Tag: multidisciplinary

  • Kondrakiewicz, K., Kostecki, M., Szadzinska, W. & Knapska, E. Ecological validity of social interaction tests in rats and mice. Genes Brain Behav. 18, e12525 (2019).

    Article 
    PubMed 

    Google Scholar
     

  • Olsson, A., Knapska, E. & Lindstrom, B. The neural and computational systems of social learning. Nat. Rev. Neurosci. 21, 197–212 (2020).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Burgos-Robles, A., Gothard, K. M., Monfils, M. H., Morozov, A. & Vicentic, A. Conserved features of anterior cingulate networks support observational learning across species. Neurosci. Biobehav. Rev. 107, 215–228 (2019).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Keum, S. & Shin, H. S. Rodent models for studying empathy. Neurobiol. Learn. Mem. 135, 22–26 (2016).

    Article 
    PubMed 

    Google Scholar
     

  • Blanchard, D. C., Griebel, G., Pobbe, R. & Blanchard, R. J. Risk assessment as an evolved threat detection and analysis process. Neurosci. Biobehav. Rev. 35, 991–998 (2011).

    Article 
    PubMed 

    Google Scholar
     

  • Qi, S. et al. How cognitive and reactive fear circuits optimize escape decisions in humans. Proc. Natl Acad. Sci. USA 115, 3186–3191 (2018).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Fanselow, M. S. Neural organization of the defensive behavior system responsible for fear. Psychon. Bull. Rev. 1, 429–438 (1994).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • LeDoux, J. E. & Pine, D. S. Using neuroscience to help understand fear and anxiety: a two-system framework. Am. J. Psychiatry 173, 1083–1093 (2016).

    Article 
    PubMed 

    Google Scholar
     

  • Jercog, D. et al. Dynamical prefrontal population coding during defensive behaviours. Nature 595, 690–694 (2021).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Mobbs, D. The ethological deconstruction of fear(s). Curr. Opin. Behav. Sci. 24, 32–37 (2018).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Sharpe, M. J. & Killcross, S. Modulation of attention and action in the medial prefrontal cortex of rats. Psychol. Rev. 125, 822–843 (2018).

    Article 
    PubMed 

    Google Scholar
     

  • DSM-5. Diagnostic and Statistical Manual of Mental Disorders, 4th edn (APA Press, 2013).

  • Kim, A., Keum, S. & Shin, H. S. Observational fear behavior in rodents as a model for empathy. Genes Brain Behav. 18, e12521 (2019).

    Article 
    PubMed 

    Google Scholar
     

  • Preston, S. D. & de Waal, F. B. Empathy: its ultimate and proximate bases. Behav. Brain Sci. 25, 1–20 (2002).

    Article 
    PubMed 

    Google Scholar
     

  • Cummings, K. A. & Clem, R. L. Prefrontal somatostatin interneurons encode fear memory. Nat. Neurosci. 23, 61–74 (2020).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Yizhar, O. & Levy, D. R. The social dilemma: prefrontal control of mammalian sociability. Curr. Opin. Neurobiol. 68, 67–75 (2021).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Chen, P. & Hong, W. Neural circuit mechanisms of social behavior. Neuron 98, 16–30 (2018).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Liang, B. et al. Distinct and dynamic ON and OFF neural ensembles in the prefrontal cortex code social exploration. Neuron 100, 700–714.e709 (2018).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Wu, Y. E. et al. Neural control of affiliative touch in prosocial interaction. Nature 599, 262–267 (2021).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Padilla-Coreano, N. et al. Cortical ensembles orchestrate social competition through hypothalamic outputs. Nature 603, 667–671 (2022).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Ito, W., Palmer, A. J. & Morozov, A. Social synchronization of conditioned fear in mice requires ventral hippocampus input to the amygdala. Biol. Psychiatry 93, 322–330 (2023).

    Article 
    PubMed 

    Google Scholar
     

  • Scheggia, D. et al. Somatostatin interneurons in the prefrontal cortex control affective state discrimination in mice. Nat. Neurosci. 23, 47–60 (2020).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Piva, M. et al. The dorsomedial prefrontal cortex computes task-invariant relative subjective value for self and other. eLife 8, e44939 (2019).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Wang, F. et al. Bidirectional control of social hierarchy by synaptic efficacy in medial prefrontal cortex. Science 334, 693–697 (2011).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Murugan, M. et al. Combined social and spatial coding in a descending projection from the prefrontal cortex. Cell 171, 1663–1677.e1616 (2017).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Yusufishaq, S. & Rosenkranz, J. A. Post-weaning social isolation impairs observational fear conditioning. Behav. Brain Res. 242, 142–149 (2013).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Allsop, S. A. et al. Corticoamygdala transfer of socially derived information gates observational learning. Cell 173, 1329–1342.e1318 (2018).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Jeon, D. et al. Observational fear learning involves affective pain system and Cav1.2 Ca2+ channels in ACC. Nat. Neurosci. 13, 482–488 (2010).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Keum, S. & Shin, H. S. Neural basis of observational fear learning: a potential model of affective empathy. Neuron 104, 78–86 (2019).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Paradiso, E., Gazzola, V. & Keysers, C. Neural mechanisms necessary for empathy-related phenomena across species. Curr. Opin. Neurobiol. 68, 107–115 (2021).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Smith, M. L., Asada, N. & Malenka, R. C. Anterior cingulate inputs to nucleus accumbens control the social transfer of pain and analgesia. Science 371, 153–159 (2021).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Fillinger, C., Yalcin, I., Barrot, M. & Veinante, P. Efferents of anterior cingulate areas 24a and 24b and midcingulate areas 24a′ and 24b′ in the mouse. Brain Struct. Funct. 223, 1747–1778 (2018).

    PubMed 

    Google Scholar
     

  • Sierra-Mercado, D., Padilla-Coreano, N. & Quirk, G. J. Dissociable roles of prelimbic and infralimbic cortices, ventral hippocampus, and basolateral amygdala in the expression and extinction of conditioned fear. Neuropsychopharmacology 36, 529–538 (2011).

    Article 
    PubMed 

    Google Scholar
     

  • Halladay, L. R. & Blair, H. T. Distinct ensembles of medial prefrontal cortex neurons are activated by threatening stimuli that elicit excitation vs. inhibition of movement. J Neurophysiol. 114, 793–807 (2015).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Padilla-Coreano, N., Tye, K. M. & Zelikowsky, M. Dynamic influences on the neural encoding of social valence. Nat. Rev. Neurosci. 23, 535–550 (2022).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Huang, Z. et al. Ventromedial prefrontal neurons represent self-states shaped by vicarious fear in male mice. Nat. Commun. 14, 3458 (2023).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Franklin, T. B. et al. Prefrontal cortical control of a brainstem social behavior circuit. Nat. Neurosci. 20, 260–270 (2017).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Siciliano, C. A. et al. A cortical–brainstem circuit predicts and governs compulsive alcohol drinking. Science 366, 1008–1012 (2019).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Vander Weele, C. M. et al. Dopamine enhances signal-to-noise ratio in cortical-brainstem encoding of aversive stimuli. Nature 563, 397–401 (2018).

    Article 
    ADS 

    Google Scholar
     

  • Assareh, N., Bagley, E. E., Carrive, P. & McNally, G. P. Brief optogenetic inhibition of rat lateral or ventrolateral periaqueductal gray augments the acquisition of Pavlovian fear conditioning. Behav. Neurosci. 131, 454–459 (2017).

    Article 
    PubMed 

    Google Scholar
     

  • Courtin, J. et al. Prefrontal parvalbumin interneurons shape neuronal activity to drive fear expression. Nature 505, 92–96 (2014).

    Article 
    ADS 
    PubMed 

    Google Scholar
     

  • Ozawa, T. et al. A feedback neural circuit for calibrating aversive memory strength. Nat. Neurosci. 20, 90–97 (2017).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Haaker, J., Yi, J., Petrovic, P. & Olsson, A. Endogenous opioids regulate social threat learning in humans. Nat. Commun. 8, 15495 (2017).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Huang, J. et al. A neuronal circuit for activating descending modulation of neuropathic pain. Nat. Neurosci. 22, 1659–1668 (2019).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Rozeske, R. R. et al. Prefrontal–periaqueductal gray-projecting neurons mediate context fear discrimination. Neuron 97, 898–910.e896 (2018).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Anastasiades, P. G., Marlin, J. J. & Carter, A. G. Cell-type specificity of callosally evoked excitation and feedforward inhibition in the prefrontal cortex. Cell Rep. 22, 679–692 (2018).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Senn, V. et al. Long-range connectivity defines behavioral specificity of amygdala neurons. Neuron 81, 428–437 (2014).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Sotres-Bayon, F., Sierra-Mercado, D., Pardilla-Delgado, E. & Quirk, G. J. Gating of fear in prelimbic cortex by hippocampal and amygdala inputs. Neuron 76, 804–812 (2012).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Hagihara, K. M. et al. Intercalated amygdala clusters orchestrate a switch in fear state. Nature 594, 403–407 (2021).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • McGarry, L. M. & Carter, A. G. Inhibitory gating of basolateral amygdala inputs to the prefrontal cortex. J. Neurosci. 36, 9391–9406 (2016).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Anderson, S. W., Bechara, A., Damasio, H., Tranel, D. & Damasio, A. R. Impairment of social and moral behavior related to early damage in human prefrontal cortex. Nat. Neurosci. 2, 1032–1037 (1999).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Shin, L. M., Rauch, S. L. & Pitman, R. K. Amygdala, medial prefrontal cortex, and hippocampal function in PTSD. Ann. NY Acad. Sci. 1071, 67–79 (2006).

    Article 
    ADS 
    PubMed 

    Google Scholar
     

  • Jeon, D. & Shin, H. S. in Current Protocols in Neuroscience (eds. Crawley, J. N. et al.) Ch. 8, Unit 8 27 (2011).

  • Holmes, A. & Rodgers, R. J. Prior exposure to the elevated plus-maze sensitizes mice to the acute behavioral effects of fluoxetine and phenelzine. Eur. J. Pharmacol. 459, 221–230 (2003).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Karlsson, R. M., Tanaka, K., Heilig, M. & Holmes, A. Loss of glial glutamate and aspartate transporter (excitatory amino acid transporter 1) causes locomotor hyperactivity and exaggerated responses to psychotomimetics: rescue by haloperidol and metabotropic glutamate 2/3 agonist. Biol. Psychiatry 64, 810–814 (2008).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Feyder, M. et al. Association of mouse Dlg4 (PSD-95) gene deletion and human DLG4 gene variation with phenotypes relevant to autism spectrum disorders and Williams’ syndrome. Am. J. Psychiatry 167, 1508–1517 (2010).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Gunduz-Cinar, O. et al. A cortico-amygdala neural substrate for endocannabinoid modulation of fear extinction. Neuron 111, 3053–-3067.e10 (2023).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Halladay, L. R. et al. Prefrontal regulation of punished ethanol self-administration. Biol. Psychiatry 87, 967–978 (2020).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Eastwood, B. S. et al. Whole mouse brain reconstruction and registration to a reference atlas with standard histochemical processing of coronal sections. J. Comp. Neurol. 527, 2170–2178 (2019).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Ahrlund-Richter, S. et al. A whole-brain atlas of monosynaptic input targeting four different cell types in the medial prefrontal cortex of the mouse. Nat. Neurosci. 22, 657–668 (2019).

    Article 
    PubMed 

    Google Scholar
     

  • Sengupta, A. & Holmes, A. A discrete dorsal raphe to basal amygdala 5-HT circuit calibrates aversive memory. Neuron 103, 489–505.e487 (2019).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

[ad_2]

Source link

  • A recently formed ocean inside Saturn’s moon Mimas

    [ad_1]

  • Castillo-Rogez, J. et al. Compositions and interior structures of the large moons of Uranus and implications for future spacecraft observations. J. Geophys. Res. Planets 128, e2022JE007432 (2023).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Ćuk, M., Dones, L. & Nesvorný, D. Dynamical evidence for a late formation of Saturn’s moons. Astrophys. J. 820, 97 (2016).

    Article 

    Google Scholar
     

  • Rhoden, A. R. & Walker, M. E. The case for an ocean-bearing Mimas from tidal heating analysis. Icarus 376, 114872 (2022).

    Article 

    Google Scholar
     

  • Tajeddine, R. et al. Constraints on Mimas’ interior from Cassini ISS libration measurements. Science 346, 322–324 (2014).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Borderies, N. & Yoder, C. F. Phobos’ gravity field and its influence on its orbit and physical librations. Astron. Astrophys. 233, 235–251 (1990).


    Google Scholar
     

  • Lainey, V., Rambaux, N., Cooper, N. & Zhang, Q. Characterizing the interior of five inner Saturnian moons using Cassini ISS data. Astron. Astrophys. 670, L25 (2023).

    Article 

    Google Scholar
     

  • Viswanathan, V., Rambaux, N., Fienga, A., Laskar, J. & Gastineau, M. Observational constraint on the radius and oblateness of the lunar core–mantle boundary. Geophys. Res. Lett. 46, 7295–7303 (2019).

    Article 

    Google Scholar
     

  • Balmino, G. Gravitational potential harmonics from the shape of an homogeneous body. Celest. Mech. Dyn. Astron. 60, 331–364 (1994).

    Article 

    Google Scholar
     

  • Tobie, G., Grasset, O., Lunine, J. I., Mocquet, A. & Sotin, C. Titan’s internal structure inferred from a coupled thermal–orbital model. Icarus 175, 496–502 (2005).

    Article 
    CAS 

    Google Scholar
     

  • Tobie, G., Mocquet, A. & Sotin, C. Tidal dissipation within large icy satellites: applications to Europa and Titan. Icarus 177, 534–549 (2005).

    Article 

    Google Scholar
     

  • Cadek, O. et al. Long-term stability of Enceladus’ uneven ice shell. Icarus 319, 476–484 (2019).

    Article 

    Google Scholar
     

  • Ćuk, M. & El Moutamid, M. Three-body resonances in the Saturnian system. Astrophys. J. 926, L18 (2022).

  • Baillié, K., Noyelles, B., Lainey, V., Charnoz, S. & Tobie, G. Formation of the Cassini Division—I. Shaping the rings by Mimas inward migration. Mon. Not. R. Astron. Soc. 486, 2933–2946 (2019).

    Article 

    Google Scholar
     

  • Noyelles, B., Baillié, K., Charnoz, S., Lainey, V. & Tobie, G. Formation of the Cassini Division—II. Possible histories of Mimas and Enceladus. Mon. Not. R. Astron. Soc. 486, 2947–2963 (2019).

    Article 

    Google Scholar
     

  • Wisdom, J. et al. Loss of a satellite could explain Saturn’s obliquity and young rings. Science 377, 1285–1289 (2022).

    Article 
    MathSciNet 
    CAS 
    PubMed 

    Google Scholar
     

  • Lainey, V. et al. Strong tidal dissipation in Saturn and constraints on Enceladus’ thermal state from astrometry. Astrophys. J. 752, 14 (2012).

  • Lainey, V. et al. New constraints on Saturn’s interior from Cassini astrometric data. Icarus 281, 286–296 (2017).

    Article 

    Google Scholar
     

  • Lainey, V. et al. Resonance locking in giant planets indicated by the rapid orbital expansion of Titan. Nat. Astron. 4, 1053–1058 (2020).

    Article 

    Google Scholar
     

  • Zandanel, A. et al. Short lifespans of serpentinization in the rocky core of Enceladus: implications for hydrogen production. Icarus 364, 114461 (2021).

  • Zandanel, A. et al. Geologically rapid aqueous mineral alteration at subfreezing temperatures in icy worlds. Nat. Astron. 6, 554–559 (2022).

    Article 

    Google Scholar
     

  • Cooper, N. J. et al. The Caviar software package for the astrometric reduction of Cassini ISS images: description and examples. Astron. Astrophys. 610, A2 (2018).

    Article 

    Google Scholar
     

  • Rambaux, N., Lainey, V., Cooper, N., Auzemery, L. & Zhang, Q. F. Spherical harmonic decomposition and interpretation of the shapes of the small Saturnian inner moons. Astron. Astrophys. 667, A78 (2022).

    Article 

    Google Scholar
     

  • Zhang, Q. F. et al. A comparison of centring algorithms in the astrometry of Cassini imaging science subsystem images and Anthe’s astrometric reduction. Mon. Not. R. Astron. Soc. 505, 5253–5259 (2021).

    Article 

    Google Scholar
     

  • Iess, L. et al. Measurement and implications of Saturn’s gravity field and ring mass. Science 364, aat2965 (2019).

    Article 

    Google Scholar
     

  • Iess, L. et al. The tides of Titan. Science 337, 457–459 (2012).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Iess, L. et al. The gravity field and interior structure of Enceladus. Science 344, 78–80 (2014).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Militzer, B. & Hubbard, W. Relation of gravity, winds, and the moment of inertia of Jupiter and Saturn. Planet. Sci. J. 4, 95 (2023).

  • French, R. G. et al. Astrometry of Saturn’s satellites from the Hubble Space Telescope WFPC2. Publ. Astron. Soc. Pac. 118, 246–259 (2006).

    Article 

    Google Scholar
     

  • Jacobson, R. A. The orbits and masses of the Martian satellites and the libration of Phobos. Astron. J 139, 668–679 (2010).

    Article 

    Google Scholar
     

  • Lainey, V. et al. Interior properties of the inner Saturnian moons from space astrometry data. Icarus 326, 48–62 (2019).

    Article 

    Google Scholar
     

  • Van Hoolst, T., Rambaux, N., Karatekin, Ö., Dehant, V. & Rivoldini, A. The librations, shape, and icy shell of Europa. Icarus 195, 386–399 (2008).

    Article 

    Google Scholar
     

  • Rambaux, N., van Hoolst, T. & Karatekin, Ö. Librational response of Europa, Ganymede, and Callisto with an ocean for a non-Keplerian orbit. Astron. Astrophys. 527, A118 (2011).

    Article 

    Google Scholar
     

  • Richard, A., Rambaux, N. & Charnay, B. Librational response of a deformed 3-layer Titan perturbed by non-Keplerian orbit and atmospheric couplings. Planet. Space Sci. 93, 22–34 (2014).

    Article 

    Google Scholar
     

  • Xu, S. & Szeto, A. M. K. Gravitational coupling in the Earth’s interior revisited. Geophys. J. Int. 118, 94–100 (1994).

    Article 

    Google Scholar
     

  • Thomas, P. C. et al. Shapes of the Saturnian icy satellites and their significance. Icarus 190, 573–584 (2007).

    Article 
    CAS 

    Google Scholar
     

  • Choblet, G. et al. Powering prolonged hydrothermal activity inside Enceladus. Nat. Astron. 1, 841–847 (2017).

    Article 

    Google Scholar
     

  • Castillo-Rogez, J. C., Efroimsky, M. & Lainey, V. The tidal history of Lapetus: spin dynamics in the light of a refined dissipation model. J. Geophys. Res. 116, E09008 (2011).


    Google Scholar
     

  • Saito, M. Some problems of static deformation of the Earth. J. Phys. Earth 22, 123–140 (1974).

    Article 

    Google Scholar
     

  • Takeushi, H. & Saito, M. in Methods in Computational Physics Vol. 1 (ed. Bolt, B. A.) 217–295 (Academic Press, 1972).

  • Grasset, O. & Pargamin, J. The ammonia water system at high pressures: implications for the methane of Titan. Planet. Space Sci. 53, 371–384 (2005).

    Article 
    CAS 

    Google Scholar
     

  • Waite, J. H. et al. Cassini finds molecular hydrogen in the Enceladus plume: evidence for hydrothermal processes. Science 356, 155–159 (2017).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • [ad_2]

    Source link

  • Transforming a head direction signal into a goal-oriented steering command

    [ad_1]

    Flies

    Unless otherwise specified, flies were raised on cornmeal-molasses food (Archon Scientific) in an incubator on a 12 h:12 h light:dark cycle at 25 °C at 50–70% relative humidity. Experimenters were not blinded to fly genotype. For iontophoresis stimulus experiments (Fig. 2a,b) flies were grouped for analysis based on genotype. Sample sizes were chosen based on conventions in our field for standard sample sizes; these sample sizes are conventionally determined on the basis of the expected magnitude of animal-to-animal variability, given published results and pilot data. All experiments used flies with at least one wild-type copy of the white (w) gene. Genotypes used in each figure are as follows.

    Fig. 1:

    PFL2 and PFL3 calcium imaging, w/+;P{VT033284-p65AD}attP40/20XUAS-IVS-cyRFP{VK00037}; P{y[+t7.7];w[+mC]=VT044709-GAL4.DBD}attP2/PBac{y[+t7.7] w[+mC]=20XUAS-IVS-jGCaMP7b}VK00005.

    PFL2 calcium imaging, w/+;P{VT033284-p65AD}attP40/20XUAS-IVS-cyRFP{VK00037}; P{y[+t7.7];P{VT007338-Gal4DBD}attP2/PBac{y[+t7.7] w[+mC]=20XUAS-IVS-jGCaMP7b}VK00005.

    Fig. 2:

    PFL2 cells expressing P2X2, w/+;P{VT033284-p65AD}attP40/P{w[+mC]=UAS-Rnor\P2rx2.L}4/;P{VT007338-Gal4DBD}attP2/20XUAS-mCD8::GFP {attP2}.

    Empty split control,

    w/+;P{y[+t7.7] w[+mC]=p65.AD.Uw}attP40/P{w[+mC]=UAS-Rnor\P2rx2.L}4;P{y[+t7.7] w[+mC]=GAL4.DBD.Uw}attP2/20XUAS-mCD8::GFP {attP2}.

    PFL2 calcium imaging,

    w/+;P{VT033284-p65AD}attP40/20XUAS-IVS-cyRFP{VK00037}; P{y[+t7.7];P{VT007338-Gal4DBD}attP2/PBac{y[+t7.7] w[+mC]=20XUAS-IVS-jGCaMP7b}VK00005.

    Fig. 3:

    PFL2 calcium imaging,

    w/+;P{VT033284-p65AD}attP40/20XUAS-IVS-cyRFP{VK00037}; P{y[+t7.7];P{VT007338-Gal4DBD}attP2/PBac{y[+t7.7] w[+mC]=20XUAS-IVS-jGCaMP7b}VK00005.

