples. Finally, the samples were boiled, centrifuged at 16,000g for 1 min and equal amounts were loaded onto SDS–PAGE gels. For immunofluorescence studies, cells on coverslips were fixed in a formaldehyde lysis solution (4% formaldehyde, 0.5% Triton X-100, 1× PBS), washed with 1× PBS and permeabilized in 0.5% Triton X-100, 1× PBS. Blocking was performed in 1× PBS, 0.1% Triton X-100, 10% FBS for 1 h, followed by incubation with primary or secondary antibodies in the same solution. Washes were performed using 1× PBST (1× PBS, 0.1% Triton X-100). Coverslips were mounted in Vectashield Mounting Medium with DAPI (Vector Laboratories, H1200-10). Images were collected on the Leica SP8 with ×63/1.4 NA oil objectives, using the Leica Application Suite X software (LAS-X). Images were deconvolved using Huygens Professional v.19.04 software (Scientific Volume Imaging); processing and analysis were performed using ImageJ v.1.53a and Adobe Illustrator 2021. All of the images shown are the projections of z optical sections.

    SIRT1 inhibition assays

    Cells were preincubated with EX 527 (selisistat; SIRT1i; Selleckchem) resuspended in DMSO or with DMSO alone for 3 days and then seeded at a density of 2.5 × 105 cells per 10 cm dish, maintaining either SIRT1i or DMSO in the culture medium. The next day, cells were treated with tamoxifen or mock treated for 24 h. The number of living cells at each timepoint was determined after trypsinization using the Countess II machine (Life Technologies). To determine the dose of tamoxifen that resulted in full depletion of DSCC1 in the hTERT RPE-1 DSCC1Δ/floxcretam cell line, cells were grown in the presence of different concentrations of the compound. After 3 days of tamoxifen treatment (Sigma-Aldrich), cell survival was observed by staining with crystal violet (Sigma-Aldrich; 1% aqueous solution). The dose that killed all DSCC1Δ/floxcretam cells, but not WT hTERT RPE-1 control cells (100 nM), was used for subsequent experiments (Extended Data Fig. 7). To determine the dose of SIRT1i that fully inhibits SIRT1 activity in cultured hTERT RPE-1 cells, the acetylation of p53 at Lys382, a bona fide SIRT1 substrate86, was examined. Cells were grown in the presence of different concentrations of SIRT1i for 3 days (Extended Data Fig. 9). To avoid interference from other histone deacetylases 5 µM vorinostat (Sigma-Aldrich) was added to the cells 2 h before gamma irradiation (5 Gy). Then, 3 h later, the samples were collected and acetylation of p53 at Lys382 was examined using western blotting.

    SIRT1 in vitro deacetylation assay

    These experiments were performed in HDAC8-KO HAP1 cells (Horizon Discovery) and also hTERT RPE-1 cells (Extended Data Fig. 9). p53 (a known SIRT1 target) was purified 5 h after gamma irradiation (10 Gy) of hTERT RPE-1 cells that were previously treated with 10 µM selisistat and 5 µM vorinostat (SAHA; Sigma-Merk, SML0061). SMC3 was purified from exponentially growing HDAC8-KO HAP1 cells. Both proteins (p53 and SMC3) were purified by immunoprecipitation as follows: cell pellets were resuspended in lysis buffer (50 mM Tris-Cl pH 8, 150 mM NaCl, 1 mM EDTA, 0.5% igepal, complete EDTA-free protein inhibitor cocktail from Roche and phosphatase inhibitor cocktails 2 and 3 from Sigma-Aldrich) and quantified. For p53, 2 mg of protein from hTERT-RPE-1 cell lysates was incubated with 20 μl of Dynabeads (protein G) and 6 μl of anti-p53 antibodies. For SMC3, 10 mg of HAP1 cell lysate was incubated with 40 μl of Dynabeads (protein A) and 12 μg of anti-SMC3 antibodies. Both incubations were performed overnight at 4 °C. The next morning, the beads were washed four times with cold lysis buffer and twice with reaction buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM MgCl2) and resuspended in 50 μl of reaction buffer. For the deacetylation reaction, 10 μl of beads was incubated with 1 μl of human recombinant SIRT1 (Sigma-Aldrich) in a total volume of 30 μl of reaction buffer supplemented with 1.5 μM NAD+. The reactions were incubated for 3 h at 30 °C with shaking. Finally, the reactions were stopped by the addition of 10 μl of 4× Laemmli sample buffer and incubation at 95 °C for 5 min. The samples were then immunoblotted with the respective antibodies.

    siRNA experiments in RPE-1 cells

    A total of 200,000 RPE-1 DSCC1Δ/floxcretam cells were seeded per well of a six-well plate and allowed to attach overnight. The cells were then transfected with either non-targeting (referred to as SCR control) or targeting siRNA at 25 nM using 5 µl DharmaFECT 1 transfection reagent (Horizon Discovery T-2001-02) according to the manufacturer’s instructions. After 24 h, the medium was replaced in all wells and cells were treated with or without 100 nM 4-OHT. Cells were incubated for a further 5 days before collecting and cell counting by trypan blue exclusion. A list of all siRNAs used is provided in Supplementary Table 6.

    MN counting in HAP1 cells

    HAP1 cells were seeded at an equal density, grown on coverslips and transfected with siRNAs targeting luciferase or DSCC1. All siRNAs were ON-TARGETplus SMARTpools manufactured by Dharmacon and used at a final concentration of 20 μM per siRNA. Transfections were performed using Invitrogen RNAiMAX (Life Technologies) according to the manufacturer’s instructions. Transfections were repeated after 48 h. After an additional 24 h, the coverslips were fixed with freshly prepared 3.7% paraformaldehyde in PBS for 7 min at room temperature. Cells were permeabilized and stained for 10 min with 0.1% Triton X-100 in PBS, supplemented with 1 μg ml−1 DAPI at room temperature. The coverslips were washed once with PBS, and mounted onto glass slides using Prolong Gold (Invitrogen). The slides were imaged and deconvolved on the THUNDER Imager (Leica Microsystems) and analysed using ImageJ (v.2.1.0/1.53k). A cell was scored as harbouring MN when the nucleus had one or more MN in its proximity. At least 400 cells were scored per condition.

    Analysis of cohesion defects in RPE-1 TP53-KO and RPE-1 TP53/
    DSCC1-double-KO cells

    RPE-1 TP53/DSCC1-double-KO cells were generated as previously reported51 and were cultured in DMEM + 8% FCS. For analysis of cohesion defects, cells were incubated for 20 min with 200 ng ml−1 demecolcine (Sigma-Aldrich), collected, incubated for 20 min in 0.075 M KCl and fixed in 3:1 methanol:acetic acid. Cells were washed in fixative three times, dropped onto microscopy slides and stained with 5% Giemsa (Merck). For each condition, cohesion defects were counted in 50 metaphases on two coded slides.

    Statistics and reproducibility

    Statistical analyses were performed using Prism (v.9.1.0/v.10.1, GraphPad) or R (v.3/v.4.3.1). All statistical details are provided in the figure legends. All experiments were performed independently at least three times, and were replicated by independent researchers using multiple models and using blinding where possible. T-tests were unpaired. 

    Reporting summary

    Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

    [ad_2]

    Source link