    PFL2 and PFL3 calcium imaging,

    w/+;P{VT033284-p65AD}attP40/20XUAS-IVS-cyRFP{VK00037}; P{y[+t7.7];w[+mC]=VT044709-GAL4.DBD}attP2/PBac{y[+t7.7] w[+mC]=20XUAS-IVS-jGCaMP7b}VK00005.

    Fig. 4:

    w/+;P{VT033284-p65AD}attP40/P{20XUAS-IVS-mCD8::GFP}attP40;P{y[+t7.7] w[+mC]=VT044709-GAL4.DBD}attP2/+.

    Fig. 5:

    PFL2 calcium imaging,

    w/+;P{VT033284-p65AD}attP40/20XUAS-IVS-cyRFP{VK00037}; P{y[+t7.7];P{VT007338-Gal4DBD}attP2/PBac{y[+t7.7] w[+mC]=20XUAS-IVS-jGCaMP7b}VK00005.

    PFL2 and PFL3 recordings,

    w/+;P{VT033284-p65AD}attP40/P{20XUAS-IVS-mCD8::GFP}attP40;P{y[+t7.7] w[+mC]=VT044709-GAL4.DBD}attP2/+.

    Extended Data Fig. 2:

    MCFO, w[1118] P{y[+t7.7] w[+mC]=R57C10-FLPG5}su(Hw)attP8; PBac{y[+mDint2] w[+mC]=10xUAS(FRT.stop)myr::smGdP-HA}VK00005 P{y[+t7.7] w[+mC]=10xUAS(FRT.stop)myr::smGdP-V5-THS-10xUAS(FRT.stop)myr::smGdP-FLAG}su(Hw)attP1.

    PFL2 and PFL3 line:

    w/+;P{VT033284-p65AD}attP40/P{20XUAS-IVS-mCD8::GFP}attP40;P{y[+t7.7] w[+mC]=VT044709-GAL4.DBD}attP2/+.

    PFL2 line:

    w/+;P{VT033284-p65AD}attP40/P{20XUAS-IVS-mCD8::GFP}attP40; P{y[+t7.7];P{VT007338-Gal4DBD}attP2/+.

    Extended Data Fig. 3:

    PFL2 calcium imaging,

    w/+;P{VT033284-p65AD}attP40/20XUAS-IVS-cyRFP{VK00037}; P{y[+t7.7];P{VT007338-Gal4DBD}attP2/PBac{y[+t7.7] w[+mC]=20XUAS-IVS-jGCaMP7b}VK00005.

    PFL2 and PFL3 calcium imaging,

    w/+;P{VT033284-p65AD}attP40/20XUAS-IVS-cyRFP{VK00037}; P{y[+t7.7];w[+mC]=VT044709-GAL4.DBD}attP2/PBac{y[+t7.7] w[+mC]=20XUAS-IVS-jGCaMP7b}VK00005.

    Extended Data Fig. 4:

    PFL2 cells expressing P2X2, w/+;P{VT033284-p65AD}attP40/P{w[+mC]=UAS-Rnor\P2rx2.L}4/;P{VT007338-Gal4DBD}attP2/20XUAS-mCD8::GFP {attP2}.

    Empty split control,

    w/+;P{y[+t7.7] w[+mC]=p65.AD.Uw}attP40/P{w[+mC]=UAS-Rnor\P2rx2.L}4;P{y[+t7.7] w[+mC]=GAL4.DBD.Uw}attP2/20XUAS-mCD8::GFP {attP2}.

    Extended Data Fig. 5:

    PFL2 calcium imaging,

    w/+;P{VT033284-p65AD}attP40/20XUAS-IVS-cyRFP{VK00037}; P{y[+t7.7];P{VT007338-Gal4DBD}attP2/PBac{y[+t7.7] w[+mC]=20XUAS-IVS-jGCaMP7b}VK00005.

    PFL2 and PFL3 calcium imaging,

    w/+;P{VT033284-p65AD}attP40/20XUAS-IVS-cyRFP{VK00037}; P{y[+t7.7];w[+mC]=VT044709-GAL4.DBD}attP2/PBac{y[+t7.7] w[+mC]=20XUAS-IVS-jGCaMP7b}VK00005.

    Extended Data Fig. 6:

    w/+;P{VT033284-p65AD}attP40/P{20XUAS-IVS-mCD8::GFP}attP40;P{y[+t7.7] w[+mC]=VT044709-GAL4.DBD}attP2/+.

    Extended Data Fig. 7:

    w/+;P{VT033284-p65AD}attP40/P{20XUAS-IVS-mCD8::GFP}attP40;P{y[+t7.7] w[+mC]=VT044709-GAL4.DBD}attP2/+.

    Extended Data Fig. 8–10:

    PFL2 calcium imaging,

    w/+;P{VT033284-p65AD}attP40/20XUAS-IVS-cyRFP{VK00037}; P{y[+t7.7];P{VT007338-Gal4DBD}attP2/PBac{y[+t7.7] w[+mC]=20XUAS-IVS-jGCaMP7b}VK00005.

    Origins of transgenic stocks

    The following stocks were obtained from the Bloomington Drosophila Stock Center (BDSC) and previously published as follows: P{y[+t7.7]w[+mC]=VT044709-GAL4.DBD}attP2 (BDSC_75555)41, P{y[+t7.7] w[+mC]=p65.AD.Uw}attP40; P{y[+t7.7] w[+mC]=GAL4.DBD.Uw}attP2 (BDSC_79603), P{w[+mC]=UAS-Rnor\P2rx2.L}4/CyO (BDSC_91223)42, w[1118] P{y[+t7.7] w[+mC]=R57C10-FLPG5}su(Hw)attP8; PBac{y[+mDint2] w[+mC]=10xUAS(FRT.stop)myr::smGdP-HA}VK00005 P{y[+t7.7] w[+mC]=10xUAS(FRT.stop)myr::smGdP-V5-THS-10xUAS(FRT.stop)myr::smGdP-FLAG}su(Hw)attP1 (BDSC_64088)43.

    The following stocks were obtained from WellGenetics: w[1118];P{VT007338-p65ADZp}attP40/CyO;+ (SWG9178/A), w[1118];P{VT033284-p65AD}attP40/CyO;+ (A/SWG8077). Using these lines, we constructed a split-Gal4 line whose expression in the lateral accessory lobe (LAL) is specific to PFL2 and PFL3 cells (+;P{VT033284-p65AD}attP40;P{y[+t7.7] w[+mC]=VT044709-GAL4.DBD}attP2). We validated the expression of this line using immunohistochemical anti-GFP staining and also using Multi-Color-Flip-Out (MCFO)43 to visualize single-cell morphologies. This line has significant non-specific expression throughout the brain but is specific for PFL2 and PFL3 in the LAL. We also constructed a split-Gal4 line to target PFL2 neurons, +;P{VT033284-p65AD}attP40; P{y[+t7.7];P{VT007338-Gal4DBD}attP2. We validated the expression of this line using immunohistochemical anti-GFP staining and also using MCFO to visualize single-cell morphologies. This line exhibits expression in various peripheral neurons but is selective for PFL2 neurons within the central complex—specifically, the protocerebral bridge, fan-shaped body and LAL.

    Fly preparation and dissection

    Flies used for all experiments were isolated the day before the experiment by single-housing on molasses food. For calcium imaging experiments we used female flies 20–72 h posteclosion. For electrophysiology experiments, including the iontophoresis experiments, we used female flies 16–30 h posteclosion. No circadian restriction was imposed for the time of experiments.

    Manual dissections in preparation for experiments were as follows. Flies were briefly cold-anaesthetized and inserted using fine forceps (Fine Science Tools) into a custom platform machined from black Delrin (Autotiv or Protolabs). The platform was shaped like an inverted pyramid to minimize occlusion of the fly’s eyes. The head was pitched slightly forward, so the posterior surface was more accessible to the microscope objective. The wings were removed, then the fly head and thorax were secured to the holder using UV-curable glue (Loctite AA 3972) with a brief pulse of ultraviolet light (LED-200, Electro-Lite Co.). To prevent large brain movements, the proboscis was glued in place using a small amount of the same UV-curable glue. Using fine forceps in extracellular Drosophila saline, a window was opened in the head cuticle, and tracheoles and fat were removed to expose the brain. To further reduce brain movement, muscle 16 was stretched by gently tugging the oesophagus, or else it was removed by clipping the muscle anteriorly. For electrophysiology and iontophoresis experiments only, the perineural sheath was minimally removed with fine forceps over the brain region of interest. For all experiments, saline was continuously superfused over the brain. Drosophila extracellular saline composition was: 103 mM NaCl, 3 mM KCl, 5 mM TES, 8 mM trehalose, 10 mM glucose, 26 mM NaHCO3, 1 mM NaH2PO4, 1.5 mM CaCl2 and 4 mM MgCl2 (osmolarity 270–275 mOsm). Saline was oxygenated by bubbling with carbogen (95% O2, 5% CO2) and reached a final pH of about 7.3.

    Two-photon calcium imaging

    We used a two-photon microscope equipped with a galvo-galvo-resonant scanhead (Thorlabs Bergamo II GGR) and ×25, 1.10 numerical aperture (NA) objective (Nikon CFI APO LWD; Thorlabs, WDN25X-APO-MP). For volumetric imaging, we used a fast piezoelectric objective scanner (Thorlabs PFM450E). To excite GCaMP we used a wavelength-tunable femtosecond laser with dispersion compensation (Mai Tai DeepSee, Spectra Physics) set to 920 nm. GCaMP fluorescence signals were collected using GaAsP PMTs (PMT2100, Thorlabs) through a 405–488 nm band-pass filter (Thorlabs). All image acquisition and microscope control was conducted in MATLAB 2021a (MathWorks Inc), using ScanImage 2021 Premium with vDAQ hardware (Vidrio Technologies LLC) and custom MATLAB scripts for further experimental control. The region for imaging the fan-shaped body and protocerebral bridge was 150 × 250 pixels, whereas the region for imaging the LAL was 150 × 400 pixels. We acquired 10–12 slices in the z axis for each volume (4 µm per slice), resulting in 6–8 Hz volumetric scanning rate. For experiments using the selective PFL2 split-Gal4 line, we imaged in the protocerebral bridge, fan-shaped body, or LAL for different trials. For experiments imaging the mixed PFL2 and PFL3 split-Gal4 line, we only imaged in the LAL.

    Patch-clamp recordings

    Patch pipettes were pulled from filamented borosilicate capillary glass (outer diameter: 1.5 mm, inner diameter 0.86 mm; BF150-86-7.5HP, Sutter Instrument Company), using a horizontal pipette puller (P-97, Sutter Instrument Company) to a resistance range of 9–13 MΩ. Pipettes were filled with an internal solution44 consisting of 140 mM KOH, 140 mM aspartic acid, 1 mM KCl, 10 mM HEPES, 1 mM EGTA, 4 mM MgATP, 0.5 mM Na3GTP and 15 mM neurobiotin citrate, filtered twice through a 0.22 µm PVDF filter (Millipore).

    All electrophysiology experiments used a semicustom upright microscope consisting of a motorized base (Thorlabs Cerna), with conventional collection and epifluorescence attachment (Olympus BX51), but no substage optics in order to better fit the virtual-reality system. The microscope was equipped with a ×40 water immersion objective (LUMPlanFLN 40×W, Olympus) and CCD Monochrome Camera (Retiga ELECTRO; 01-ELECTRO-M-14-C Teledyne). For GFP excitation and detection, we used a 100 W Hg arc lamp (Olympus U-LH100HG) and an eGFP long-pass filter cube (Olympus F-EGFP LP). The fly was illuminated from below using a fibre optic coupled LED (M740F2, Thorlabs) coupled to a ferrule-terminated patch cable (200 µM core, 0.22 NA, Thorlabs) attached to a fibre optic cannula (200 µM core, 0.22, Thorlabs). The cannula was glued to the ventral side of the holder and positioned approximately 135° from the front of the fly to be unobtrusive to the fly’s visual field. Throughout the experiment, saline bubbled with 95% O2 and 5% CO2 was superfused over the fly using a gravity fed pump at a rate of 2 ml min−1. Whole-cell current-clamp recordings were performed using an Axopatch 200B amplifier with a CV-203BU headstage (Molecular Devices). Data from the amplifier were low-pass filtered using a 4-pole Bessel low-pass filter with a 5 kHz corner frequency, then acquired on a data acquisition card at 20 kHz (NiDAQ PCIe-6363, National Instruments). The liquid junction potential was corrected by subtracting 13 mV from recorded voltages45. Membrane potential data was then resampled to a rate of 1 kHz for ease of use and compatibility with behavioural data. To estimate baseline membrane voltage (Fig. 5e–g), we removed spikes from voltage traces by median filtering using a 50 ms window and lightly smoothed using the smoothdata function in MATLAB (loess method, 20 ms window). For all electrophysiology experiments in the mixed PFL2 and PFL3 line, we recorded from only one cell per fly. During recordings the cell was filled using internal solution containing neurobiotin citrate, so that we could visualize the cell morphology in order to determine its identity, using the protocol described in the ‘Immunohistochemistry’ section.

    Spherical treadmill and locomotion measurement

    Experiments used an air-cushioned spherical treadmill and machine-vision system to track the intended movement of the animal. The treadmill consisted of a 9-mm-diameter ball machined from foam (FR-4615, General Plastics), sitting in a custom-designed concave hemispherical holder three-dimensionally printed from clear acrylic (Autotiv). The ball was floated with medical-grade breathing air (Med-Tech) through a tapered hole at the base of the holder using a flow meter (Cole Parmer). For machine-vision tracking, the ball was painted with a high-contrast black pattern using a black acrylic pen and illuminated with an IR LED (880 nm for two-photon experiments; M880L3, Thorlabs, or 780 nm for electrophysiology experiments; M780L3, Thorlabs). Ball movement was captured online at 60 Hz using a CMOS camera (CM3-U3-13Y3M-CS for two-photon imaging, or CM3-U3-13Y3C-CS for electrophysiology, Teledyne FLIR) fitted with a macro zoom lens InfiniStix (68 mm ×0.66 for two-photon, InfiniStix 94 mm ×0.5 for electrophysiology). The camera faced the ball from behind the fly (at 180°). Machine vision software (FicTrac v.2.1) was used to track the position of the ball43 in real time. We used a custom Python script to output the forward axis ball displacement, yaw axis ball displacement, forward ball displacement and gain-modified yaw ball displacement to an analogue output device (Phidget Analog 4-Output 1002_0B) and recorded these signals along with other experimental timeseries data on a data acquisition card (NiDAQ PCIe-6363) card at 20 kHz. The gain-modified yaw ball displacement voltage signal was also used to update the azimuthal position of the visual cues displayed by the visual panorama.

    Visual panorama and visual stimuli

    To display visual stimuli, we used a circular panorama built from modular square (8 × 8 pixel) LED panels46. The circular arena was twelve panels in circumference and two panels tall. To accommodate the ball-tracking camera view and the light source the upper panel 180° behind the fly was removed. In all experiments, the modular panels contained blue LEDs with peak blue (470 nm) emission; blue LEDs were chosen to reduce overlap with the GCaMP emission spectrum. For calcium imaging experiments, four layers of gel filters were added in front of the LED arena (Rosco, R381) to further reduce overlap in spectra. For electrophysiology experiments, only two layers of gel filters were used. On top of the gel filters in both cases we added a final diffuser layer to prevent reflections (SXF-0600, Snow White Light Diffuser, Decorative Films). The visual cue was a bright (positive contrast) 2-pixel-wide (7.5°) vertical bar. The bar’s height was the full two-panel height of the area (except for −165 to +165° behind the fly with a single visual display panel, where the bar was half this height). The bar intensity was set at a luminance value of 4 with a background luminance of 0 (maximum value 15).

    The azimuthal position of the cue was controlled during closed-loop experiments by the yaw motion of the ball (see section ‘Spherical treadmill and locomotion measurement’). For all experiments, a yaw gain of 0.7 was used, meaning that the visual cue displacement was 0.7 times the ball’s yaw displacement. For calcium imaging and electrophysiology experiments the cue was instantaneously jumped every 60 s by ±90° or 180°. Immediately following each jump, the cue would continue to move in closed loop with the fly’s movements. We recorded the position of the cue during experiments using analogue output signals from the visual panels along with other experimental timeseries data on a data acquisition card at 20 kHz (PCIe-6363, National Instruments). We converted analogue signals from the visual panels into cue position in pixels during offline analysis. Cue positions were then converted into head direction as follows: 0° when the fly was directly facing the cue, 90° when the fly’s head direction was 90° clockwise to the cue, −90° when the fly was 90° counterclockwise and 180° when the fly was facing directly away from the cue. These signals were lightly smoothed and values above 180° or below −180° were set to ±180°.

    Experimental trial structure

    Before data collection in each experiment, the fly walked for a minimum of 15 min in closed loop with the visual cue. For calcium imaging experiments, data were collected in 10 min trials. In each trial, the fly was in closed loop with the cue, and every 60 s the cue jumped to a new location relative to its current one, alternating between +90°, 180° and −90°, in that order. Between trials during calcium imaging experiments, there was 30 s of darkness. Electrophysiology experiments followed a similar protocol, though occasionally 20 min trials were collected rather than 10 min trials. Additionally, during the intertrial period, flies viewed the cue in closed loop. As these experiments were heavily dependent on spontaneously performed behaviour, trials were run until the fly stopped walking or, in the case of electrophysiology experiments, the cell recording quality significantly decreased.

    Iontophoresis stimuli

    Pipettes for iontophoresis were pulled from aluminosilicate capillary glass (outer diameter 1.5 mm, inner diameter 1.0 mm, Sutter Instrument Company) to a resistance of approximately 75 MΩ using a horizontal pipette puller (P-97, Sutter Instrument Company). Pipettes were filled with a solution47 consisting of 10 mM ATP disodium in extracellular saline with 1 mM AlexFluor 555 hydrazine (Thermo Fisher Scientific) for visualization. This solution was stored in aliquots at −20 °C, thawed fresh daily and kept on ice during the experiment. The tip of the iontophoresis pipette was positioned to be approximately in the medial region of the protocerebral bridge every trial. During experimental trials, we simultaneously recorded from a PFL2 neuron. During control trials, we recorded from unidentified neurons with somata in the same approximate region as PFL2 somata (medial area dorsal to the protocerebral bridge). Pulses of ATP were delivered using a dual current generator iontophoresis system (Model 260, World Precision Instruments). Holding current was set to 10 nA to prevent solution leakage, and a current of −200 nA was used for ejection. Visual confirmation of ATP ejection following current pulses was obtained before and after each trial. For the duration of the 10 min trial period, flies viewed a visual cue that moved in closed loop with their rotational movements, as described above. Throughout the trial, pulses were delivered every 30 s with lengths of 100, 200, 300 and 500 ms, repeating in that order.

    Immunohistochemistry

    Brains were dissected from female flies 1–3 days posteclosion in Drosophila external saline and fixed in 4% paraformaldehyde (Electron Microscopy Sciences, catalogue no. 15714) in phosphate-buffered saline (PBS, Thermo Fisher Scientific, 46-013-CM) for 15 min at room temperature. Brains were washed with PBS before adding a blocking solution containing 5% normal goat serum (Sigma-Aldrich, catalogue no. G9023) in PBS with 0.44% Triton-X (Sigma-Aldrich, catalogue no. T8787) for 20 min. Brains were then incubated in primary antibody with blocking solution for roughly 24 h at room temperature, washed in PBS and incubated in secondary antibody with blocking solution for roughly 24 h at room temperature. Primary and secondary antibodies were protocol-specific (see below). Brains were then rinsed with PBS and mounted in antifade mounting medium (Vectashield, Vector Laboratories, catalogue no. H-1000) for imaging. For MCFO protocols, a tertiary incubation step for about 24 h at room temperature and wash with PBS was performed before mounting. Mounted brains were imaged on a Leica SPE confocal microscope using a ×40, 1.15 NA oil-immersion objective. Image stacks comprised 50 to 200 z-slices at a depth of 1 μm per slice. Image resolution was 1,024 × 1,024 pixels. For visualizing Gal4 expression patterns, the primary antibody solution contained chicken anti-GFP (1:1,000, Abcam, catalogue no. ab13970) and mouse anti-Bruchpilot (1:30, Developmental Studies Hybridoma Bank, nc82). The secondary antibody solution contained Alexa Fluor 488 goat anti-chicken (1:250, Invitrogen, catalogue no. A11039) and Alexa Fluor 633 goat anti-mouse (1:250, Invitrogen, catalogue no. A21050). For visualizing cell fills after whole-cell patch-clamp recordings, 1:1,000 streptavidin::Alexa Fluor 568 (Invitrogen, catalogue no. S11226) was added to the primary and secondary solutions.

    For MCFO48, the primary antibody solution contained mouse anti-Bruchpilot (1:30, Developmental Studies Hybridoma Bank, nc82), rat anti-Flag (1:200, Novus Biologicals, catalogue no. NBP1-06712B) and rabbit anti-HA (1:300, Cell Signaling Technology, catalogue no. 3724S). The secondary antibody solution contained Alexa Fluor 488 goat anti-rabbit (1:250, Invitrogen, catalogue no. A11039), ATTO 647 goat anti-rat (1:400, Rockland, catalogue no. 612-156-120) and Alexa Fluor 405 goat anti-mouse (1:500, Invitrogen, catalogue no. A31553). The tertiary antibody solution contained DyLight 550 mouse anti-V5 (1:500, Bio-Rad, catalogue no. MCA1360D550GA).

    Processing calcium imaging data

    Analysis was performed in either MATLAB 2019 or MATLAB R2021a. The calcium imaging dataset comprised 23 flies expressing GCaMP under the control of the PFL3 + 2 split-Gal4 line and 33 flies expressing GCaMP under the control of the PFL2 split-Gal4 line. Rigid motion correction in the x, y and z axes was performed for each trial using the NoRMCorre algorithm49. Each region of interest (ROI) was defined across the z-stack. For each ROI ΔF/F was calculated with the baseline fluorescence (F) defined as the mean of the bottom 10% of fluorescence values in a given trial (600 s in length). From this measurement a modified z-score was calculated using the median absolute deviation (MAD) normalized difference from the median, which we refer to as the z-scored ΔF/F (Extended Data Fig. 9):

    $${y}_{i}=\frac{{x}_{i}-\,\underline{X}}{{\rm{MAD}}},{\rm{where}}\,\underline{X}={\rm{median}}\,{\rm{of}}\,X,\,{\rm{MAD}}={\rm{median}}\,(| {x}_{i}-\underline{X}| )$$

    (1)

    For protocerebral bridge imaging, ten ROIs were defined, one for each of the ten glomeruli occupied by PFL2 dendrites and defined to be approximately the same width and without overlap, constrained by estimated anatomical boundaries. For fan-shaped-body imaging, nine ROIs were defined for PFL2 neurites corresponding to the nine columns spanning the horizontal axis of the fan-shaped body. ROIs were approximately the same width without overlap. For LAL imaging, two ROIs were defined, one for the left LAL and one for the right. In any given 10 min epoch, we imaged either the protocerebral bridge or the fan-shaped body, or the LAL, that is, one brain region only. Signals in the protocerebral bridge and fan-shaped body had a similar sinusoidal profile, similar bump amplitude and a similar relationship to fly behaviour, so we used both protocerebral-bridge-imaging epochs and fan-shaped-body-imaging epochs to obtain our measurements of bump amplitude, and we pooled these bump amplitude measurements without regard to whether they came from the protocerebral bridge or fan-shaped body, see Figs. 2e–g, 3a and 5k, and Extended Data Figs. 3 and 5. The single fly examples shown in Fig. 5j, and Extended Data Figs. 8 and 9 are from trials where we imaged the protocerebral bridge.

    Processing locomotion and visual arena data

    The position of the spherical treadmill was computed online using machine vision software (Fictrac v.2.1) and output as a voltage signal for acquisition. For post hoc analysis, the voltage signal was converted into radians and unwrapped. Signals were then low-pass filtered using a second-order Butterworth filter with 0.003 corner frequency and downsampled to half the ball-tracking update rate.Velocity was calculated using the MATLAB gradient function. Artefactually large velocity values (greater than 20 rad s−1) were set to 20 rad s−1, and timeseries were then smoothed using the smooth function in MATLAB (using the loess method with an 33 ms window) and resampled to 60 Hz, the ball-tracking update rate. Forward and sideways velocities were then converted to millimetres per second while yaw (rotational) velocity was converted to degrees per second.

    During calcium imaging, we acquired a signal from our imaging software indicating the end of each volumetric stack on the same acquisition card as online ball tracking signals. These imaging time points were then resampled to the ball-kinematic data update rate of 60 Hz, allowing us to align the acquired volumes. Electrophysiology data were collected on the same acquisition card as online ball tracking signals, so alignment was not required; however, ball-tracking data were resampled to 1 kHz to match the sampling rate of the electrophysiology data.

    Computing inferred goal direction and consistency of head direction across trials

    Head direction (θ) and consistency of head direction (ρ) were calculated for every datapoint over each entire trial using a 30 s window centred on each datapoint index. Here we excluded datapoints where the fly’s cumulative speed (forward + sideways + rotational) was less than 0.67 rad s−1. At values below this threshold, the fly is essentially standing still, so including these time points might result in an overestimation of the fly’s internal drive to maintain its head direction. We also excluded time points within 5 s after a cue jump; this was to avoid underestimating the fly’s internal drive to maintain its head direction, as these points represent a forced deviation from the angle the flies were attempting to maintain. If no datapoints within the 30 s window satisfied these requirements, then the window was excluded from further analyses. Head directions were treated as unit vectors and used to compute the goal direction θg and the consistency of head direction ρ:

    $${\theta }_{{\rm{g}}}={\rm{atan}}2(\Sigma \sin ({\theta }_{{\rm{w}}}),\Sigma \cos ({\theta }_{{\rm{w}}}))$$

    (2)

    $${\rho }_{t}=\sqrt{{\left(\frac{\Sigma \cos ({\theta }_{{\rm{w}}})}{{N}_{{\rm{w}}}}\right)}^{2}+{\left(\frac{\Sigma \sin ({\theta }_{{\rm{w}}})}{{N}_{{\rm{w}}}}\right)}^{2}}$$

    (3)

    In equation (2), θg represents the goal direction associated with time point t, θw is a vector consisting of all head directions within the 15 s before and after time point t at which the fly was moving, and the atan2 function is the two-argument arctangent. As each head direction is treated as a unit vector we can simply convert each value of θw into Cartesian coordinates, calculate the sum of these values along each axis and take the arctangent to convert them back to polar coordinates to find the average angle the fly travelled at during that window. In equation (3), ρt represents the ρ value associated with time point t, and Nw is the number of data points over which ρ is calculated. Again, we first convert each θ value into Cartesian coordinates and find the average distance travelled along each axis before calculating ρ, so that ρ ranges between 0 and 1. Note that ρ = 1 would indicate that the fly maintained the same head direction for the entire window, while ρ = 0 would indicate that the fly uniformly sampled all possible head directions during the window. Figure 1g shows mean ρ and θ values from each trial, with radial length proportional to ρ.

    Path segmentation based on walking straightness

    We observed that flies often walked in a straight line for an extended segment and then switched to a different apparent goal direction (θg) to initiate a new segment (Extended Data Fig. 10). To infer the fly’s goal direction, we automatically divided each path into segments. We reasoned that a switch in θg, would coincide with a dip in head direction consistency. Therefore, we looked for moments when ρ crossed a threshold value, and we broke the path into segments at those moments of threshold-crossing. The only exception was if ρ fell below threshold only very briefly (less than 0.5 s); here we did not count these as segment breaks, but lumped those time points together as part of a continuous segment with the preceding and following time points. We found that a threshold of ρ = 0.88 matched our commonsense notion of when a new segment should start, but varying the threshold value over a wide range (0.70–0.98) did not dramatically change the outcome of our segmentation process nor the resulting relationships between neural activity and behaviour.

    We then calculated the average θ and ρ for each of these segments and used the mean θ value as the inferred goal head direction. For all analyses, segments were discarded if ρ was equal to 1, as this indicated the panels had not been initiated correctly and that the cue had remained in a single location for the duration of the trial. Segments were also discarded if the fly was inactive (that is, if the fly’s cumulative velocity was not above a threshold of 0.67 rad s−1 for at least 2 s). For population analyses shown in Figs. 1h, 2e–g and  3, all remaining segments were used regardless of ρ.

    For the head direction tuning analysis shown in Fig. 4f,g we used a threshold of ρ = 0.7, and we only used data from segments where ρ ≥ 0.7. We lowered the threshold on ρ for this analysis because we needed to include a larger number of time points in the analysis, to improve the resolution for binning the activity of cells into groups defined by θp − θg.

    Classifying jumps as ‘corrected, high ρ’ versus ‘uncorrected, low ρ

    To analyse cue jumps (Figs. 1f and  5e–h and Extended Data Figs. 3 and 7), we classified jumps as ‘corrected, high ρ’ or ‘uncorrected, low ρ’. Here we rejected jumps where the fly was essentially immobile in the epoch before the jump (meaning its cumulative speed did not exceed 0.67 rad s−1 for at least 1 s in the 15 s before the jump). For each jump, we measured the original mean head direction (θ) during the 15 s before the jump, and we judged jumps as ‘corrected’ if θ returned to within 30° of its original value for ±90° jumps, or within 60° for 180° jumps, in the 10 s after the jump. We classified a jump trial as ‘high ρ’ if the average ρ was equal to or greater than 0.88 as calculated over time points within the 15 s before the jump, where the fly’s cumulative speed was over 0.67 rad s−1 and ‘low ρ’ otherwise.

    In principle, it is possible that the jumps we categorized as uncorrected might have happened (by chance) to produce a smaller absolute change in the distance between a fly’s head direction and a cell’s preferred head direction |Δ(θ − θp)|, as compared to the jumps in the corrected category. If this sampling artefact existed, it could produce an overall smaller absolute change in membrane potential for uncorrected jumps, leading us to misinterpret this result. However, we found no difference in the variance of ∆(θ − θp) or the mean value of |Δ(θ − θp)| for uncorrected versus corrected jumps (Extended Data Fig. 7d).

    Computing average response to iontophoresis stimulation

    For the plots shown in Fig. 2a,b and Extended Data Fig. 4, data from the ±10 s period around each ATP pulse were averaged within individual flies to get the fly-averaged response to the 100 ms, 200 ms, 300 ms and 500 ms pulses for the membrane potential, forward velocity, sideways velocity and rotational velocity (each condition had at least four repetitions per fly). We then calculated the grand mean and s.e.m. across all flies using these per-fly averages.

    Computing activity bump parameters

    To track the amplitude and phase of PFL2 activity for analyses in Figs. 2c–g and 5j,k and Extended Data Figs. 3, 5 and 8, a sinusoid was fit independently to each time point of the z-scored ΔF/F activity across fan-shaped body and protocerebral bridge imaging trials:

    $${\rm{PFL}}2\,\,{\rm{activity}}=a\times \sin (x-u)+c$$

    (4)

    Here, PFL2 activity is a vector of z-scored ΔF/F values at a single time point such that it has ten bins if from a protocerebral bridge trial or nine if from an fan-shaped body trial, corresponding to the number of ROIs specified for each region. Here, u sets the phase of the sinusoid, c is the vertical offset term, a represents the bump amplitude, and the position in brain space where the peak of the sinusoid is located defines the bump phase. A bump phase of +180° represents the rightmost position in the protocerebral bridge and fan-shaped body while a phase of −180° represents the leftmost position.

    Computing change in bump phase versus change in head direction

    We calculated the relative changes in PFL2 bump phase and head direction in 1.5 s bins as shown in Fig. 2d. In each time window, we took the difference between start and end points for θ or bump phase. Positive differences represent a clockwise shift while a negative difference represents a counterclockwise shift. The relationship between changes in θ and changes in bump phase was strongest when a 200 ms lag was implemented, such that changes in bump phase lagged 200 ms behind changes in θ. The line of best fit for the relationship between the two variables was found with the polyfit and polyval functions. We then used the corrcoef function to find the correlation coefficients and P value of the relationship. We excluded indices where the adjusted r2 value of the sinusoidal fit for bump parameters was below 0.1 or the fly was not moving.

    Computing population activity as a function of behaviour

    To determine the relationship between neural activity and various behavioural parameters (Figs. 2e–g and 3 and Extended Data Fig. 5) we binned conditioned data. Within each segment described above, indices with cumulative velocity less than 0.67 rad s−1 were removed, and head directions were recalculated to be relative to the inferred goal head directions, meaning that a negative value indicated that the fly was facing counterclockwise to its goal head direction, and a positive value indicated that the fly was facing clockwise to its goal head direction. The z-scored ΔF/F was then averaged within bins of 10° s−1 for rotational velocity, 1 mm s−1 for forward velocity, or 10° for head direction. For Fig. 3d,e and Extended Data Fig. 5, the sum or difference between right and left LAL activity was calculated per segment following binning. The mean and s.e.m. was then calculated across flies.

    Computing preferred head direction

    To show preferred cell head direction in Fig. 4a, we divided the estimated baseline membrane voltage (see section ‘Patch-clamping’) into 20° bins, based on the fly’s head direction. We considered the preferred head direction to be the value with the maximum binned membrane potential. The amplitude of the preferred head direction was calculated by taking the difference between the maximum and minimum binned membrane potential values.

    Analysis of IPSPs

    To detect IPSPs for analyses in Fig. 4d, we focused only on jump trials where the fly was essentially immobile, to avoid any confounds associated with the membrane potential fluctuations in these cells that are associated with movement transitions. Action potentials were first removed from the voltage trace by median filtering the membrane potential with a 25 ms window, then lightly smoothing (smoothdata function in MATLAB, window size 20 ms, using the loess method). We then calculated the derivative of the membrane potential (gradient function in MATLAB) and found local minima corresponding to periods of rapid decreases in membrane potential (findpeaks function in MATLAB, peak distance of 20 ms, threshold determined for each cell). We also generated a detrended version of the membrane potential by subtracting the median filtered membrane potential (500 ms window) and found local minima (findpeaks function in MATLAB, peak distance of 20 ms, threshold determined for each cell). We categorized IPSPs as indices where a negative peak was detected from the derivative of the membrane potential trace within 30 ms before a negative peak in the baseline corrected trace.

    Computing change in IPSP parameters as a function of the change in head direction

    To examine changes in IPSP parameters as a function of change in head direction, ±5 s windows around cue jumps in which the fly did not move for the entire 10 s period were used (Fig. 4c). All jumps fitting this category were analysed for 20 of 27 neurons in this dataset; the remaining 7 neurons were not included, as there were no cue jumps around which the fly was stopped for the entire 10 s window around the jump.

    Detected IPSP frequency was calculated for the 5 s before or after the cue jump. The change in frequency before jump versus after jump was then compared to change in head direction relative to the cell’s preferred head direction produced by the cue jump. This was determined by first finding the absolute angular difference between the head direction before the jump and the cell’s preferred head direction (see section ‘Computing preferred head direction’) and doing the same for the new head direction following the cue jump. Then the precue jump value was subtracted from the postcue jump value. This means that a negative value indicated that the head direction was closer to the cell’s preferred head direction following the jump while a positive value indicated that the distance between the head direction and the cell’s preferred head direction increased following the jump. The change in IPSP frequency was then plotted against the change in the distance from the cell’s preferred head direction for each jump. MATLAB’s polyfit and polyval functions were used to find the line of best fit for the relationship between the two variables, while the corrcoef function was used to find the correlation coefficients of the relationship. Additionally, we used an unbalanced two-factor ANOVA to determine the significance of the relationship between change in frequency and change in head direction compared to that with cell identity.

    Exploring interactions between goal head direction and single-cell head direction tuning curves

    To explore how single-cell dynamics lead to the population level relationships between neural activity and behaviour, we first segmented electrophysiology data into groups of continuous data points based on their associated goal head directions and ρ values (see section ‘Trial segmentation based on walking straightness and inferred goal direction’). For each trial, the cell’s preferred heading was determined (see section ‘Computing preferred head direction’) and the difference between the preferred heading and goal was found (θg − θp). Segments were assigned to 72˚ wide bins based on the θg − θp value and for each segment, the head direction tuning curve was recalculated for both firing rate and membrane potential, using the data points within the bin. For Fig. 4f,g, the minimum value of each tuning curve was calculated and subtracted from that tuning curve. Following the subtraction, the mean and s.e.m. values were calculated across all tuning curves within each θg − θp bin. For Extended Data Fig. 6, the only difference is that the minimum value of the tuning curves was not subtracted.

    Determining the temporal relationship between neural activity and behaviour

    The figures shown in Fig. 5h were created using the same method as previous jump analyses (see section ‘Classifying jumps as “corrected, high ρ“ versus ”uncorrected, low ρ”’) but pooling data across the PFL2 and PFL3 corrected jumps. For Extended Data Fig. 7e, jumps were categorized as corrected as done previously, except jumps were deemed corrected if within 4 s following the cue jump, the cue was returned to within 40˚ for ±90˚ jumps, or within 75˚ for 180˚ jumps. This was done to select for jumps where the fly initiated a behavioural response quite rapidly following the cue jump, as behavioural response times varied across and within flies. For each corrected jump, the mean membrane potential was calculated from data in the 4 s preceding the cue jump and subtracted from the membrane potential in the 4 s following the cue jump, in order to focus on the change in membrane potential. Pearson’s linear correlation coefficient was then found between the absolute change in membrane potential from the 4 s following the jump and the lagged copies of the rotational speed over the same time window using MATLAB’s corr function. The mean and s.e.m. for each lag (stepped by 0.01 s with a maximum and minimum lag of ±1 s) across all individual correlations was then calculated.

    Examining single-cell responses around cue jumps

    For Fig. 5e–g and Extended Data Fig. 7a–d, jumps were categorized as either corrected or uncorrected as described previously (see section ‘Classifying jumps as “corrected, high ρ” versus “uncorrected, low ρ”’). For each jump, the difference between the mean membrane potentials calculated over the 1 s before and following each jump was found, and the distribution of these values is shown for both categories in Fig. 5f,g. A two sample Brown–Forsythe test was used to determine whether the variance of membrane potential changes was significantly different between the two categories.

    Examining the relationship between PFL2 activity and consistency of head direction

    For Fig. 5j,k and Extended Data Fig. 8, we binned data from each ROI (protocerebral bridge glomerulus) individually across the entire non-segmented trial to obtain the average response of each glomerulus across different values of (θ − θg). Here we inferred θg from neural activity rather than behaviour, because we wanted to include epochs with low ρ, and it is difficult to infer θg from the fly’s behaviour when ρ is low. To infer θg from neural activity, we grouped PFL2 bump amplitude data points by θ in 5˚ bins, and we calculated the difference in bump amplitude between pairs of bins 180˚ apart. Our model predicts that the absolute bump amplitude difference should be largest between the bins representing the goal and anti-goal, and so we searched for the pair of opposing bins with the largest difference in bump amplitude, and we took θg as the value of θ corresponding to the bin with the smaller bump amplitude. For Fig. 5k, we plotted the largest bump amplitude difference against the trial’s average ρ value, as calculated over the entire trial. For the individual brain space plots shown in Fig. 5i,j and Extended Data Fig. 8, we used this θg value to calculate the directional error (θ − θg) and we binned the z-scored ΔF/F data points from each individual ROI into 90˚ bins based on their associated directional error value. We then plotted the z-scored ΔF/F within each directional error bin against neural space (ROI identity), with the rightmost glomeruli represented by an angular position of +180˚ and the leftmost by −180˚.

    Note that this analysis assumes that θg does not change very much over the course of a trial. If θg did change dramatically, this would result in a lower ρ value for the trial and possibly also a reduced bump amplitude range value, despite the fly potentially being in a state of high goal fixation strength for the entire trial. Flies that switched between periods of very strong and weak goal fixation would be expected to result in a similar potential mismatch between ρ and bump amplitude range. Therefore, the limitations of the analysis in Fig. 5k should, if anything, reduce our ability to detect a relationship between PFL2 activity and behaviour.

    Neurotransmitter predictions

    There are 12 complete PFL2 cells, 13 complete PFL3 cells and one nearly complete DNa03 cell in the hemibrain connectome, with over 100 presynapses associated with each of these cells. Although the axon terminal of DNa03 is not present in the hemibrain dataset, DNa03 makes many output synapses in the brain, so there are still many EM images of the presynaptic sites within this cell. A recent algorithm50,51 automatically infers transmitter identification from electron micrographs in the hemibrain dataset, and it predicts that, of these, 12 of 12 PFL2 neurons are cholinergic, 13 of 13 PFL3 neurons are cholinergic and 1 of 1 DNa03 neuron is cholinergic. This algorithm predicts transmitters on a per-synapse basis, with an error rate that varies with cell and transmitter type. For PFL2 and PFL3 neurons, 74% of high-confidence presynapses (confidence score greater than or equal to 0.5) are predicted as cholinergic; the second most commonly predicted transmitter is glutamate (11%). For DNa03, 85.2 % of high-confidence presynapses are predicted as cholinergic; the second most commonly predicted neurotransmitter is glutamate (5.6%). This algorithm used 3,094 hemibrain neurons in its ground-truth data to train the model and included ground truth neurons identified as cholinergic using light microscopy pipelines and antibody staining or RNA sequencing. Among this ground-truth population, 73% of presynapses are correctly predicted as cholinergic. All synapse predictions are available from ref. 51.

    Connectome analyses

    Cell connectivity data was obtained from the hemibrain connectome at https://neuprint.janelia.org/ and analysis of this data was performed using the neuprintr natverse 1.1 software package52 available at https://natverse.org/.

    Network model

    Our model shares features with several other recent models of central complex steering control4,5,11,12,13. These studies, in turn, built upon the existing idea that vectors should be represented as sinusoidal spatial patterns of neural activity, so that vector addition can be implemented via the addition of sinusoids9,15,16,53,54. Webb and colleagues extended this idea to an explicit notion of how rotational velocity commands might be generated via vector addition, by using right–left shifted basis vectors9. While our model incorporates these previous insights, it also takes advantage of new information from the automatic assignment of neurotransmitters50, as well as our neurophysiological experiments. For these reasons, it differs from previous models in a few important ways, as noted below. Most notably, our model shows how this network can adaptively control steering gain based on the magnitude of directional error (via PFL2 cells). Previous studies did not mention PFL2 cells, or else proposed that they have a non-steering-related role (as putative positive regulators of forward speed5,13). In contrast, our model gives these cells a strong influence over steering, and it shows how they can prevent oscillations in the steering system by boosting steering only when error is high, while throttling down steering when error is low.

    In broad terms, the aim of the model is to understand how steering signals arise from the head direction system. We take the steering signal as the right–left difference in the activity of DNa02 descending neurons, because these neurons have been shown to predict and influence steering4:

    $${\rm{d}}\theta /{\rm{d}}t\propto {\rm{DNa02R\; -\; DNa02L}}\,\,+{\epsilon }$$

    (5)

    where θ is head direction and ε is a random term that accounts for neural noise and the influence of unmodeled circuits (that is, the influence of other brain regions that affect steering and other descending pathways4,55,41). Here, (\({\rm{d}}\theta /{\rm{d}}t\) > 0) denotes rightward (clockwise) steering.

    DNa02 receives direct input from central complex output neurons (PFL3 cells), as well as indirect input from PFL2 and PFL3 cells via DNa03. We model the activity of each DNa02 cell by taking the weighted sum of its synaptic inputs and passing this through a nonlinearity:

    $$\begin{array}{c}{\rm{DNa}}02{\rm{R}}=f(\Sigma {W}_{{\rm{DNa}}02{\rm{R}},{\rm{PFL}}3{{\rm{R}}}_{j}}\times {\rm{PFL}}3{{\rm{R}}}_{j}+\Sigma {W}_{{\rm{DNa}}02{\rm{R}},{\rm{DNa}}03{\rm{R}}}\times {\rm{DNa}}03{\rm{R}})\\ \\ {\rm{DNa}}02{\rm{L}}=f(\Sigma {W}_{{\rm{DNa}}02{\rm{L}},{\rm{PFL}}3{{\rm{L}}}_{j}}\times {\rm{PFL}}3{{\rm{L}}}_{j}+\Sigma {W}_{{\rm{DNa}}02{\rm{L}},{\rm{DNa}}03{\rm{L}}}\times {\rm{DNa}}03{\rm{L}})\end{array}$$

    (6)

    where \(W\) denotes an array of synaptic weights and \(f\) represents a nonlinear activation function (see below). We define PFL3R cells as the members of the PFL3 cell class that project their axons to the right hemisphere; PFL3L cells are the members of the PFL3 cell class that project their axons to the left hemisphere. This differs from some previous work where PFL3 cells were divided according to dendritic location rather than their axonal projection5.

    We model the activity of each DNa03 cell by taking the weighted sum of its synaptic inputs and passing this sum through the same type of nonlinearity. Here the relevant inputs to each DNa03 cell are from PFL3 cells and PFL2 cells. Each PFL2 axon projects bilaterally to both right and left brain hemispheres, and we model these connections as right–left symmetric, because we do not find any systematic asymmetry in connectome data; thus we use the same weights for PFL2 connections onto DNa03R and DNa03L:

    $$\begin{array}{c}{\rm{DNa}}03{\rm{R}}=f(\Sigma {W}_{{\rm{DNa}}03{\rm{R}},{\rm{PFL}}3{{\rm{R}}}_{j}}\times {\rm{PFL}}3{{\rm{R}}}_{j}+\Sigma {W}_{{\rm{DNa}}03,{\rm{PFL}}{2}_{j}}\times {\rm{PFL}}{2}_{j})\\ \\ {\rm{DNa}}03{\rm{L}}=f(\Sigma {W}_{{\rm{DNa}}03{\rm{L}},{\rm{PFL}}3{{\rm{L}}}_{j}}\times {\rm{PFL}}3{{\rm{L}}}_{j}+\Sigma {W}_{{\rm{DNa}}03,{\rm{PFL}}{2}_{j}}\times {\rm{PFL}}{2}_{j})\end{array}$$

    (7)

    We then combine equations (5)–(7) to obtain an expression that predicts steering as a function of PFL2 and PFL3 activity. Here we assume that DNa03 output is anatomically symmetric in the right and left hemispheres. For compactness, we notate weight arrays using the abbreviations D2 (DNa02), D3 (DNa03) P2 (PFL2) and P3 (PFL3):

    $$\begin{array}{l}{\rm{d}}\theta /{\rm{d}}t\propto {\rm{DNa}}02{\rm{R}}-{\rm{DNa}}02{\rm{L}}+{\epsilon }\\ =\,f(\Sigma {W}_{{\rm{D2R}},{\rm{P}}3{{\rm{R}}}_{j}}\times {{\rm{P3R}}}_{j}+\Sigma {W}_{{\rm{D2,D3}}}\times {\rm{D3R}})\\ \,-f(\Sigma {W}_{{{\rm{D2L,P3L}}}_{j}}\times {{\rm{P3L}}}_{j}+\Sigma {W}_{{\rm{D2,D3}}}\times {\rm{D3L}})+{\epsilon }\\ =\,f(\Sigma {W}_{{{\rm{D2R,P3R}}}_{j}}\times {{\rm{P3R}}}_{j}+\Sigma {W}_{{\rm{D2,D3}}}\times f(\Sigma {W}_{{{\rm{D3R,P3R}}}_{j}}\times {{\rm{P3R}}}_{j}\\ \,+\Sigma {W}_{{{\rm{D3,PFL2}}}_{j}}\times {{\rm{PFL2}}}_{j}))\\ \,-f(\Sigma {W}_{{{\rm{D2L,P3L}}}_{j}}\times {{\rm{P3L}}}_{j}+\Sigma {W}_{{\rm{D2,D3}}}\times f(\Sigma {W}_{{{\rm{D3L,P3L}}}_{j}}\times {{\rm{P3L}}}_{j}\\ \,+\Sigma {W}_{{{\rm{D3,PFL2}}}_{j}}\times {{\rm{PFL2}}}_{j}))+{\epsilon }\end{array}$$

    (8)

    If the activation function \(f\) is linear, the PFL2 terms will cancel out and PFL2 cells will have no effect on steering; therefore, we require \(f\) to be nonlinear, at least for DNa03 cells. Below we will see that \(f\) must also be nonlinear for PFL3 cells. For consistency, we give \(f\) the same form for all cells in the model (see below). If \(f\) is an expansive nonlinearity and if PFL2 cells are excitatory (as inferred from neurotransmitter predictions, see above), then PFL2 cells will increase the gain of steering commands, because they push DNa03 cells up into the steeper part of the nonlinearity.

    We specify the weight array \(W\) for each connection type based on data from the hemibrain 1.2.1 (ref. 5) connectome, following the heuristic that functional weights are roughly proportional to the number of synaptic contacts per unitary connection42,45. Connectome data imply that PFL3 → DNa03 connections are approximately equal in strength to PFL3 → DNa02 connections, on average; all these weights are set to 1 in our model. Meanwhile, connectome data imply that PFL2 → DNa03 connections are approximately 4-fold stronger than PFL3 → DNa02 and PFL3 → DNa03 connections, on average; therefore, we set PFL2 → DNa03 weights equal to 4. Finally, connectome data imply that DNa03 → DNa02 connections are approximately 12-fold stronger than PFL3 → DNa02 and PFL3 → DNa03 connections; therefore, we set DNa03 → DNa02 connections to 12. We verified that our conclusions were not altered if we chose somewhat different scaling factors for these connections. Within each weight array \(W\), we set all entries to the same value; in other words, all connections of the same type were given the same weight. All weights were positive, because all the presynaptic cells are cholinergic and thus excitatory (see section ‘Neurotransmitter predictions’). Some previous studies assumed that PFL3 cells are inhibitory5,11, which produces different model behaviour, because it aligns the system’s stable fixed point with the point of maximum PFL2 activity (not the minimum of PFL2 activity), resulting in more oscillatory steering around the goal.

    Our model contains 1,000 PFL2 units, 1,000 PFL3R units, 1,000 PFL3L units and 1,000 goal cell units. We chose to use a large number of units for these cell types, so that model output resembles a quasi-continuous function over neural space, because this makes it easier to see how spatial patterns of ensemble neural activity might resemble a sinusoidal function. In reality, however, there are only 12 PFL2 cells, 12 PFL3R cells and 12 PFL3L cells in the brain, according to the hemibrain 1.2.1 (ref. 5) connectome, so activity in the brain is actually more discretized than in our model. We verified that discretizing neural activity to match these numbers does not alter our conclusions.

    In our model, the activity of each PFL cell depends on both head direction and goal direction. Δ7 cells provide most of the head direction input to PFL2 and PFL3 cells5. Available data indicate that there are two complete linearized topographic maps of head direction in Δ7 cells, positioned side-by-side and formatted as two cycles of a sinusoidal function over neural space5,24,47,56. The spatial phase of the Δ7 activity pattern should have an arbitrary offset (θ0) relative to the fly’s head direction, with different values of θ0 in different individuals and at different times in the same individual, because this is true of EPG cells, which provide head direction input to Δ7 (ref. 19). We define the offset θ0 as the angular position of the EPG bump at a head direction of 0°. For simplicity, we lump the contributions of EPG output and Δ7 cells, and we treat their lumped contributions as a sinusoidal function over neural space. Specifically, we model their lumped output as cos(θ − θ0 − h), where h is a vector with 1,000 entries that uniformly tile the full 360° of angular space, representing the preferred head directions of 1,000 units. As the fly rotates rightward (clockwise), the sinusoidal pattern of neural activity moves leftward across the protocerebral bridge47,56.

    We define PFL3 cells as R or L depending on whether they project to right or left descending neurons, respectively. The head direction maps in PFL3 cells are shifted ±67.5° relative to the map in Δ7 cells, according to hemibrain connectome data41 (not ±90° as reported previously5,12,13). Therefore, we model the head direction input to PFL3R cells as cos(θ − θ0 − h + 67.5°), and we model the head direction input to PFL3L cells as cos(θ − θ0 − h − 67.5°). Meanwhile, PFL2 cells sample one full head direction map from the middle section of the protocerebral bridge. Therefore, their head direction map is offset by 180°, relative to the map in Δ7 cells. Thus, we model the head direction input to PFL2 cells as cos(θ − θ0 − h + 180°).

    We model the neural representation of the goal direction (θg) as another sinusoidal pattern over neural space, which is reasonable, because the goal direction can be thought of as just a special head direction, and head direction is represented as a sinusoid. Because PFL2, PFL3R and PFL3L cells receive almost identical inputs in the fan-shaped body, we assume the goal input is the same in the PFL2, PFL3R and PFL3L populations. The output of goal cells is modelled as A × cos(θg − θ0 − h); note that if there is a shift in the offset of the head direction system (θ0), the goal representation will shift accordingly. As the goal direction rotates rightward (clockwise), the peak of activity in goal cells will move leftward across the fan-shaped body. We use A = 1 in our model implementations, so that the amplitude of the goal signal is equal to the amplitude of the head direction signal, but some of our results can be potentially explained by a mechanism that modulates A (Extended Data Fig. 8).

    To obtain PFL activity levels, we sum head direction inputs and goal inputs. We then rescale this sum according to a scaling factor S. Finally, we pass the result through a nonlinear activation function \(f\):

    $$\begin{array}{l}\,\,{\rm{PFL}}2\,=\,f(S\times (\cos (\theta -{\theta }_{0}-{\bf{h}}+18{0}^{\circ })+A\times \,\cos ({\theta }_{g}-{\theta }_{0}-{\bf{h}})))\\ {\rm{PFL}}3{\rm{R}}\,=\,f(S\times (\cos (\theta -{\theta }_{0}-{\bf{h}}+67.{5}^{\circ })+A\times \,\cos ({\theta }_{g}-{\theta }_{0}-{\bf{h}})))\\ {\rm{PFL}}3{\rm{L}}\,=\,f(S\times (\cos (\theta -{\theta }_{0}-{\bf{h}}-67.{5}^{\circ })+A\times \,\cos ({\theta }_{g}-{\theta }_{0}-{\bf{h}})))\end{array}$$

    (9)

    Note that the activation function \(f\) must be nonlinear or else the goal input will have no influence on the right–left difference in PFL3 activity (ΣPFL3R − ΣPFL3L). We use S = 1 by default, except in Figs. 5c,d and 5j,k, where we investigate the effect of lowering S.

    For simplicity, we use the same nonlinear activation function \(f\) for all units in this model (meaning all PFL2, PFL3, DNa03 and DNa02 cells). Specifically, we use an exponential linear unit or ELU. We chose an ELU because it is biologically highly plausible (as a ‘soft’ expansive nonlinearity57) and it is a good fit to our data. The input to the ELU is an array M that represents the weighted sum of the inputs to each cell, over its lifetime, for all values of head direction (θ), goal direction (θg), scaling parameter (S) and cell index (j). We rescale M so that min(M) = −1 and max(M) = 1. Then, we apply the function

    $$\begin{array}{c}{\rm{ELU}}(M)=M\,{\rm{for}}\,M\ge 0\\ \\ {\rm{ELU}}(M)={{\rm{e}}}^{M}-1\,{\rm{for}}\,M < 0\end{array}$$

    (10)

    before finally rescaling the resulting array \({\rm{ELU}}(M)\) so that it ranges from 0 to 1. These rescaling procedures are motivated by the idea that a neuron’s inputs are adjusted (over development and/or evolution) to fit into some standard dynamic range dictated by the biophysical properties of a typical neuron; rescaling in this way is useful because it ensures that every cell type has a similar overall level of activity, and every cell has an activation function with the same shape. Note that from the perspective of a single PFL cell, the goal input is a fixed value that does not change as head direction changes, and when this goal signal becomes more positive (again, from the perspective of a single PFL cell), it pushes the cell’s activity up to a steeper part of the nonlinear function \(f\), effectively amplifying the cell’s head direction tuning. This aspect of the model captures our experimental observation that head direction tuning is stronger in some cells than in other cells, in a way that depends systematically on the distance between the cell’s preferred head direction (θp) and the goal direction (θg). Notably, this observation emerges only at the level of spike rate, not membrane potential (Fig. 4f,g), and this implies that the nonlinearity \(f\) is largely due to the voltage-gated conductances that transform total synaptic input into spike rate. We verified that the basic conclusions of our model are unchanged if we substitute different nonlinear activation functions (sigmoid or ReLU rather than ELU); other published models have assumed a multiplicative12 or divisive nonlinearity13.

    To model steering behaviour over time (Fig. 5d), we closed the loop on the brain’s feedback control system for steering: we took the fly’s predicted rotational velocity (\({\rm{d}}\theta /{\rm{d}}t\)) at each time point, and we fed it back into the head direction representation at the next time point, in order to compute updated PFL2 and PFL3 activity. The simulation was updated at a frequency of 10 Hz, and Fig. 5d shows 10 s of simulated time. We arbitrarily took 0° as the goal direction, so directional error is equal to θ. We drew the random steering component ε (equation (5)) from a Gaussian distribution, then we low-pass filtered ε(t) at 2 Hz, before rescaling ε(t) to enforce a standard deviation of 10°. This was done for different values of S, using the same frozen noise sample ε(t) in each case. In Fig. 5k, we used many independent random samples of ε(t), each simulation run included 100 s of simulated time, and we swept through many values of S, computing PFL2 bump amplitude and the consistency of head direction (p) for each run, with p = (one-circular variance(θ)). Model code was written and implemented in Python v.3.9.5.

    Reporting summary

    Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

    [ad_2]

    Source link

  • Structural basis of ribosomal 30S subunit degradation by RNase R

    [ad_1]

  • Warner, J. R. The economics of ribosome biosynthesis in yeast. Trends Biochem. Sci. 24, 437–440 (1999).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Condon, C., Liveris, D., Squires, C., Schwartz, I. & Squires, C. L. rRNA operon multiplicity in Escherichia coli and the physiological implications of rrn inactivation. J. Bacteriol. 177, 4152–4156 (1995).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Klappenbach, J. A., Dunbar, J. M. & Schmidt, T. M. rRNA operon copy number reflects ecological strategies of bacteria. Appl. Environ. Microbiol. 66, 1328–1333 (2000).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Cheng, Z.-F. & Deutscher, M. P. Quality control of ribosomal RNA mediated by polynucleotide phosphorylase and RNase R. Proc. Natl Acad. Sci. USA 100, 6388–6393 (2003).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Piir, K., Paier, A., Liiv, A., Tenson, T. & Maiväli, Ü. Ribosome degradation in growing bacteria. EMBO Rep. 12, 458–462 (2011).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Roller, B. R. K., Stoddard, S. F. & Schmidt, T. M. Exploiting rRNA operon copy number to investigate bacterial reproductive strategies. Nat. Microbiol. 1, 16160 (2016).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Bremer, H. & Dennis, P. P. Modulation of chemical composition and other parameters of the cell at different exponential growth rates. EcoSal Plus 3, ecosal.5.2.3 (2008).

    Article 

    Google Scholar
     

  • Li, S. H.-J. et al. Escherichia coli translation strategies differ across carbon, nitrogen and phosphorus limitation conditions. Nat. Microbiol. 3, 939–947 (2018).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Jacob, A. I., Köhrer, C., Davies, B. W., RajBhandary, U. L. & Walker, G. C. Conserved bacterial RNase YbeY plays key roles in 70S ribosome quality control and 16S rRNA maturation. Mol. Cell 49, 427–438 (2013).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Moore, S. D. & Sauer, R. T. The tmRNA system for translational surveillance and ribosome rescue. Annu. Rev. Biochem. 76, 101–124 (2007).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Basturea, G. N., Zundel, M. A. & Deutscher, M. P. Degradation of ribosomal RNA during starvation: comparison to quality control during steady-state growth and a role for RNase PH. RNA 17, 338–345 (2011).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Maiväli, Ü., Paier, A. & Tenson, T. When stable RNA becomes unstable: the degradation of ribosomes in bacteria and beyond. Biol. Chem. 394, 845–855 (2013).

    Article 
    PubMed 

    Google Scholar
     

  • Smith, B. A., Gupta, N., Denny, K. & Culver, G. M. Characterization of 16S rRNA processing with pre-30S subunit assembly intermediates from E. coli. J. Mol. Biol. 430, 1745–1759 (2018).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Sulthana, S. & Deutscher, M. P. Multiple exoribonucleases catalyze maturation of the 3′ terminus of 16S ribosomal RNA (rRNA). J. Biol. Chem. 288, 12574–12579 (2013).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Arraiano, C. M., Matos, R. G. & Barbas, A. RNase II: the finer details of the Modus operandi of a molecular killer. RNA Biol. 7, 276–281 (2010).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Lorentzen, E., Basquin, J., Tomecki, R., Dziembowski, A. & Conti, E. Structure of the active subunit of the yeast exosome core, Rrp44: diverse modes of substrate recruitment in the RNase II nuclease family. Mol. Cell 29, 717–728 (2008).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Chen, C. & Deutscher, M. P. Elevation of RNase R in response to multiple stress conditions. J. Biol. Chem. 280, 34393–34396 (2005).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Abula, A. et al. Molecular mechanism of RNase R substrate sensitivity for RNA ribose methylation. Nucleic Acids Res. 49, 4738–4749 (2021).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Chu, L.-Y. et al. Structural insights into RNA unwinding and degradation by RNase R. Nucleic Acids Res. 45, 12015–12024 (2017).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Chhabra, S., Mandell, Z. F., Liu, B., Babitzke, P. & Bechhofer, D. H. Analysis of mRNA decay intermediates in Bacillus subtilis 3′ exoribonuclease and RNA helicase mutant strains. mBio 13, e00400-22 (2022).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Donovan, W. P. & Kushner, S. R. Polynucleotide phosphorylase and ribonuclease II are required for cell viability and mRNA turnover in Escherichia coli K-12. Proc. Natl Acad. Sci. USA 83, 120–124 (1986).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Cheng, Z.-F., Zuo, Y., Li, Z., Rudd, K. E. & Deutscher, M. P. The vacB gene required for virulence in Shigella flexneri and Escherichia coli encodes the exoribonuclease RNase R. J. Biol. Chem. 273, 14077–14080 (1998).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Kaplan, R. & Apirion, D. The involvement of ribonuclease I, ribonuclease II, and polynucleotide phosphorylase in the degradation of stable ribonucleic acid during carbon starvation in Escherichia coli. J. Biol. Chem. 249, 149–151 (1974).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Sulthana, S., Basturea, G. N. & Deutscher, M. P. Elucidation of pathways of ribosomal RNA degradation: an essential role for RNase E. RNA 22, 1163–1171 (2016).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Lipońska, A. & Yap, M.-N. F. Hibernation-promoting factor sequesters Staphylococcus aureus ribosomes to antagonize RNase R-mediated nucleolytic degradation. mBio 12, e0033421 (2021).

    Article 
    PubMed 

    Google Scholar
     

  • Malecki, M., Bárria, C. & Arraiano, C. M. Characterization of the RNase R association with ribosomes. BMC Microbiol. 14, 34 (2014).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Prossliner, T., Gerdes, K., Sørensen, M. A. & Winther, K. S. Hibernation factors directly block ribonucleases from entering the ribosome in response to starvation. Nucleic Acids Res. 49, 2226–2239 (2021).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Crowe-McAuliffe, C. et al. Structural basis for bacterial ribosome-associated quality control by RqcH and RqcP. Mol. Cell 81, 115–126 (2021).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Filbeck, S. et al. Mimicry of canonical translation elongation underlies alanine tail synthesis in RQC. Mol. Cell 81, 104–114 (2021).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Frazão, C. et al. Unravelling the dynamics of RNA degradation by ribonuclease II and its RNA-bound complex. Nature 443, 110–114 (2006).

    Article 
    ADS 
    PubMed 

    Google Scholar
     

  • Faehnle, C. R., Walleshauser, J. & Joshua-Tor, L. Mechanism of Dis3l2 substrate recognition in the Lin28–let-7 pathway. Nature 514, 252–256 (2014).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Beckert, B. et al. Structure of a hibernating 100S ribosome reveals an inactive conformation of the ribosomal protein S1. Nat. Microbiol. 3, 1115–1121 (2018).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Crowe-McAuliffe, C. et al. Structural basis for antibiotic resistance mediated by the Bacillus subtilis ABCF ATPase VmlR. Proc. Natl Acad. Sci. USA 115, 8978–8983 (2018).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Boehringer, D., O’Farrell, H. C., Rife, J. P. & Ban, N. Structural insights into methyltransferase KsgA function in 30S ribosomal subunit biogenesis. J. Biol. Chem. 287, 10453–10459 (2012).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Guo, Q. et al. Dissecting the in vivo assembly of the 30S ribosomal subunit reveals the role of RimM and general features of the assembly process. Nucleic Acids Res. 41, 2609–2620 (2013).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Jahagirdar, D. et al. Alternative conformations and motions adopted by 30S ribosomal subunits visualized by cryo-electron microscopy. RNA 26, 2017–2030 (2020).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Maksimova, E. M. et al. RbfA Is Involved in two important stages of 30S subunit assembly: formation of the central pseudoknot and docking of helix 44 to the decoding center. Int. J. Mol. Sci. 22, 6140 (2021).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Maksimova, E., Kravchenko, O., Korepanov, A. & Stolboushkina, E. Protein assistants of small ribosomal subunit biogenesis in bacteria. Microorganisms 10, 747 (2022).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Matos, R. G., Barbas, A. & Arraiano, C. M. RNase R mutants elucidate the catalysis of structured RNA: RNA-binding domains select the RNAs targeted for degradation. Biochem. J. 423, 291–301 (2009).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Hossain, S. T., Malhotra, A. & Deutscher, M. P. The helicase activity of ribonuclease R Is essential for efficient nuclease activity. J. Biol. Chem. 290, 15697–15706 (2015).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Hossain, S. T., Malhotra, A. & Deutscher, M. P. How RNase R degrades structured RNA: role of the helicase activity and the S1 domain. J. Biol. Chem. 291, 7877–7887 (2016).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Loh, P. C., Morimoto, T., Matsuo, Y., Oshima, T. & Ogasawara, N. The GTP-binding protein YqeH participates in biogenesis of the 30S ribosome subunit in Bacillus subtilis. Genes Genet. Syst. 82, 281–289 (2007).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Nishima, W. et al. Hyper-swivel head domain motions are required for complete mRNA–tRNA translocation and ribosome resetting. Nucleic Acids Res. 50, 8302–8320 (2022).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Li, Z. RNA quality control: degradation of defective transfer RNA. EMBO J. 21, 1132–1138 (2002).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Bralley, P., Gust, B., Chang, S., Chater, K. F. & Jones, G. H. RNA 3′-tail synthesis in Streptomyces: in vitro and in vivo activities of RNase PH, the SCO3896 gene product and polynucleotide phosphorylase. Microbiology 152, 627–636 (2006).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Mohanty, B. K. & Kushner, S. R. Analysis of the function of Escherichia coli poly(A) polymerase I in RNA metabolism. Mol. Microbiol. 34, 1094–1108 (1999).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Campos-Guillén, J., Bralley, P., Jones, G. H., Bechhofer, D. H. & Olmedo-Alvarez, G. Addition of poly(A) and heteropolymeric 3′ ends in Bacillus subtilis wild-type and polynucleotide phosphorylase-deficient strains. J. Bacteriol. 187, 4698–4706 (2005).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Hussain, T., Llácer, J. L., Wimberly, B. T., Kieft, J. S. & Ramakrishnan, V. Large-scale movements of IF3 and tRNA during bacterial translation initiation. Cell 167, 133–144 (2016).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Failmezger, J., Nitschel, R., Sánchez-Kopper, A., Kraml, M. & Siemann-Herzberg, M. Site-specific cleavage of ribosomal RNA in Escherichia coli-based cell-free protein synthesis systems. PLoS ONE 11, e0168764 (2016).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Schedlbauer, A. et al. A conserved rRNA switch is central to decoding site maturation on the small ribosomal subunit. Sci. Adv. 7, eabf7547 (2021).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Beckert, B. et al. Structure of the Bacillus subtilis hibernating 100S ribosome reveals the basis for 70S dimerization. EMBO J. 36, 2061–2072 (2017).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Franken, L. E. et al. A general mechanism of ribosome dimerization revealed by single-particle cryo-electron microscopy. Nat. Commun. 8, 722 (2017).

    Article 
    ADS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Matzov, D. et al. The cryo-EM structure of hibernating 100S ribosome dimer from pathogenic Staphylococcus aureus. Nat. Commun. 8, 723 (2017).

    Article 
    ADS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Khusainov, I. et al. Structures and dynamics of hibernating ribosomes from Staphylococcus aureus mediated by intermolecular interactions of HPF. EMBO J. 36, 2073–2087 (2017).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Cerullo, F. et al. Bacterial ribosome collision sensing by a MutS DNA repair ATPase paralogue. Nature 603, 509–514 (2022).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Sambrook, J., Fritsch, E. F. & Maniatis, T. Molecular Cloning: A Laboratory Manual 2nd edn (Cold Spring Harbor Laboratory Press, 1989).

  • Liu, H. & Naismith, J. H. An efficient one-step site-directed deletion, insertion, single and multiple-site plasmid mutagenesis protocol. BMC Biotechnol. 8, 91 (2008).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Dimitrova, L. et al. Structural characterization of the Chaetomium thermophilum TREX-2 complex and its interaction with the mRNA nuclear export factor Mex67:Mtr2. Structure 23, 1246–1257 (2015).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Blaha, G. et al. in Methods in Enzymology Vol. 317 (eds. Abelson, J. N. & Celander, D. W.) 292–309 (Elsevier, 2000).

  • Arenz, S. et al. Drug sensing by the ribosome induces translational arrest via active site perturbation. Mol. Cell 56, 446–452 (2014).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Zivanov, J. et al. New tools for automated high-resolution cryo-EM structure determination in RELION-3. eLife 7, e42166 (2018).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Zivanov, J., Nakane, T. & Scheres, S. H. W. A Bayesian approach to beam-induced motion correction in cryo-EM single-particle analysis. IUCrJ 6, 5–17 (2019).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Zheng, S. Q. et al. MotionCor2: anisotropic correction of beam-induced motion for improved cryo-electron microscopy. Nat. Methods 14, 331–332 (2017).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Rohou, A. & Grigorieff, N. CTFFIND4: fast and accurate defocus estimation from electron micrographs. J. Struct. Biol. 192, 216–221 (2015).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Wagner, T. et al. SPHIRE-crYOLO is a fast and accurate fully automated particle picker for cryo-EM. Commun. Biol. 2, 218 (2019).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Wagner, T. & Raunser, S. The evolution of SPHIRE-crYOLO particle picking and its application in automated cryo-EM processing workflows. Commun. Biol. 3, 61 (2020).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Casañal, A., Lohkamp, B. & Emsley, P. Current developments in Coot for macromolecular model building of electron cryo‐microscopy and crystallographic data. Protein Sci. 29, 1055–1064 (2020).

    Article 

    Google Scholar
     

  • Emsley, P., Lohkamp, B., Scott, W. G. & Cowtan, K. Features and development of Coot. Acta Crystallogr. D 66, 486–501 (2010).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Jumper, J. et al. Highly accurate protein structure prediction with AlphaFold. Nature 596, 583–589 (2021).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Kovalevskiy, O., Nicholls, R. A., Long, F., Carlon, A. & Murshudov, G. N. Overview of refinement procedures within REFMAC 5: utilizing data from different sources. Acta Crystallogr. D 74, 215–227 (2018).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Nicholls, R. A., Fischer, M., McNicholas, S. & Murshudov, G. N. Conformation-independent structural comparison of macromolecules with ProSMART. Acta Crystallogr. D 70, 2487–2499 (2014).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Varadi, M. et al. AlphaFold protein structure database: massively expanding the structural coverage of protein-sequence space with high-accuracy models. Nucleic Acids Res. 50, D439–D444 (2022).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Goddard, T. D. et al. UCSF ChimeraX: meeting modern challenges in visualization and analysis: UCSF ChimeraX Visualization System. Protein Sci. 27, 14–25 (2018).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Pettersen, E. F. et al. UCSF ChimeraX: structure visualization for researchers, educators, and developers. Protein Sci. 30, 70–82 (2021).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Yamashita, K., Palmer, C. M., Burnley, T. & Murshudov, G. N. Cryo-EM single-particle structure refinement and map calculation using Servalcat. Acta Crystallogr. D 77, 1282–1291 (2021).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Sweeney, B. A. et al. R2DT is a framework for predicting and visualising RNA secondary structure using templates. Nat. Commun. 12, 3494 (2021).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Pedreira, T., Elfmann, C. & Stülke, J. The current state of SubtiWiki, the database for the model organism Bacillus subtilis. Nucleic Acids Res. 50, D875–D882 (2022).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Schneider, C. A., Rasband, W. S., & Eliceiri, K. W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 9, 671–675 (2012).

  • [ad_2]

    Source link

  • Convergence of coronary artery disease genes onto endothelial cell programs

    [ad_1]

  • Uffelmann, E. et al. Genome-wide association studies. Nat. Rev. Methods Primers 1, 59 (2021).

    Article 
    CAS 

    Google Scholar
     

  • Visscher, P. M. et al. 10 years of GWAS discovery: biology, function, and translation. Am. J. Hum. Genet. 101, 5–22 (2017).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Claussnitzer, M. et al. A brief history of human disease genetics. Nature 577, 179–189 (2020).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • de Leeuw, C. A., Mooij, J. M., Heskes, T. & Posthuma, D. MAGMA: generalized gene-set analysis of GWAS data. PLoS Comput. Biol. 11, e1004219 (2015).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Weeks, E. M. et al. Leveraging polygenic enrichments of gene features to predict genes underlying complex traits and diseases. Nat. Genet. 55, 1267–1276 (2023).

  • Pers, T. H. et al. Biological interpretation of genome-wide association studies using predicted gene functions. Nat. Commun. 6, 5890 (2015).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Westra, H.-J. & Franke, L. From genome to function by studying eQTLs. Biochim. Biophys. Acta 1842, 1896–1902 (2014).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Maurano, M. T. et al. Systematic localization of common disease-associated variation in regulatory DNA. Science 337, 1190–1195 (2012).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Nasser, J. et al. Genome-wide enhancer maps link risk variants to disease genes. Nature 593, 238–243 (2021).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • van der Harst, P. & Verweij, N. Identification of 64 novel genetic loci provides an expanded view on the genetic architecture of coronary artery disease. Circ. Res. 122, 433–443 (2018).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Tcheandjieu, C. et al. Large-scale genome-wide association study of coronary artery disease in genetically diverse populations. Nat. Med. 28, 1679–1692 (2022).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Aragam, K. G. et al. Discovery and systematic characterization of risk variants and genes for coronary artery disease in over a million participants. Nat. Genet. 54, 1803–1815 (2022).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Gimbrone, M. A. Jr & García-Cardeña, G. Endothelial cell dysfunction and the pathobiology of atherosclerosis. Circ. Res. 118, 620–636 (2016).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Gupta, R. M. et al. A genetic variant associated with five vascular diseases is a distal regulator of endothelin-1 gene expression. Cell 170, 522–533.e15 (2017).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Turner, A. W. et al. Single-nucleus chromatin accessibility profiling highlights regulatory mechanisms of coronary artery disease risk. Nat. Genet. 54, 804–816 (2022).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Pepin, M. E. & Gupta, R. The role of endothelial cells in atherosclerosis: insights from genetic association studies. Am. J. Pathol. https://doi.org/10.1016/j.ajpath.2023.09.012 (2023).

  • Dixit, A. et al. Perturb-seq: dissecting molecular circuits with scalable single-cell RNA profiling of pooled genetic screens. Cell 167, 1853–1866.e17 (2016).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Adamson, B. et al. A multiplexed single-cell CRISPR screening platform enables systematic dissection of the unfolded protein response. Cell 167, 1867–1882.e21 (2016).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Replogle, J. M. et al. Mapping information-rich genotype–phenotype landscapes with genome-scale Perturb-seq. Cell 185, 2559–75.e38 (2022).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Datlinger, P. et al. Pooled CRISPR screening with single-cell transcriptome readout. Nat. Methods 14, 297–301 (2017).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Bouïs, D., Hospers, G. A., Meijer, C., Molema, G. & Mulder, N. H. Endothelium in vitro: a review of human vascular endothelial cell lines for blood vessel-related research. Angiogenesis 4, 91–102 (2001).

    Article 
    PubMed 

    Google Scholar
     

  • Fulco, C. P., Nasser, J., Jones, T. R. & Munson, G. Activity-by-contact model of enhancer–promoter regulation from thousands of CRISPR perturbations. Nat. Genet. 51, 1664–1669 (2019).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Norman, T. M. et al. Exploring genetic interaction manifolds constructed from rich single-cell phenotypes. Science 365, 786–793 (2019).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Morris, J. A. et al. Discovery of target genes and pathways at GWAS loci by pooled single-cell CRISPR screens. Science 380, eadh7699 (2023).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Kotliar, D. et al. Identifying gene expression programs of cell-type identity and cellular activity with single-cell RNA-seq. eLife 8, e43803 (2019).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Nichol, D. & Stuhlmann, H. EGFL7: a unique angiogenic signaling factor in vascular development and disease. Blood 119, 1345–1352 (2012).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Brütsch, R. et al. Integrin cytoplasmic domain-associated protein-1 attenuates sprouting angiogenesis. Circ. Res. 107, 592–601 (2010).

    Article 
    PubMed 

    Google Scholar
     

  • Finucane, H. K. et al. Partitioning heritability by functional annotation using genome-wide association summary statistics. Nat. Genet. 47, 1228–1235 (2015).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Stolze, L. K. et al. Systems genetics in human endothelial cells identifies non-coding variants modifying enhancers, expression, and complex disease traits. Am. J. Hum. Genet. 106, 748–763 (2020).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Wünnemann, F. et al. Multimodal CRISPR perturbations of GWAS loci associated with coronary artery disease in vascular endothelial cells. PLoS Genet. 19, e1010680 (2023).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Stacey, D. et al. ProGeM: a framework for the prioritization of candidate causal genes at molecular quantitative trait loci. Nucleic Acids Res. 47, e3 (2019).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Jagadeesh, K. A. et al. Identifying disease-critical cell types and cellular processes by integrating single-cell RNA-sequencing and human genetics. Nat. Genet. 54, 1479–1492 (2022).

  • GTEx Consortium. The GTEx Consortium atlas of genetic regulatory effects across human tissues. Science 369, 1318–1330 (2020).

    Article 

    Google Scholar
     

  • Snellings, D. A. et al. Cerebral cavernous malformation: from mechanism to therapy. Circ. Res. 129, 195–215 (2021).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Zhou, Z. et al. The cerebral cavernous malformation pathway controls cardiac development via regulation of endocardial MEKK3 signaling and KLF expression. Dev. Cell 32, 168–180 (2015).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Riolo, G., Ricci, C. & Battistini, S. Molecular genetic features of cerebral cavernous malformations (CCM) patients: an overall view from genes to endothelial cells. Cells 10, 704 (2021).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Gingras, A. R. et al. Central region of talin has a unique fold that binds vinculin and actin. J. Biol. Chem. 285, 29577–29587 (2010).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Cowell, A. R. et al. Talin rod domain–containing protein 1 (TLNRD1) is a novel actin-bundling protein which promotes filopodia formation. J. Cell Biol. 220, e202005214 (2021).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Luck, K. et al. A reference map of the human binary protein interactome. Nature 580, 402–408 (2020).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Fisher, O. S. et al. Structural basis for the disruption of the cerebral cavernous malformations 2 (CCM2) interaction with Krev interaction trapped 1 (KRIT1) by disease-associated mutations. J. Biol. Chem. 290, 2842–2853 (2015).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Draheim, K. M. et al. CCM2–CCM3 interaction stabilizes their protein expression and permits endothelial network formation. J. Cell Biol. 208, 987–1001 (2015).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Zhou, Z. et al. Cerebral cavernous malformations arise from endothelial gain of MEKK3-KLF2/4 signalling. Nature 532, 122–126 (2016).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Renz, M. et al. Regulation of β1 integrin–Klf2-mediated angiogenesis by CCM proteins. Dev. Cell 32, 181–190 (2015).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Donat, S. et al. Heg1 and Ccm1/2 proteins control endocardial mechanosensitivity during zebrafish valvulogenesis. eLife 7, e28939 (2018).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Khera, A. V. et al. Gene sequencing identifies perturbation in nitric oxide signaling as a nonlipid molecular subtype of coronary artery disease. Circ. Genom. Precis. Med. 15, e003598 (2022).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Macek Jilkova, Z. et al. CCM proteins control endothelial β1 integrin dependent response to shear stress. Biol. Open 3, 1228–1235 (2014).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Knowles, J. W. et al. Enhanced atherosclerosis and kidney dysfunction in eNOS–/–Apoe–/– mice are ameliorated by enalapril treatment. J. Clin. Invest. 105, 451–458 (2000).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Mueller, P. A. et al. Coronary artery disease risk-associated Plpp3 gene and its product lipid phosphate phosphatase 3 regulate experimental atherosclerosis. Arterioscler. Thromb. Vasc. Biol. 39, 2261–2272 (2019).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Denier, C. et al. Genotype–phenotype correlations in cerebral cavernous malformations patients. Ann. Neurol. 60, 550–556 (2006).

    Article 
    PubMed 

    Google Scholar
     

  • Finak, G. et al. MAST: a flexible statistical framework for assessing transcriptional changes and characterizing heterogeneity in single-cell RNA sequencing data. Genome Biol. 16, 278 (2015).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Whitehead, K. J. et al. The cerebral cavernous malformation signaling pathway promotes vascular integrity via Rho GTPases. Nat. Med. 15, 177–184 (2009).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Zheng, X. et al. CCM3 signaling through sterile 20-like kinases plays an essential role during zebrafish cardiovascular development and cerebral cavernous malformations. J. Clin. Invest. 120, 2795–2804 (2010).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Fulco, C. P., Munschauer, M., Anyoha, R. & Munson, G. Systematic mapping of functional enhancer–promoter connections with CRISPR interference. Science 354, 769–773 (2016).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Thakore, P. I. et al. Highly specific epigenome editing by CRISPR–Cas9 repressors for silencing of distal regulatory elements. Nat. Methods 12, 1143–1149 (2015).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Gilbert, L. A. et al. Genome-scale CRISPR-mediated control of gene repression and activation. Cell 159, 647–661 (2014).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Bray, N. L., Pimentel, H., Melsted, P. & Pachter, L. Near-optimal probabilistic RNA-seq quantification. Nat. Biotechnol. 34, 525–527 (2016).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Law, C. W., Chen, Y., Shi, W. & Smyth, G. K. voom: precision weights unlock linear model analysis tools for RNA-seq read counts. Genome Biol. 15, R29 (2014).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Chen, Y., Lun, A. T. L. & Smyth, G. K. From reads to genes to pathways: differential expression analysis of RNA-seq experiments using Rsubread and the edgeR quasi-likelihood pipeline. F1000Research 5, 1438 (2016).

    PubMed 
    PubMed Central 

    Google Scholar
     

  • Huang, H. et al. Fine-mapping inflammatory bowel disease loci to single-variant resolution. Nature 547, 173–178 (2017).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Marshall, J. L. et al. HyPR-seq: single-cell quantification of chosen RNAs via hybridization and sequencing of DNA probes. Proc. Natl Acad. Sci. USA 117, 33404–33413 (2020).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Hart, T. & Moffat, J. BAGEL: a computational framework for identifying essential genes from pooled library screens. BMC Bioinformatics 17, 164 (2016).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Soneson, C. & Robinson, M. D. Bias, robustness and scalability in single-cell differential expression analysis. Nat. Methods 15, 255–261 (2018).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Nygaard, V., Rødland, E. A. & Hovig, E. Methods that remove batch effects while retaining group differences may lead to exaggerated confidence in downstream analyses. Biostatistics 17, 29–39 (2016).

    Article 
    MathSciNet 
    PubMed 

    Google Scholar
     

  • Robinson, M. D., McCarthy, D. J. & Smyth, G. K. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26, 139–140 (2010).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • McCarthy, D. J., Chen, Y. & Smyth, G. K. Differential expression analysis of multifactor RNA-seq experiments with respect to biological variation. Nucleic Acids Res. 40, 4288–4297 (2012).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Wu, T. et al. clusterProfiler 4.0: a universal enrichment tool for interpreting omics data. Innovation 2, 100141 (2021).

    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Subramanian, A. et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl Acad. Sci. USA 102, 15545–15550 (2005).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Karolchik, D., Hinrichs, A. S. & James Kent, W. The UCSC genome browser. Curr. Protoc. Hum. Genet. 71, 18.6.1–18.6.33 (2011).


    Google Scholar
     

  • Wirka, R. C. et al. Atheroprotective roles of smooth muscle cell phenotypic modulation and the TCF21 disease gene as revealed by single-cell analysis. Nat. Med. 25, 1280–1289 (2019).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Finucane, H. K. et al. Heritability enrichment of specifically expressed genes identifies disease-relevant tissues and cell types. Nat. Genet. 50, 621–629 (2018).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Dey, K. K. et al. Contribution of enhancer-driven and master-regulator genes to autoimmune disease revealed using functionally informed SNP-to-gene linking strategies. Cell Genomics 2, 100145 (2022).

  • Zhang, K. et al. A single-cell atlas of chromatin accessibility in the human genome. Cell 184, 5985–6001.e19 (2021).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Hujoel, M. L. A., Gazal, S., Hormozdiari, F., van de Geijn, B. & Price, A. L. Disease heritability enrichment of regulatory elements is concentrated in elements with ancient sequence age and conserved function across species. Am. J. Hum. Genet. 104, 611–624 (2019).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Padarti, A. & Zhang, J. Recent advances in cerebral cavernous malformation research. Vessel Plus 2, 21 (2018).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Wei, S. et al. Cerebral cavernous malformation proteins in barrier maintenance and regulation. Int. J. Mol. Sci. 21, 675 (2020).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Fischer, A., Zalvide, J., Faurobert, E., Albiges-Rizo, C. & Tournier-Lasserve, E. Cerebral cavernous malformations: from CCM genes to endothelial cell homeostasis. Trends Mol. Med. 19, 302–308 (2013).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Cullere, X., Plovie, E., Bennett, P. M., MacRae, C. A. & Mayadas, T. N. The cerebral cavernous malformation proteins CCM2L and CCM2 prevent the activation of the MAP kinase MEKK3. Proc. Natl Acad. Sci. USA 112, 14284–14289 (2015).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Kleaveland, B. et al. Regulation of cardiovascular development and integrity by the heart of glass-cerebral cavernous malformation protein pathway. Nat. Med. 15, 169–176 (2009).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Engreitz, J. M. et al. Local regulation of gene expression by lncRNA promoters, transcription and splicing. Nature 539, 452–455 (2016).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Atri, D. S. et al. CRISPR–Cas9 genome editing of primary human vascular cells in vitro. Curr Protoc. 1, e291 (2021).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Jumper, J. et al. Highly accurate protein structure prediction with AlphaFold. Nature 596, 583–589 (2021).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • mattarnoldbio. mattarnoldbio/alphapickle: Release v.1.4.0. Zenodo https://doi.org/10.5281/zenodo.5708709 (2021).

  • Yang, X. et al. A public genome-scale lentiviral expression library of human ORFs. Nat. Methods 8, 659–661 (2011).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Bray, M.-A. et al. Cell Painting, a high-content image-based assay for morphological profiling using multiplexed fluorescent dyes. Nat. Protoc. 11, 1757–1774 (2016).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Higaki, T. Quantitative evaluation of cytoskeletal organizations by microscopic image analysis. Plant Morphol. 29, 15–21 (2017).

    Article 

    Google Scholar
     

  • Kroll, F. et al. A simple and effective F0 knockout method for rapid screening of behaviour and other complex phenotypes. eLife 10, e59683 (2021).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Lu, F., Leach, L. L. & Gross, J. M. A CRISPR–Cas9-mediated F0 screen to identify pro-regenerative genes in the zebrafish retinal pigment epithelium. Sci. Rep. 13, 3142 (2023).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Moulton, J. D. & Yan, Y.-L. Using morpholinos to control gene expression. Curr. Protoc. Mol. Biol. Chapter 26, Unit 26.8 (2008).

    PubMed 

    Google Scholar
     

  • Hoeppner, L. H. et al. Revealing the role of phospholipase Cβ3 in the regulation of VEGF-induced vascular permeability. Blood 120, 2167–2173 (2012).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Wang, Y. et al. Dissecting VEGF-induced acute versus chronic vascular hyperpermeability: essential roles of dimethylarginine dimethylaminohydrolase-1. iScience 24, 103189 (2021).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Zebrafish embryo medium. Cold Spring Harb. Protoc. 2011, db.rec12478 (2011).

  • Machikhin, A. S., Volkov, M. V., Burlakov, A. B., Khokhlov, D. D. & Potemkin, A. V. Blood vessel imaging at pre-larval stages of zebrafish embryonic development. Diagnostics 10, 886 (2020).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Thisse, C. & Thisse, B. High-resolution in situ hybridization to whole-mount zebrafish embryos. Nat. Protoc. 3, 59–69 (2008).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Sudlow, C. et al. UK Biobank: an open access resource for identifying the causes of a wide range of complex diseases of middle and old age. PLoS Med. 12, e1001779 (2015).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Roadmap Epigenomics Consortium. Integrative analysis of 111 reference human epigenomes. Nature 518, 317–330 (2015).

    Article 
    PubMed Central 

    Google Scholar
     

  • Hodonsky, C. J. et al. Multi-ancestry genetic analysis of gene regulation in coronary arteries prioritizes disease risk loci. Cell Genomics 4, 100465 (2024).

    Article 
    CAS 

    Google Scholar
     

  • Li, L. et al. Transcriptome-wide association study of coronary artery disease identifies novel susceptibility genes. Basic Res. Cardiol. 117, 6 (2022).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Mountjoy, E. et al. An open approach to systematically prioritize causal variants and genes at all published human GWAS trait-associated loci. Nat. Genet. 53, 1527–1533 (2021).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Ma, X. R. & Engreitz J. M. EngreitzLab/V2G: V2Gv1.0.0. Zenodo https://doi.org/10.5281/zenodo.10357646 (2023).

  • Kang, H., Guo, K. & Engreitz J. M. EngreitzLab/cNMF_pipeline: v1.0. Zenodo https://doi.org/10.5281/zenodo.10357454 (2023).

  • The R Development Core Team. R: A Language and Environment for Statistical Computing (R Foundation for Statistical Computing, 2022).

  • Yu, G., Wang, L.-G., Han, Y. & He, Q.-Y. clusterProfiler: an R package for comparing biological themes among gene clusters. OMICS 16, 284–287 (2012).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Stuart, T. et al. Comprehensive integration of single-Cell data. Cell 177, 1888–1902.e21 (2019).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Satija, R., Farrell, J. A., Gennert, D., Schier, A. F. & Regev, A. Spatial reconstruction of single-cell gene expression data. Nat. Biotechnol. 33, 495–502 (2015).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Macosko, E. Z. et al. Highly parallel genome-wide expression profiling of individual cells using nanoliter droplets. Cell 161, 1202–1214 (2015).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Amezquita, R. A. et al. Orchestrating single-cell analysis with Bioconductor. Nat. Methods 17, 137–145 (2020).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Wickham, H. ggplot2 (Springer-Verlag, 2016).

  • Gagolewski, M. stringi: fast and portable character string processing in R. J. Stat. Softw. 103, 1–59 (2022).

    Article 
    MathSciNet 

    Google Scholar
     

  • Holt, J., Huang, S., McMillan, L. & Wang, W. Read annotation pipeline for high-throughput sequencing data. In Proc. International Conference on Bioinformatics, Computational Biology and Biomedical Informatics 605–612 (Association for Computing Machinery, 2013).

  • Li, H. et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics 25, 2078–2079 (2009).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Bulik-Sullivan, B. K. et al. LD score regression distinguishes confounding from polygenicity in genome-wide association studies. Nat. Genet. 47, 291–295 (2015).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Langmead, B., Wilks, C., Antonescu, V. & Charles, R. Scaling read aligners to hundreds of threads on general-purpose processors. Bioinformatics 35, 421–432 (2019).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Gaspar, J. M. Improved peak-calling with MACS2. Preprint at bioRxiv https://doi.org/10.1101/496521 (2018).

  • Zheng, G. X. Y. et al. Massively parallel digital transcriptional profiling of single cells. Nat. Commun. 8, 14049 (2017).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Robinson, J. T. et al. Integrative genomics viewer. Nat. Biotechnol. 29, 24–26 (2011).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Ghoussaini, M. et al. Open Targets Genetics: systematic identification of trait-associated genes using large-scale genetics and functional genomics. Nucleic Acids Res. 49, D1311–D1320 (2021).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Purcell, S. et al. PLINK: a tool set for whole-genome association and population-based linkage analyses. Am. J. Hum. Genet. 81, 559–575 (2007).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Boughton, A. P. et al. LocusZoom.js: interactive and embeddable visualization of genetic association study results. Bioinformatics 37, 3017–3018 (2021).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Tsherniak, A. et al. Defining a cancer dependency map. Cell 170, 564–576.e16 (2017).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Alcid, E. A. & Tsukiyama, T. ATP-dependent chromatin remodeling shapes the long noncoding RNA landscape. Genes Dev. 28, 2348–2360 (2014).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • SenBanerjee, S. et al. KLF2 is a novel transcriptional regulator of endothelial proinflammatory activation. J. Exp. Med. 199, 1305–1315 (2004).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Coma, S. et al. GATA2 and LMO2 control angiogenesis and lymphangiogenesis via direct transcriptional regulation of neuropilin-2. Angiogenesis 16, 939–952 (2013).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Yu, M. et al. Computational estimates of annular diameter reveal genetic determinants of mitral valve function and disease. JCI Insight 7, e146580 (2022).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Hogan, B. M., Bussmann, J., Wolburg, H. & Schulte-Merker, S. ccm1 cell autonomously regulates endothelial cellular morphogenesis and vascular tubulogenesis in zebrafish. Hum. Mol. Genet. 17, 2424–2432 (2008).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Neuman, N. A. et al. The four-and-a-half LIM domain protein 2 regulates vascular smooth muscle phenotype and vascular tone. J. Biol. Chem. 284, 13202–13212 (2009).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Wang, W. et al. Essential role of Smad3 in angiotensin II-induced vascular fibrosis. Circ. Res. 98, 1032–1039 (2006).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Tsai, S. et al. TGF-β through Smad3 signaling stimulates vascular smooth muscle cell proliferation and neointimal formation. Am. J. Physiol. Heart Circ. Physiol. 297, H540–H549 (2009).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Crispino, J. D. & Weiss, M. J. Erythro-megakaryocytic transcription factors associated with hereditary anemia. Blood 123, 3080–3088 (2014).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Gruber, T. A. & Downing, J. R. The biology of pediatric acute megakaryoblastic leukemia. Blood 126, 943–949 (2015).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Hauser, W. et al. Megakaryocyte hyperplasia and enhanced agonist-induced platelet activation in vasodilator-stimulated phosphoprotein knockout mice. Proc. Natl Acad. Sci. USA 96, 8120–8125 (1999).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Pleines, I. et al. Mutations in tropomyosin 4 underlie a rare form of human macrothrombocytopenia. J. Clin. Invest. 127, 814–829 (2017).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Meinders, M. et al. Sp1/Sp3 transcription factors regulate hallmarks of megakaryocyte maturation and platelet formation and function. Blood 125, 1957–1967 (2015).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • [ad_2]

    Source link

  • Spatial transcriptomics reveal neuron–astrocyte synergy in long-term memory

    [ad_1]

    Mice

    All animal experiments were conducted following protocols approved by the Administrative Panel on Laboratory Animal Care at Stanford University. The TRAP2:Ai14 mouse line was a gift from the Luo laboratory at Stanford. TRAP210 mice were heterozygous for the Fos2A-icreER allele, and homozygous for Ai14 in the C57BL/6 background. Gt(ROSA)26Sortm1.1(CAG-cas9*,-EGFP)Fezh/J mice were acquired from Jackson Laboratory. Mice were group-housed (maximum 5 mice per cage) on a 12 h light:dark cycle (07:00 to 19:00, light) with food and water freely available. Mice were kept with ambient temperature at 21.1 ± 1.1 °C and humidity at 55 ± 5%. Male mice 49–56 days of age were used for all the experiments. Mice were handled daily for 3 days before their first behavioural experiment. The animal protocol no. 20787 was approved by Stanford University APLAC and IACUC. All surgeries were performed under avertin anaesthesia and carprofen analgesia, and every effort was made to minimize suffering, pain and distress.

    Genotyping

    The following primers: TCCTGGGCATTGCCTACAAC (forward), CTTCACTCTGATTCTGGCAATTTCG (reverse) and ACCCTGCTGCGCATTG (reporter) were used for genotyping of the Fos2A-icreER allele; CTGAGCTCACCCACGCT (forward), GGCTGCCTTGCCTTCTCT (reverse), ACTGCTCACAGGGCCAG (reporter) for wild-type allele; CGGCATGGACGAGCTGTA (forward), CAGGGCCGGCCTTGTA (reverse) and AATTGTGTTGCACTTAACG (reporter) were used for genotyping of the Rosa-Ai14 allele; TTCCCTCGTGATCTGCAACTC (forward), CTTTAAGCCTGCCCAGAAGACT (reverse) and CCGCCCATCTTCTAGAAAG (reporter) for Rosa wild-type allele.

    Fear conditioning

    The fear conditioning training was conducted according to previously described methods9. Each mouse was placed individually in the fear conditioning chamber (Coulbourn Instruments), which was positioned at the centre of a sound-attenuating cubicle. Prior to each session, the chamber was cleaned with 10% ethanol to provide a background odour, while a ventilation fan generated background noise at around 55 dB. The training began with a 2-min exploration period, after which the mice received three tone-foot shock pairings separated by 1-min intervals. Each tone, an 85 dB 2-kHz sound, lasted for 30 s, and was followed by a 2-s foot shock of 0.75 mA, with both ending simultaneously. Following each pairing, the mice remained in the chamber for an additional 60 s before being returned to their home cages. For context recall, the mice were reintroduced to the original conditioning chamber for 5 min, 16 days after the training. Injections of 4-hydroxytamoxifen injections were administered immediately prior to the recall experiments, within 30 min. In the HC and NR groups, 4-hydroxytamoxifen was injected at a similar time to the other two groups during the recall. The behaviour of the mice was recorded and analysed using FreezeFrame software (version 4; Coulbourn Instruments), with motionless bouts lasting over 1 s being considered as freezing.

    Brain tissue dissociation and flow cytometry

    Basolateral amygdala was microdissected from live sections cut by a vibratome (300 μm thick). Tissue pieces were enzymatically dissociated using a papain-based digestion system (LK003150, Worthington). In brief, tissue chunks were incubated with papain (containing L-cysteine), DNase I, and kynurenic acid for 1 h at 37 °C and 5% CO2. After incubation, tissues were triturated with 300 µm glass pipette tips, then 200 µm glass pipette tips, and 100 µm glass pipette tips. Cell suspensions were then centrifuged at 350g for 10 min at room temperature, resuspended in 1 ml EBSS with 10% v/v ovomucoid inhibitor, 4.5% v/v Dnase I, and 0.1% v/v kynurenic acid, and centrifuged again. The supernatant was removed, and 1 ml artificial cerebrospinal fluid (ACSF) was added to the cells. ACSF contained 2.5 mM KCl, 7 mM MgCl2, 0.5 mM CaCl2, 1.3 mM NaH2PO4, 110 mM choline chloride, 24 mM NaHCO3, 1.3 mM sodium ascorbate, 20 mM glucose, and 3 mM sodium pyruvate, 2 mM thiourea, and 13.2 mM trehalose. Cells were then passed through a 70 μm cell strainer to remove debris. Hoechst stain (1:2,000; H3570, Life Technologies) was added and incubated in the dark at 4 °C for 10 min. Samples were centrifuged (350g for 8 min at 4 °C) and resuspended in 0.5 ml of ACSF and kept on ice for flow cytometry. Live cells were sorted using the BD Vulcan into 384-well plates (Bio-Rad) directly into lysis buffer, oligodT, and layered with mineral oil. After sorting, the plates were immediately snap frozen until reverse transcription.

    Sequencing

    The Smartseq3 protocol was used for whole-cell lysis, first-strand synthesis and cDNA synthesis, as previously described with modifications. Following cDNA amplification (23 cycles), the concentration of cDNA was determined via Pico Green quantitation assay (384-well format) and normalized to 0.4 ng µl−1 using the TPP Labtech Mosquito HTS and Mantis (Formulatrix) robotic platforms. In-house Tn5 were used for cDNA tagmentation. Libraries were amplified using Kapa HiFi. The libraries were then sequenced on a Novaseq (illumina), using 2 × 100-bp paired-end reads and 2 × 12-bp index reads, with an average of 2 million reads per cell.

    Bioinformatics and data analysis for scRNA-seq

    Sequences from Nextseq or Novaseq were demultiplexed using bcl2fastq, and reads were aligned to the mm10 genome augmented with ERCC (External RNA Controls Consortium) sequences, using STARsolo 2.7.9a. We applied standard algorithms for cell filtration, feature selection and dimensionality reduction. In brief, genes that appeared in fewer than five cells, samples with fewer than 2,000 genes and samples with less than 50,000 reads were excluded from the analysis. Out of these cells, those with more than 10% of reads as ERCC or more than 20% mitochondrial were also excluded from analysis. Counts were log-normalized and then scaled where appropriate. Canonical correlation analysis (CCA) function from the Seurat70 package was used to align raw data from multiple experiments. The top 20 canonical components were used. After alignment, relevant features were selected by filtering expressed genes to a set of 2,000 with the highest positive and negative pairwise correlations. Genes were then projected into principal component space using the robust principal component analysis. DEG analysis was done by applying the Mann–Whitney–Wilcoxon test on various cell populations.

    To find memory-induced genes in each type of neurons, series of strict criteria were applied. First, we removed the background activation by excluding the DEGs resulted from FR versus NF among tdT negative neurons. This guarantees their specificity that DEGs are activity-dependent, rather than a general increase in all cells caused by experience. Second, DEGs must be differentially expressed when FR TRAPed cells are compared to NR and HC controls, ensuring that the DEGs were unique to neuronal ensembles associated with memory recall, and not a result of baseline activity (HC) or activity remaining from the initial fear learning (NR). Finally, each DEG had to meet the criteria of being expressed in a quater of cells and exhibiting at least a 1.75-fold change. By adhering to these standards, a total of 107 DEGs were recognized as ‘remote-memory-associated DEGs’ across 6 distinct neuron types, BLA.Int.Pvalb was not included in the analysis due to insufficient numbers of cells. EnrichR was used for GO, KEGG and REACTOME pathway analysis and classification of enriched genes (log2FC > 0.5 and P < 0.05) in each subpopulation.

    scRNA-seq data from mPFC cells were mapped to mm10 genome with full-length tdTomato construct (including Woodchuck Hepatitis Virus Posttranscriptional sequence included in Ai14 line71), which improved the sensitivity in calling tdT+ cells. Data from BLA and mPFC cells were integrated using CCA. TRAPed neurons from the each integrated population were analysed, except B-P.Int.Pvalb and B-P.Int.Gpr88 neurons, due to limited cell number. DEGs with P < 0.05 (Mann–Whitney–Wilcoxon test) were considered as significant DEGs (highlighted in orange in Fig. 5d and Extended Data Fig. 12f).

    After unbiased clustering astrocytes, RNA velocyto40 and Monocle341 were applied to infer astrocytic trajectory. DEGs between FR and NF conditions were estimated using Mann–Whitney–Wilcoxon test on each astrocyte population. R, RStudio, Python were used for data analysis.

    RNAscope

    The RNAscope multiplex fluorescent reagent kit v2 (323100, ACD) and RNAscope 4-Plex probes were used to conduct the RNAscope experiment according to the manufacturer’s guidelines. The probes employed were either obtained from available stocks or specially created by ACD.

    Gene selection for MERFISH measurements

    We used a combination of single-cell RNA sequencing data and literature to select genes for MERFISH. Our selection criteria involved identifying cell-type-marker genes for a particular cell population using a one-vs-all approach. To do this, we performed a Mann–Whitney–Wilcoxon test for each gene between the cells within the cell population and all other cells not in that population, and corrected the resulting P values for multiple hypothesis testing to obtain false discovery rate-adjusted P values. A gene was considered a cell-type marker for a specific cell population if it met the following criteria: (1) it was expressed in at least 30% of cells within the specified population; (2) the false discovery rate-adjusted P value < 0.001; (3) gene expression in the specified population was at least fourfold higher than the average expression in all cells not in that population; and (4) expressed in a fraction of cells within the specified population that was at least 2 times higher than any other population of cells. We then sorted the marker genes for each population by fold change in expression relative to cells outside the population, and saved the top five marker genes for each population to use for marker selection. In addition to these markers, known genes related to microglia, astrocytes and OPCs from the literature and included. Finally, DEGs from remote memory-associated genes were added to the panel with a total number of 158 genes.

    Tissue processing for MERFISH and RNAscope

    Brain tissue samples were processed using a fixed-frozen protocol for both MERFISH and RNAscope. In brief, mice were euthanized using CO2 and perfused with cold 4% paraformaldehyde. Brain tissue was dissected and followed by incubation at 4 °C in 4% paraformaldehyde overnight, 15% sucrose for 12 h, and 30% sucrose until sink. Brain tissue was frozen in OCT using dry ice and stored at −80 °C until sectioning. Sectioning was performed on a cryostat at −18 °C. Slices were removed and discarded until BLA region was reached.

    Slices with 10 μm in thickness were captured onto Superfrost slides for RNAscope and MERSCOPE slides for MERFISH. The same anatomical region was identified for imaging post hoc after sample preparation, before the start of RNAscope or MERFISH imaging.

    Sample preparation and MERFISH imaging

    Slides with tissue sections were processed according to MERSCOPE protocol (Vizgen). In brief, slides with tissue sections were washed three times in PBS, and then stored in 70% ethanol at 4 °C for 18 h to permeabilize the tissue. Tissue slices from the same mouse were cut at the same time and distributed onto four coverslips. After permeabilization, the samples were removed from 70% ethanol and washed with Sample Prep Wash Buffer (PN 20300001), then incubated with Formamide Wash Buffer (PN 20300002) at 37 °C for 30 min. Gene Panel Mix (RNA probes) was incubated for 48 h at 37 °C. After hybridization, the samples were washed in Formamide Wash Buffer for 30 min at 47 °C for a total of 2 times to remove excess encoding probes and polyA-anchor probes. Tissue samples were then cleared to remove lipids and proteins that contribute fluorescence background. In brief, the samples were embedded in a thin 4% polyacrylamide gel and were then treated with Clearing Premix (PN 20300003) for 36 h at 37 °C. After digestion, the coverslips were washed in Sample Prep Wash Buffer 2 times and stain with DAPI/PolyT mix for 15 min. Slides were washed with Formamide Wash Buffer followed by Sample Prep Wash Buffer before imaging. Finally, slides were loaded to MERSCOPE Flow Chamber and imaged at both 20× and 63× magnification.

    MERFISH data processing

    MERFISH imaging data were processed with MERlin72 pipeline with cell segmentation using CellPose73, a deep learning-based cell segmentation algorithm based on DAPI staining. Decoding molecules were then assigned to the segmented nuclei to produce a cell-by-gene matrix that list the number of molecules decoded for each gene in each cell. The MERFISH expression matrix for each sample was concatenated with the normalized, log-transformed with Scanpy74 and integrated using Harmony75 and Leiden76 clustering was applied to separate the cells into distinct clusters. TRAPed neurons were assigned based on tdTomato expression. DEGs from a comparison of FR-TRAPed and NF-TRAPed conditions were estimated using Mann–Whitney–Wilcoxon test. Peri-engram cells were computed as follows: for each engram cell (tdT+), its peri-engram cells were counted within a radius of 30 μm.

    CalEx injection and behavioural experiments

    AAVs carrying CalEx51 or tdTomato were generated by Addgene based on the vector pZac2.1-GfaABC1D-mCherry-hPMCA2w/b (AAV5, Addgene 111568) or pZac2.1 gfaABC1D-tdTomato (AAV5, Addgene 44332). Stereotaxic procedure of viral microinjection has been described previously. In brief, mice with fear training (within 12 h or after 24 h) were anaesthetized and placed onto a stereotaxic frame (model 1900, KOPF). Mice were injected with Carprofen (5 mg kg−1) subcutaneously before and after surgery. AAVs carrying hPMCA2w/b (CalEx) or control (tdTomato) viruses were loaded via a glass pipette connected with a 10 μl Hamilton syringe (Hamilton, 80308) on a syringe injection pump (WPI, SP101I) Bevelled glass pipettes (1B100–4; World Precision Instruments) filled with viruses were placed into the BLA (1.3 mm posterior to the bregma, 3.4 mm lateral and to the midline, and 4.6 mm from the pial surface). Either 0.3 μl of AAV5 GfaABC1D mCherry-hPMCA2w/b (7 × 1012 viral genomes (vg) per ml) or 0.3 μl AAV5 GfaABC1D tdTomato (7 × 1012 vg ml−1) were injected at 100 nl min−1. Glass pipettes were withdrawn after 10 min and scalps were cleaned and sutured with sterile surgical sutures. Mice were allowed to recover in clean cages for 7 days. behavioural experiments (recall) were performed three weeks after surgeries. Schematic illustrations (Figs. 1a and 4a,f and Extended Data Fig. 7h,o) created with BioRender.com.

    Open field

    Mice were placed in the centre of 40 × 40 cm white box and allowed to freely explore for 15 min. Videos were recorded and analysed by BIOBSERVE III software. The 20 × 20 cm region in the centre was defined as the central zone. The total distance travelled and the activity exploring the centre area were analysed to evaluate the subject’s locomotor ability and anxiety levels.

    Oligos and antibodies

    For quantitative PCR analysis, specific primers were designed to amplify the Igfbp2 gene: Igfbp2 FW (GTCTACATCCCGCGCTG) and Igfbp2 RV (GTCTCTTTTCACAGGTACCCG). Additionally, for CRISPR–Cas9 gene editing, six gRNAs (Igfbp2 guides 1–6) were selected to target distinct regions of the Igfbp2 gene. These gRNAs were designed based on predicted specificity and efficiency: Igfbp2 guide 1 (CTACGCTGCTATCCCAACCC), Igfbp2 guide 2 (GCCAGACGCTCGGGCGTGCA), Igfbp2 guide 3 (AGAAGGTCAATGAACAGCAC), Igfbp2 guide 4 (GCCCTCCTGCCGTGCGCACA), Igfbp2 guide 5 (CTCTCGCACCAGCTCGGCGC), and Igfbp2 guide 6 (CGTAGCGTCTGGGCGCAGCG).

    Antibodies targeting mCherry (Thermo Fisher M11217) and cFOS (Synaptic Systems 226308) were applied for immunostaining following manufacturers’ manuals.

    Inclusion and ethics statement

    We, the authors of this manuscript, recognize the importance of inclusion and ethical considerations in scientific research. Our work is guided by the principles of fairness, transparency, and respect for human dignity.

    We affirm our commitment to promoting diversity and inclusivity in science, recognizing that diverse perspectives, backgrounds, and experiences enrich research and enhance scientific discovery. We have made efforts to ensure that our study is conducted in a manner that respects and includes individuals of all races, ethnicities, genders, sexual orientations, abilities, and other aspects of human diversity.

    We have obtained all necessary ethical approvals and have followed appropriate guidelines and regulations for the research conducted. We have taken measures to protect the privacy and confidentiality of research participants, including obtaining informed consent and ensuring data security.

    We acknowledge the potential for harm in scientific research and have taken steps to minimize any potential harm to research participants or others affected by our work. We have carefully considered the potential implications of our research and have taken responsibility for ensuring that our work is conducted in a manner that upholds ethical and moral standards.

    We recognize that scientific research has the potential to impact society in profound ways and we are committed to engaging in responsible research practices that promote the well-being of individuals and society as a whole.

    In summary, we affirm our commitment to inclusive and ethical research practices and recognize our responsibility to conduct research that is conducted with integrity, respect, and social responsibility.

    Reporting summary

    Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

    [ad_2]

    Source link

  • Evidence of superconducting Fermi arcs

    [ad_1]

    ARPES measurements

    ARPES measurements were carried out on the 12 and 13ARPES endstations26 at BESSY II synchrotron (Helmholtz-Zentrum Berlin), as well as in the Leibniz-Institut für Festkörper und Werkstoffforschung Dresden (IFW) laboratory using the 5.9 eV laser light source. Samples were cleaved in situ at a pressure lower than 1 × 10−10 mbar and measured at the temperatures of 15 K and 1.5 K at BESSY II and 3-30 K in the IFW laboratory. The experimental data were obtained using the synchrotron light in the photon energy range from 15 to 50 eV with horizontal polarization and laser light with horizontal and circular polarizations. Angular resolution was set to 0.2–0.5° and energy resolution to 2–20 meV. The findings from the experiments were consistent and reproducible across multiple samples.

    The simultaneous presence of bulk non-superconducting and surface superconducting states hinders the detection of true coherence peaks with ARPES. Our experiments at the synchrotron, with energy resolution of the order of 5 meV, turned out to be insufficient to detect even the shifts of the leading edges of the corresponding arc peaks having FWHM of the order of 10 meV and peak-to-background ratio of approximately 5. This is because the arc states are always on top of the bulk continuum. Only by measuring with energy resolution of the order of 1–2 meV did we manage to observe sufficiently sharp peaks (Fig. 3c,d and Extended Data Fig. 4) and their sensitivity to temperature. The sharpest features need to be found on the surface.

    A superconducting gap on the arcs is most likely anisotropic. We included error bars in Fig. 4e to show the influence of a small shift of the beam spot and thus slightly different emission angle. Taking into account the very high localization in momentum space, this could lead to probing a different part of the arc and thus different kF, where the superconducting gap is slightly different.

    Bulk band structure and Fermi arc position

    In Extended Data Fig. 1, we show ARPES Fermi surface maps obtained using the photon energies from 15 eV to 43 eV. Relatively strong variation of the pattern suggests a reasonable kz-sensitivity of our experiment. We found the optimal value of the inner potential to be equal to 10.5 eV. This agrees with the previous study of Jiang et al.17.

    In Extended Data Fig. 2, we present further evidence that our assignment of the surface and bulk features is correct. Extended Data Fig. 2a shows EDCs taken across the Fermi arc for different photon energies (from synchrotron and laser sources), alongside the theoretical EDC for the fully integrated kz. The peak corresponding to the Fermi arc remains clearly visible without any noticeable dispersion for different values of kz, whereas the peaks located further below the Fermi level disperse. Such absence of the dispersion is peculiar to the surface states.

    In Extended Data Fig. 3, we show an analogue of Fig. 1e–g, but here we compare experimental data with the results of band structure calculations carried out using the linear muffin-tin orbital (LMTO) method in the atomic sphere approximation as implemented in PY LMTO computer code27. As is seen from the figure, the agreement is at the same level as earlier, underpinning the previous conclusion as regards the good agreement between experimental and theoretical 3D band structure.

    In Extended Data Fig. 4b, we present the sharpest EDCs from among the various samples and cleaves. Most have FWHM below 3 meV and a peak-to-background ratio of over 30.

    Band structure calculations

    We performed density functional theory calculations using the full-potential nonorthogonal local-orbital scheme of ref. 28 within the general gradient approximation29 and extracted a Wannier function model. This allows determination of bulk projected spectral densities (without surface states) and the spectral densities of semi-infinite slabs via Green’s function techniques30. To model surface superconductivity of the semi-infinite slab, the Wannier model is extended into the BdG formalism with a zero-gap function except for a constant Wannier orbital diagonal singlet gap function matrix at the first three PtBi2 layers. A modification of the Green’s function method is used to accommodate this surface-specific term.

    Surface superconductivity calculations

    To model a system which has a non-zero gap function only at the surface—in the first 30aB which is 3(PtBi2) layers—we modified the standard Green’s function technique for semi-infinite slabs. The system is built by a semi-infinite chain of identical blocks consisting of 3(PtBi2) layers, repeating indefinitely away from the surface. Each block has a Hamiltonian Hk for each pseudo momentum k in the plane perpendicular to the surface and a hopping matrix Vk, which couples neighbouring blocks. The blocks’ minimum size is determined by the condition that H and V describe all possible hoppings. To add superconductivity, the BdG formalism is used by extending the matrices in the following way:

    $$\begin{array}{rcl}{H}_{k,{\rm{BdG}}} & = & \left(\begin{array}{cc}{H}_{k} & {\varDelta }_{k}\\ {\varDelta }_{k}^{+} & -{H}_{-k}^{* }\end{array}\right),\\ {V}_{k,{\rm{BdG}}} & = & \left(\begin{array}{cc}{V}_{k} & 0\\ 0 & -{V}_{-k}^{* }\end{array}\right),\end{array}$$

    where we choose \({\varDelta }_{k}={\delta }_{i{i}^{{\prime} }}\left(\begin{array}{cc}0 & {V}_{0}\\ -{V}_{0} & 0\end{array}\right)\) with i being a spinless Wannier function index and the 2 × 2 matrix to act in a single Wannier function’s spin subspace. This choice also leads to \(\varDelta \left[{V}_{k,{\rm{BdG}}}\right]=0\), since V is an off-diagonal part of the full Hamiltonian. To model surface-only superconductivity, we let V0 = 0 for all (infinite) blocks, except the first one, which gets a finite V0 = 2 meV.

    The standard Green’s function solution for this problem consists of determining the propagator X which encompasses all diagrams that describe paths that start at a certain block, propagate anywhere towards the infinite side of that block and return to that block. X also describes the Green’s function G00 of the first block and the self-energy to be added to the Hamiltonian to obtain G00 (a self-consistency condition) \({G}_{00}=X={\left({\omega }^{+}-H-\Sigma \right)}^{-1}\), Σ = VXV+ (in practice, however, self-consistency is obtained by an accelerated algorithm). From this recursion, relations can calculate all other Green’s-function blocks. These can be derived by subdividing propagation diagrams into irreducible parts using known components, in particular X.

    If the first block differs from all the others (as is the case due to Δk) one needs to modify the method in the following way. Let the first block have Hamiltonian h and hoppings to the second block v (while all other blocks are described by H and V). Then the irreducible subdivision of the propagation diagrams for G00 results in \(g={\left({\omega }^{+}-h\right)}^{-1}\).

    $$\begin{array}{l}{G}_{00}=g+gvX{v}^{+}g+(\,gvX{v}^{+})g\\ \,=\,\frac{1}{{\omega }^{+}-h-vX{v}^{+}}\end{array}$$

    which contains the surface Hamiltonian and a modified self-energy depending on the X of the unmodified semi-infinite slab. From this we can derive the second block’s Green’s function

    $${G}_{11}=X+X{v}^{+}{G}_{00}vX$$

    and all others

    $${G}_{n+1,n+1}=X+X{V}^{+}{G}_{nn}VX,\quad n > 0$$

    which can be used to obtain the spectral density up to a certain penetration depth. Note that in our BdG case \(H={H}_{k,{\rm{BdG}}}\left[{V}_{0}=0\right]\), \(V={V}_{k,{\rm{BdG}}}\left[{V}_{0}=0\right]\) and \(h={H}_{k,{\rm{BdG}}}\left[{V}_{0}\ne 0\right]\), v = V. The BdG spectral density is particle–hole symmetric and to obtain results that resemble ARPES data, one needs to use the particle–particle block Gee (the upper left quarter of the G matrix) only.

    Extended Data Fig. 5b shows the resulting spectra of this method along the path denoted in Extended Data Fig. 5a. Note that a gap is opened at the surface band pockets close to the Fermi energy, while the rest of the spectrum stays gapless (if we let V0 ≠ 0 for all blocks, we get a completely gapped spectrum). Extended Data Fig. 5c shows a zoomed-in region around the surface state. Note that the bulk bands are gapless (dark blue vertical features) while the surface state shows a gap and corresponding band back-bending. The particle–hole symmetry becomes apparent, although with a larger spectral weight for the occupied part because we use Gee only.

    Further discussion

    One approach to demonstrate the existence of topologically protected states with a topological insulator is to perform spin-resolved ARPES. In this technique, the spin-locking effect determines the spin structure in the vicinity of the surface Dirac node. However, the situation is quite different for Weyl semimetals. Here, there is no specific spin structure or configuration associated with the Weyl nodes, which can occur at generic points in the Brillouin zone. As inversion is broken and spin-orbital coupling present, each band at a generic k-point naturally possesses a spin direction, but this spin texture is smooth. Consequently, spin-resolved ARPES measurements cannot directly reveal Weyl points.

    We would like to exclude the interpretation of our data based on density-wave order, which could, in principle, result in the similar features in the spectra. Charge density-waves require a redistribution of the spectral weight in the momentum space, characterized by the particular k-vector (vectors). We have always observed almost the same Fermi surface maps and underlying dispersions, independent of temperature. In line with these observations are the results of the STM studies which never detected any kind of a reconstruction. We have never observed any replica of the arcs or of the deeper lying surface states, such as a strong feature at (−0.2, −0.2) in Fig. 3f,g. It is also not clear which k-vector would be suitable for characterizing the density-wave order. If the arcs are simply superimposed in momentum, they all are of electron-like topology, so the opening of the hybridization gaps seems very unlikely. Finally, the fundamental difference between the density-wave gaps and superconducting gaps is that the latter are always pinned to the Fermi level. This is the only energy interval where we observe the changes in the spectra of PtBi2 with temperature.

    [ad_2]

    Source link

  • Signatures of a surface spin–orbital chiral metal

    [ad_1]

    The samples of Sr2RuO4 were grown using the floating-zone technique, following a previously published procedure43. Single crystals were postcleaved in an ultrahigh vacuum at a base pressure of 1 × 10−10 mbar and a temperature of 20 K (and 77 K). The temperature was kept constant throughout the measurements. The experiment was performed at the NFFA–APE Low Energy beamline laboratory at the Elettra synchrotron radiation facility and designed with an APPLE-II aperiodic source for polarized extreme UV radiation and a vectorial twin-VLEED spin-polarization detector downstream of a DA30 Scienta ARPES analyser44. The photon energy used for our measurements was 40 eV, which was found to maximize the spectral intensity, as shown previously45. The energy and momentum resolutions were better than 12 meV and 0.018 Å−1, respectively. Importantly, as already mentioned, to eliminate the geometrical contribution to the circular polarization, the crystals were aligned as in Fig. 1c,d. For completeness, seminal works on ARPES and dichroism that might aid the understanding of our measurements can be found in refs. 39,41,46,47,48.

    In the following sections, we report additional measurements that help to corroborate the message and conclusions given in the main text.

    Sample alignment and experimental geometry

    When using circularly polarized light, the disentanglement between geometrical and intrinsic matrix elements is crucial but problematic. A solution is to have the incoming radiation exactly within one of the mirror planes of the system studied and to measure in the direction orthogonal to that plane, as we show in Fig. 1c. In such a configuration, the differences in the CP-spin-ARPES signal can be attributed to intrinsic differences in LS, and the geometrical contributions are well defined. In this regard, it is of paramount importance to align the sample carefully. In the present case, the symmetric character of the material’s Fermi surface45,49,50 allows us to carefully align the sample with the incoming beam of photons lying in a mirror plane. The alignment of the sample was carried out by monitoring the experimental Fermi surface and by making sure that the analyser slit direction was perpendicular to the mirror plane. As shown in Extended Data Figs. 1 and 2, we estimated our alignment to be better than 0.9° from the ideal configuration, a value within the uncertainty considering our angular azimuthal precision (about 1°). Furthermore, different samples gave us the same results, corroborating the robustness of the measurement outputs within this azimuth uncertainty.

    In the NFFA–APE Low Energy beamline laboratory, our sample was placed in the manipulator in normal emission conditions, with the synchrotron light impinging on the sample surface at an angle of 45°. This means that standard linear polarizations, such as linear vertical and linear horizontal (Extended Data Fig. 1), would act differently on the matrix elements’ selection rules. In particular, linear vertical light would be fully within the sample plane, whereas linear horizontal light would have one component within the plane and one out of plane (with 50% intensity each). Now, when using circularly polarized light, to distinguish between real and geometrical matrix element effects, the incoming light needed to be aligned within the experimental error, within one of the mirror planes of the sample.

    To estimate the azimuthal value we fitted the k-loci of the Fermi surface contours (red markers in Extended Data Fig. 2a,b) and we then aligned the horizontal and vertical axes (see ‘Details of the fitting’). In our configuration, there is negligible misalignment between the states at positive and negative values of k (Extended Data Fig. 2c,d). In Extended Data Fig. 2, we show that by extracting momentum distribution curves (coloured horizontal lines in Extended Data Fig. 2c), the peak positions are symmetric within the resolution of the instrument (12 meV for energy and 0.018 Å−1). We can therefore confidently perform the measurements shown in the main text.

    Details of the fitting

    The k-loci of the Fermi surfaces shown in Extended Data Fig. 2a,b and the positions of the peaks in Extended Data Fig. 1d have been extracted by fitting the ARPES data. The fitting procedure used is standard and consists of fitting both energy distribution curves (EDCs) and momentum distribution curves by using Lorentzian curves convoluted by a Gaussian contribution that accounts for the experimental resolutions. Then, as part of the fit results, we extracted the k positions of the peaks, which are shown as red markers in Extended Data Fig. 2 and the values in Extended Data Fig. 2d.

    Spin-ARPES data

    To obtain the values reported, the spin data shown have also been normalized to include the action of the Sherman function of the instrument. In particular, the data for spin-up and spin-down channels have been normalized to their background, so they matched in both cases. In the present study, the background normalization was done on the high-energy tails of the EDCs far from the region where the spin polarization was observed. After normalization, to extract the spin intensity, we used the following relations:

    $${I}^{{\rm{TRUE}}}({\bf{k}},\uparrow )=\frac{{I}^{{\rm{TOT}}}({\bf{k}})}{2}\times (1+P),$$

    $${I}^{{\rm{TRUE}}}({\bf{k}},\downarrow )=\frac{{I}^{{\rm{TOT}}}({\bf{k}})}{2}\times (1-P),$$

    where P is the polarization of the system, ITRUE is the intensity value (for either spin-up or -down species) obtained after inclusion of the Sherman (see below) function of the spin detector, and  and ITOT = Ibg.norm(k, ↑) + Ibg.norm(k, ↓) is simply the sum of the intensity for EDCs with spin-up and spin-down after normalization to the background. For the polarization P, the Sherman function from the instrument was included and defined as η = 0.3 (ref. 44). The Sherman function was calibrated from measurements on a single gold crystal. Therefore, P is described by:

    $$P({\bf{k}})=\frac{1}{\eta }\times \frac{{I}^{{\rm{bg.norm}}}({\bf{k}},\uparrow )-{I}^{{\rm{bg.norm}}}({\bf{k}},\downarrow )}{{I}^{{\rm{bg.norm}}}({\bf{k}},\uparrow )+{I}^{{\rm{bg.norm}}}({\bf{k}},\downarrow )}.$$

    This procedure was done for all light polarizations. We also characterized the spin channels by using different polarization-vector directions, as shown in Extended Data Fig. 3.

    Dichroism and spin-dichroism amplitudes

    A way to visualize the breaking of the time-reversal symmetry is to analyse the dichroic signal shown in Fig. 2c but resolved in the two different spin channels, up and down, which gives rise to different amplitude values when measured at ±k (expected for time-reversal symmetry breaking but not expected otherwise). We show this here at selected momentum values. The amplitude values have been extracted from the data shown in Fig. 3a and Extended Data Fig. 3, after including the Sherman function normalization.

    To corroborate the claim in the main text, that is, the observation of a signal compatible with the existence of chiral currents, Extended Data Fig. 4 shows the relative amplitudes of the dichroic versus spin-dichroic signal. First, let us consider the spin-integrated dichroism shown in Extended Data Fig. 4a. Here, the orange and green curves represent positive and negative k values, respectively, and their behaviour is overall symmetric with respect to zero. However, a small asymmetry can still be noticed, estimated to be as large as 10%, which is close to a previously reported value39 of 8%. As we will clarify from a theoretical point of view, a small degree of asymmetry in the spin-integrated dichroism can still be expected, although the amplitudes of the dichroism selected in their spin channels are supposed to be larger. To demonstrate this difference, we have shown how the dichroism curves, resolved in their spin channels, up (red) and down (blue), appear at negative k (Extended Data Fig. 4d–f) and at positive k (Extended Data Fig. 4g–i). By also considering their residuals, we can compare them to the amplitude of the spin-integrated signal. We reported this comparison in Extended Data Fig. 5. The spin-down channel shows an amplitude as high as 30% and the spin-up one is as high as 20%. These values are three times and two times bigger, respectively, than the residual extracted for the spin-integrated signal. Such a large difference corroborates the validity of our methodology and the claims of our work. Note that summing the positive and negative momentum is also counteracting any possible effects caused by small sample misalignment.

    Data and temperature

    For completeness, we also performed C+(+k, ↑) and C(−k, ↓) on the sample after cleaving it, also at high temperature (70 K), which is above the magnetic transition of Sr2RuO4. We report the results in Extended Data Fig. 6. In particular, in Extended Data Fig. 6a–c, the top panels with blue lines show the difference between C+(+k, ↑) and C(−k, ↓), normalized by their sum, at three values of k and at low temperature, but the bottom line is the same for the data collected at 70 K. If in the low-temperature configuration we observe a varying finite signal, at high temperature we did not see such a variation. It is important to mention that even with our resolution, we do not see any finite signal, although there might be some differences that could be observed above the magnetic transition, because it is likely that not all magnetic excitations are turned off immediately, although a reduction should be still observed. Furthermore, the high-temperature data are more noisy. Even if we cleaved the samples at high temperature, and the ARPES shown in Extended Data Fig. 6d,e confirms their presence, they are much weaker than at low temperature and are broadened thermally. Such a thermal broadening is not surprising to see in ARPES. Nevertheless, even with reduced intensity, the surface states are still clearly visible.

    Calibrating the VLEED

    Within the uncertainty of the instrument (1° integration region), the VLEED has been calibrated by acquiring spin EDCs at various angles, both positive and negative, for the sample. This is done for both spin species and with the used light polarizations. In the present case, for consistency, we did this with circularly polarized light (both left- and right-handed). Afterwards, by summing both circular polarizations and both spin species, we can reconstruct the ARPES spectra (Extended Data Fig. 7). This procedure was done by using only the spin detector to directly access the probed states and be sure that, when selecting the angular values on the deflectors, we effectively probe the selected state.

    Uncertainties and additional calibration

    To evaluate the uncertainty we used a controlled and known sample with no asymmetries in the dichroic signal, as in our previous work39. We used a kagome lattice because at the Γ point there is a well defined energy gap, opened by the action of spin–orbit coupling. Furthermore, at this point the bands are spin-degenerate; the system is also not magnetic. This allowed us to check the asymmetry, not only in the circular dichroism signal, but also in the spin-resolved circular dichroism. We estimated the uncertainty to be approximately 10% on the residual of the dichroism. Note that this is also consistent with that obtained by standard ARPES in our set-up: at the centre of the Brillouin zone, the difference between circular right- and circular left-polarized spectra (each spectrum was normalized by its own maximum intensity beforehand) is indeed 10%.

    [ad_2]

    Source link

  • Allosteric modulation and G-protein selectivity of the Ca2+-sensing receptor

    [ad_1]

  • Kniazeff, J., Prézeau, L., Rondard, P., Pin, J.-P. & Goudet, C. Dimers and beyond: the functional puzzles of class C GPCRs. Pharmacol. Ther. 130, 9–25 (2011).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Hofer, A. M. & Brown, E. M. Extracellular calcium sensing and signalling. Nat. Rev. Mol. Cell Biol. 4, 530–538 (2003).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Hannan, F. M., Kallay, E., Chang, W., Brandi, M. L. & Thakker, R. V. The calcium-sensing receptor in physiology and in calcitropic and noncalcitropic diseases. Nat. Rev. Endocrinol. 15, 33–51 (2019).

    Article 
    CAS 

    Google Scholar
     

  • Vahe, C. et al. Diseases associated with calcium-sensing receptor. Orphanet J. Rare Dis. 12, 19 (2017).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Massy, Z. A., Henaut, L., Larsson, T. E. & Vervloet, M. G. Calcium-sensing receptor activation in chronic kidney disease: effects beyond parathyroid hormone control. Semin. Nephrol. 34, 648–659 (2014).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Eckardt, K.-U. et al. Evolving importance of kidney disease: from subspecialty to global health burden. Lancet 382, 158–169 (2013).

    Article 
    PubMed 

    Google Scholar
     

  • Niswender, C. M. & Conn, P. J. Metabotropic glutamate receptors: physiology, pharmacology, and disease. Annu. Rev. Pharmacol. Toxicol. 50, 295–322 (2010).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Gregory, K. J. & Goudet, C. International union of basic and clinical pharmacology. CXI. Pharmacology, signaling, and physiology of metabotropic glutamate receptors. Pharmacol. Rev. 73, 521–569 (2021).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Leach, K. et al. International Union of Basic and Clinical Pharmacology. CVIII. Calcium-sensing receptor nomenclature, pharmacology, and function. Pharmacol. Rev. 72, 558–604 (2020).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Seven, A. B. et al. G-protein activation by a metabotropic glutamate receptor. Nature 595, 450–454 (2021).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Lin, S. et al. Structures of Gi-bound metabotropic glutamate receptors mGlu2 and mGlu4. Nature 594, 583–588 (2021).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Shen, C. et al. Structural basis of GABAB receptor–Gi protein coupling. Nature 594, 594–598 (2021).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Magno, A. L., Ward, B. K. & Ratajczak, T. The calcium-sensing receptor: a molecular perspective. Endocr. Rev. 32, 3–30 (2011).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Centeno, P. P. et al. Phosphate acts directly on the calcium-sensing receptor to stimulate parathyroid hormone secretion. Nat. Commun. 10, 4693 (2019).

    Article 
    ADS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Leach, K. et al. Towards a structural understanding of allosteric drugs at the human calcium-sensing receptor. Cell Res. 26, 574–592 (2016).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Ling, S. et al. Structural mechanism of cooperative activation of the human calcium-sensing receptor by Ca2+ ions and l-tryptophan. Cell Res. 31, 383–394 (2021).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Gao, Y. et al. Asymmetric activation of the calcium-sensing receptor homodimer. Nature 595, 455–459 (2021).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Park, J. et al. Symmetric activation and modulation of the human calcium-sensing receptor. Proc. Natl Acad. Sci. USA 118, e2115849118 (2021).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Olsen, R. H. et al. TRUPATH, an open-source biosensor platform for interrogating the GPCR transducerome. Nat. Chem. Biol. 16, 841–849 (2020).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Masuho, I. et al. Distinct profiles of functional discrimination among G proteins determine the actions of G protein–coupled receptors. Sci. Signal. 8, ra123 (2015).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Wall, M. A. et al. The structure of the G-protein heterotrimer Giα1β1γ2. Cell 83, 1047–1058 (1995).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Duan, J. et al. Cryo-EM structure of an activated VIP1 receptor-G protein complex revealed by a NanoBiT tethering strategy. Nat. Commun. 11, 4121 (2020).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Timmers, H., Karperien, M., Hamdy, N., De Boer, H. & Hermus, A. Normalization of serum calcium by cinacalcet in a patient with hypercalcaemia due to a de novo inactivating mutation of the calcium-sensing receptor. J. Intern. Med. 260, 177–182 (2006).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Hannan, F. M. et al. Identification of 70 calcium-sensing receptor mutations in hyper-and hypo-calcaemic patients: evidence for clustering of extracellular domain mutations at calcium-binding sites. Hum. Mol. Genet. 21, 2768–2778 (2012).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Nagase, T. et al. A family of autosomal dominant hypocalcemia with a positive correlation between serum calcium and magnesium: identification of a novel gain of function mutation (Ser820Phe) in the calcium-sensing receptor. J. Clin. Endocrinol. Metab. 87, 2681–2687 (2002).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Shiohara, M. et al. A novel gain-of-function mutation (F821L) in the transmembrane domain of calcium-sensing receptor is a cause of severe sporadic hypoparathyroidism. Eur. J. Pediatr. 163, 94–98 (2004).

    Article 
    PubMed 

    Google Scholar
     

  • Hu, J. et al. A region in the seven-transmembrane domain of the human Ca2+ receptor critical for response to Ca2+. J. Biol. Chem. 280, 5113–5120 (2005).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Quinn, S. J. et al. The Ca2+-sensing receptor: a target for polyamines. Am. J. Physiol. 273, C1315–C1323 (1997).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Michael, A. J. Polyamines in eukaryotes, bacteria, and archaea. J. Biol. Chem. 291, 14896–14903 (2016).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Schamber, M. R. & Vafabakhsh, R. Mechanism of sensitivity modulation in the calcium-sensing receptor via electrostatic tuning. Nat. Commun. 13, 2194 (2022).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Cole, D. E. et al. Calcium-sensing receptor mutations and denaturing high performance liquid chromatography. J. Mol. Endocrinol. 42, 331–339 (2009).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Tan, Y. et al. Autosomal dominant hypocalcemia: a novel activating mutation (E604K) in the cysteine-rich domain of the calcium-sensing receptor. J. Clin. Endocrinol. Metab. 88, 605–610 (2003).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Kwan, B. et al. A novel CASR mutation (p. Glu757Lys) causing autosomal dominant hypocalcaemia type 1. Endocrinol. Diabetes Metab. Case Rep. 2018, 18-0107 (2018).

    PubMed 
    PubMed Central 

    Google Scholar
     

  • Conigrave, A. D., Quinn, S. J. & Brown, E. M. l-amino acid sensing by the extracellular Ca2+-sensing receptor. Proc. Natl Acad. Sci. USA 97, 4814–4819 (2000).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Mangmool, S. & Kurose, H. Gi/o protein-dependent and-independent actions of pertussis toxin (PTX). Toxins 3, 884–899 (2011).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Vargas-Poussou, R. et al. Familial hypocalciuric hypercalcemia types 1 and 3 and primary hyperparathyroidism: similarities and differences. J. Clin. Endocrinol. Metab. 101, 2185–2195 (2016).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Koltin, D. et al. Mild infantile hypercalcemia: diagnostic tests and outcomes. J. Pediatr. 159, 215–221 (2011).

    Article 
    PubMed 

    Google Scholar
     

  • Ray, K., Fan, G.-F., Goldsmith, P. K. & Spiegel, A. M. The carboxyl terminus of the human calcium receptor: requirements for cell-surface expression and signal transduction. J. Biol. Chem. 272, 31355–31361 (1997).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Nesbit, M. A. et al. Mutations affecting G-protein subunit α11 in hypercalcemia and hypocalcemia. N. Engl. J. Med. 368, 2476–2486 (2013).

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Bai, M. et al. Protein kinase C phosphorylation of threonine at position 888 in Ca2+o-sensing receptor (CaR) inhibits coupling to Ca2+ store release. J. Biol. Chem. 273, 21267–21275 (1998).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Davies, S. L., Ozawa, A., McCormick, W. D., Dvorak, M. M. & Ward, D. T. Protein kinase C-mediated phosphorylation of the calcium-sensing receptor is stimulated by receptor activation and attenuated by calyculin-sensitive phosphatase activity. J. Biol. Chem. 282, 15048–15056 (2007).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Jiang, Y. F. et al. Protein kinase C (PKC) phosphorylation of the Ca2+o-sensing receptor (CaR) modulates functional interaction of G proteins with the CaR cytoplasmic tail. J. Biol. Chem. 277, 50543–50549 (2002).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Lazarus, S. et al. A novel mutation of the primary protein kinase C phosphorylation site in the calcium-sensing receptor causes autosomal dominant hypocalcemia. Eur. J. Endocrinol. 164, 429–435 (2011).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Brown, E. M. et al. Cloning and characterization of an extracellular Ca2+-sensing receptor from bovine parathyroid. Nature 366, 575–580 (1993).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Robertson, M. J., Meyerowitz, J. G., Panova, O., Borrelli, K. & Skiniotis, G. Plasticity in ligand recognition at somatostatin receptors. Nat. Struct. Mol. Biol. 29, 210–217 (2022).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Maeda, S. et al. Development of an antibody fragment that stabilizes GPCR/G-protein complexes. Nat. Commun. 9, 3712 (2018).

    Article 
    ADS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Bayburt, T. H., Grinkova, Y. V. & Sligar, S. G. Self-assembly of discoidal phospholipid bilayer nanoparticles with membrane scaffold proteins. Nano Lett. 2, 853–856 (2002).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Peisley, A. & Skiniotis, G. 2D projection analysis of GPCR complexes by negative stain electron microscopy. Methods Mol. Biol. 1335, 29–38 (2015).

  • Mastronarde, D. N. Automated electron microscope tomography using robust prediction of specimen movements. J. Struct. Biol. 152, 36–51 (2005).

    Article 
    PubMed 

    Google Scholar
     

  • Punjani, A., Rubinstein, J. L., Fleet, D. J. & Brubaker, M. A. cryoSPARC: algorithms for rapid unsupervised cryo-EM structure determination. Nat. Methods 14, 290–296 (2017).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Zivanov, J. et al. New tools for automated high-resolution cryo-EM structure determination in RELION-3. eLife 7, e42166 (2018).

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Pettersen, E. F. et al. UCSF Chimera—a visualization system for exploratory research and analysis. J. Comput. Chem. 25, 1605–1612 (2004).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Zhang, X. et al. Structures of the human cholecystokinin receptors bound to agonists and antagonists. Nat. Chem. Biol. 17, 1230–1237 (2021).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Emsley, P., Lohkamp, B., Scott, W. G. & Cowtan, K. Features and development of Coot. Acta Crystallogr. D 66, 486–501 (2010).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Liebschner, D. et al. Macromolecular structure determination using X-rays, neutrons and electrons: recent developments in Phenix. Acta Crystallogr. D 75, 861–877 (2019).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Chen, V. B. et al. MolProbity: all-atom structure validation for macromolecular crystallography. Acta Crystallogr. D 66, 12–21 (2010).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Pettersen, E. F. et al. UCSF ChimeraX: structure visualization for researchers, educators, and developers. Protein Sci. 30, 70–82 (2021).

    Article 
    CAS 
    PubMed 

    Google Scholar
     

  • Falk‐Petersen, C. B. et al. Development of a robust mammalian cell‐based assay for studying recombinant α4β1/3δ GABAA receptor subtypes. Basic Clin. Pharmacol. Toxicol. 121, 119–129 (2017).

    Article 
    PubMed 

    Google Scholar
     

  • [ad_2]

    Source link

  • Light-driven nanoscale vectorial currents | Nature

    [ad_1]

  • Ma, Q., Kumar, R. K., Xu, S.-Y., Koppens, F. H. L. & Song, J. C. W. Photocurrent as a multiphysics diagnostic of quantum materials. Nat. Rev. Phys. 5, 170–184 (2023).

    Article 

    Google Scholar
     

  • Orenstein, J. et al. Topology and symmetry of quantum materials via nonlinear optical responses. Annu. Rev. Condens. Matter Phys. 12, 247–272 (2021).

    Article 
    ADS 

    Google Scholar
     

  • Pettine, J. et al. Ultrafast terahertz emission from emerging symmetry-broken materials. Light Sci. Appl. 12, 133 (2023).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Takasan, K., Morimoto, T., Orenstein, J. & Moore, J. E. Current-induced second harmonic generation in inversion-symmetric Dirac and Weyl semimetals. Phys. Rev. B 104, L161202 (2021).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Sirica, N. et al. Photocurrent-driven transient symmetry breaking in the Weyl semimetal TaAs. Nat. Mater. 21, 62–66 (2022).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Dupont, E., Corkum, P. B., Liu, H. C., Buchanan, M. & Wasilewski, Z. R. Phase-controlled currents in semiconductors. Phys. Rev. Lett. 74, 3596–3599 (1995).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Schiffrin, A. et al. Optical-field-induced current in dielectrics. Nature 493, 70–74 (2013).

    Article 
    ADS 
    PubMed 

    Google Scholar
     

  • Sederberg, S. et al. Vectorized optoelectronic control and metrology in a semiconductor. Nat. Photon. 14, 680–685 (2020).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Boolakee, T. et al. Light-field control of real and virtual charge carriers. Nature 605, 251–255 (2022).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Higuchi, T., Heide, C., Ullmann, K., Weber, H. B. & Hommelhoff, P. Light-field-driven currents in graphene. Nature 550, 224–228 (2017).

    Article 
    ADS 
    PubMed 

    Google Scholar
     

  • McIver, J. W., Hsieh, D., Steinberg, H., Jarillo-Herrero, P. & Gedik, N. Control over topological insulator photocurrents with light polarization. Nat. Nanotechnol. 7, 96–100 (2012).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Wang, Y. X. et al. Visualization of bulk and edge photocurrent flow in anisotropic Weyl semimetals. Nat. Phys. 19, 507–514 (2023).

    Article 
    CAS 

    Google Scholar
     

  • Kampfrath, T. et al. Terahertz spin current pulses controlled by magnetic heterostructures. Nat. Nanotechnol. 8, 256–260 (2013).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Qiu, H. S. et al. Ultrafast spin current generated from an antiferromagnet. Nat. Phys. 17, 388–394 (2021).

    Article 
    CAS 

    Google Scholar
     

  • Koppens, F. H. L. et al. Photodetectors based on graphene, other two-dimensional materials and hybrid systems. Nat. Nanotechnol. 9, 780–793 (2014).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Schubert, O. et al. Sub-cycle control of terahertz high-harmonic generation by dynamical Bloch oscillations. Nat. Photon. 8, 119–123 (2014).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Petrov, N. V., Sokolenko, B., Kulya, M. S., Gorodetsky, A. & Chernykh, A. V. Design of broadband terahertz vector and vortex beams: I. Review of materials and components. Light Adv. Manuf. 3, 640–652 (2022).


    Google Scholar
     

  • Mubeen, S. et al. An autonomous photosynthetic device in which all charge carriers derive from surface plasmons. Nat. Nanotechnol. 8, 247–251 (2013).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Müller, M., Paarmann, A. & Ernstorfer, R. Femtosecond electrons probing currents and atomic structure in nanomaterials. Nat. Commun. 5, 5292 (2014).

    Article 
    ADS 
    PubMed 

    Google Scholar
     

  • Ma, E. Y. et al. Recording interfacial currents on the subnanometer length and femtosecond time scale by terahertz emission. Sci. Adv. 5, eaau0073 (2019).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Linic, S., Chavez, S. & Elias, R. Flow and extraction of energy and charge carriers in hybrid plasmonic nanostructures. Nat. Mater. 20, 916–924 (2021).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Pettine, J. & Nesbitt, D. J. Emerging methods for controlling hot carrier excitation and emission distributions in nanoplasmonic systems. J. Phys. Chem. C 126, 14767–14780 (2022).

    Article 
    CAS 

    Google Scholar
     

  • Dombi, P. et al. Ultrafast strong-field photoemission from plasmonic nanoparticles. Nano Lett. 13, 674–678 (2013).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Lehr, M. et al. Momentum distribution of electrons emitted from resonantly excited individual gold nanorods. Nano Lett. 17, 6606–6612 (2017).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Pettine, J., Choo, P., Medeghini, F., Odom, T. W. & Nesbitt, D. J. Plasmonic nanostar photocathodes for optically-controlled directional currents. Nat. Commun. 11, 1367 (2020).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Wei, J. X. et al. Zero-bias mid-infrared graphene photodetectors with bulk photoresponse and calibration-free polarization detection. Nat. Commun. 11, 6404 (2020).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Wei, J., Xu, C., Dong, B., Qiu, C.-W. & Lee, C. Mid-infrared semimetal polarization detectors with configurable polarity transition. Nat. Photon. 15, 614–621 (2021).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Li, L. F. et al. Room-temperature valleytronic transistor. Nat. Nanotechnol. 15, 743–749 (2020).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Liao, P. F. & Wokaun, A. Lightning rod effect in surface enhanced Raman scattering. J. Chem. Phys. 76, 751–752 (1982).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Buckley, D., Yang, Y., Yang-Keathley, Y., Berggren, K. K. & Keathley, P. D. Nanoantenna design for enhanced carrier–envelope-phase sensitivity. J. Opt. Soc. Am. B 38, C11–C21 (2021).

    Article 

    Google Scholar
     

  • Lui, C. H., Mak, K. F., Shan, J. & Heinz, T. F. Ultrafast photoluminescence from graphene. Phys. Rev. Lett. 105, 127404 (2010).

    Article 
    ADS 
    PubMed 

    Google Scholar
     

  • Low, T., Perebeinos, V., Kim, R., Freitag, M. & Avouris, P. Cooling of photoexcited carriers in graphene by internal and substrate phonons. Phys. Rev. B 86, 045413 (2012).

    Article 
    ADS 

    Google Scholar
     

  • Johannsen, J. C. et al. Direct view of hot carrier dynamics in graphene. Phys. Rev. Lett. 111, 027403 (2013).

    Article 
    ADS 
    PubMed 

    Google Scholar
     

  • Luo, L. et al. Broadband terahertz generation from metamaterials. Nat. Commun. 5, 3055 (2014).

    Article 
    ADS 
    PubMed 

    Google Scholar
     

  • Mueller, T., Xia, F., Freitag, M., Tsang, J. & Avouris, P. Role of contacts in graphene transistors: a scanning photocurrent study. Phys. Rev. B 79, 245430 (2009).

    Article 
    ADS 

    Google Scholar
     

  • Liu, C. H. et al. Ultrafast lateral photo-Dember effect in graphene induced by nonequilibrium hot carrier dynamics. Nano Lett. 15, 4234–4239 (2015).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Yoshioka, K. et al. Ultrafast intrinsic optical-to-electrical conversion dynamics in a graphene photodetector. Nat. Photon. 16, 718–723 (2022).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Tielrooij, K. J. et al. Hot-carrier photocurrent effects at graphene–metal interfaces. J. Phys. Condens. Matter 27, 164207 (2015).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Mueller, T., Xia, F. N. A. & Avouris, P. Graphene photodetectors for high-speed optical communications. Nat. Photon. 4, 297–301 (2010).

    Article 
    CAS 

    Google Scholar
     

  • Giovannetti, G. et al. Doping graphene with metal contacts. Phys. Rev. Lett. 101, 026803 (2008).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Gabor, N. M. et al. Hot carrier-assisted intrinsic photoresponse in graphene. Science 334, 648–652 (2011).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Shautsova, V. et al. Plasmon induced thermoelectric effect in graphene. Nat. Commun. 9, 5190 (2018).

    Article 
    ADS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Xu, X. D., Gabor, N. M., Alden, J. S., van der Zande, A. M. & McEuen, P. L. Photo-thermoelectric effect at a graphene interface junction. Nano Lett. 10, 562–566 (2010).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Echtermeyer, T. J. et al. Photothermoelectric and photoelectric contributions to light detection in metal–graphene–metal photodetectors. Nano Lett. 14, 3733–3742 (2014).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Levitov, L. & Falkovich, G. Electron viscosity, current vortices and negative nonlocal resistance in graphene. Nat. Phys. 12, 672–676 (2016).

    Article 
    CAS 

    Google Scholar
     

  • Bandurin, D. A. et al. Negative local resistance caused by viscous electron backflow in graphene. Science 351, 1055–1058 (2016).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Lucas, A. & Fong, K. C. Hydrodynamics of electrons in graphene. J. Phys. Condens. Matter 30, 053001 (2018).

    Article 
    ADS 
    PubMed 

    Google Scholar
     

  • Block, A. et al. Observation of giant and tunable thermal diffusivity of a Dirac fluid at room temperature. Nat. Nanotechnol. 16, 1195–1200 (2021).

    Article 
    ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Taghinejad, M. et al. Determining hot-carrier transport dynamics from terahertz emission. Science 382, 299–305 (2023).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Jana, K. et al. Reconfigurable electronic circuits for magnetic fields controlled by structured light. Nat. Photon. 15, 622–627 (2021).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Mitoma, N., Nouchi, R. & Tanigaki, K. Photo-oxidation of graphene in the presence of water. J. Phys. Chem. C 117, 1453–1456 (2013).

    Article 
    CAS 

    Google Scholar
     

  • Nahata, A., Weling, A. S. & Heinz, T. F. A wideband coherent terahertz spectroscopy system using optical rectification and electro-optic sampling. Appl. Phys. Lett. 69, 2321–2323 (1996).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Kohlhaas, R. B. et al. Ultrabroadband terahertz time-domain spectroscopy using III–V photoconductive membranes on silicon. Opt. Express 30, 23896–23908 (2022).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Song, J. C. W. & Levitov, L. S. Shockley-Ramo theorem and long-range photocurrent response in gapless materials. Phys. Rev. B 90, 075415 (2014).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Johnson, P. B. & Christy, R. W. Optical constants of noble metals. Phys. Rev. B 6, 4370–4379 (1972).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Malitson, I. H. Interspecimen comparison of the refractive index of fused silica. J. Opt. Soc. Am. 55, 1205–1209 (1965).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Chang, Y.-C., Liu, C.-H., Liu, C.-H., Zhong, Z. H. & Norris, T. B. Extracting the complex optical conductivity of mono- and bilayer graphene by ellipsometry. Appl. Phys. Lett. 104, 261909 (2014).

    Article 
    ADS 

    Google Scholar
     

  • Crossno, J. et al. Observation of the Dirac fluid and the breakdown of the Wiedemann–Franz law in graphene. Science 351, 1058–1061 (2016).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • Yan, H. G. et al. Time-resolved Raman spectroscopy of optical phonons in graphite: phonon anharmonic coupling and anomalous stiffening. Phys. Rev. B 80, 121403(R) (2009).

    Article 
    ADS 

    Google Scholar
     

  • Seol, J. H. et al. Two-dimensional phonon transport in supported graphene. Science 328, 213–216 (2010).

    Article 
    ADS 
    CAS 
    PubMed 

    Google Scholar
     

  • [ad_2]

    Source link