Carbon Chemist

Tag: Piwi RNAs

  • Two-factor authentication underpins the precision of the piRNA pathway

    [ad_1]

    Mouse strains and experimentation

    The Spocd1HA and Miwi2tdTomato (Miwi2tdTom) mouse alleles have been described previously4,31. Miwi2tdTom is a Miwi2 null allele and is used as such31. Both lines were kept on a mixed B6CBAF1/Crl;C57BL/6 N;Hsd:ICR (CD1) genetic background. The Spocd1ΔSPIN1 allele was generated by CRISPR–Cas9 gene editing as previously described32,33. A single guide RNA (sgRNA) (GGGTCAGGAATCAGGCTTGT) together with Cas9 mRNA and a single-stranded DNA oligonucleotide containing the eight-alanine mutation flanked by 85 base pairs (bp) of homology arm (AGATGGTAAACAGTTGAAGCCAAGGCAGGGAGGATTTCAGGCAGAGCCTTGCCATACTCTCTCTCAGCAGGTCTACACTGGGTCAGCTGCCGCAGCGGCCGCTGCCGCCGCTGCAAGTCAGCCAGGACAAATTGAACCTCTGGAGGAGTTGGACACCAACTCAGCCAGAAGGAAGAGAAGGCCCACAACTGCTCACCCTA) was injected into the cytoplasm of fertilized single-cell zygotes (B6CBA F1/Crl). F0 offspring were screened by PCR and the Spocd1ΔSPIN1 allele was confirmed by Sanger sequencing. The allele was established from one founder animal and back-crossed several times to a C57BL/6N genetic background. The Spocd1ΔSPIN1 mice were thus on a mixed B6CBAF1/Crl;C57BL/6N genetic background. Animals were genotyped using a PCR of four primers (F, GACCCTGTATTTATTGAAGTCACTG; R, CCTCAGTGACATCAGGCGGA; WT-F, CACTGGGTCAGGAATCAGGC; and ∆Spin-R, GTCCTGGCTGACTTGCAGC). Mice carrying the Oct4eGFP reporter allele34 were originally obtained from Jackson Laboratories (B6;129S4-Pou5f1tm2Jae/J (Oct4-eGFP), stock number 008214).

    Male fertility was assessed by mating studs to Hsd:ICR (CD1) wild-type females and counting the number of pups born for each plugged female. For each experiment, animal tissue samples were collected from one or more litters and allocated to groups according to genotype. No further randomization or blinding was applied during data acquisition and analysis.

    Animals were maintained at the University of Edinburgh, UK, in accordance with the regulation of the UK Home Office, or at the Institute for Molecular Biology in Mainz, Germany, in accordance with local and European animal-welfare laws. Ethical approval for the UK mouse experimentation has been given by the University of Edinburgh’s Animal Welfare and Ethical Review Body and the work done under licence from the UK Home Office. Animal experiments done in Germany were approved by the ethical committees on animal care and use of the federal states of Rheinland-Pfalz, Germany, covered by LUA licence G 23-5-049.

    Immunofluorescence

    Immunofluorescence experiments were done as previously described35. The following primary antibodies were used in this study: anti-HA (Cell Signaling Technologies) 1:200; anti-LINE1-ORF1p (ref. 36) 1:500; anti-IAP-GAG (a gift from B. Cullen, Duke University) 1:500; anti-γH2AX (Bethyl Laboratories) 1:500; anti-MIWI2 (a gift from R. Pillai, Université de Genève) 1:500; anti-SPOCD1 rabbit serum rb175 1:500 (O’Carroll laboratory antibody); anti-SPIN1 (Cell Signaling Technologies) 1:500 (of a custom preparation of 1.1 μg μl−1 in PBS). Images were taken on a Zeiss Observer or Zeiss LSM880 with an Airyscan module. Images acquired using the Airyscan module were deconvoluted with the Zeiss Zen software ‘Airyscan processing’ with settings 3D and a strength of 6. ImageJ and Zeiss Zen software were used to process and analyse the images.

    Cell culture, transfection, immunoprecipitation and western blotting

    HEK293T cells (O’Carroll laboratory stock, not further authenticated, tested for mycoplasma contamination) were cultured and transfected as previously described4 with a minor modification, and 3 μl Jetprime reagent was used. On day 2 after transfection, cells were washed twice with PBS and resuspended in 1 ml lysis buffer (IP buffer: 150 mM KCl, 2.5 mM MgCl2, 0.5% Triton X-100, 50 mM Tris-HCl, pH 8, supplemented with 1× protease inhibitors (cOmplete ULTRA EDTA-free, Roche) with 37 units per ml benzonase (Millipore)) and lysed for 30 min, rotating at 4 °C. The lysate was cleared by centrifugation for 10 min at 21,000g. Cleared lysate (800 μl) was incubated with 20 μl of anti-HA beads (Pierce) that had been calibrated in lysis buffer and incubated for 1 h at 4 °C on a rotating wheel. The beads were washed four times with lysis buffer. Immunoprecipitates were eluted at 50 °C for 10 min in 20 μl 0.1% sodium dodecyl sulphate (SDS), 50 mM Tris-HCl, pH 8. Lysates and eluates were run on a 4–12% bis–tris acrylamide gel (Invitrogen) and blotted onto a nitrocellulose membrane (Amersham Protran 0.45 NC) according to standard laboratory procedures. The membrane was blocked with blocking buffer (4% (w/v) skimmed milk powder (Sigma-Aldrich) in PBS-T (phosphate buffered saline, 0.1% Tween-20)) and subsequently incubated for 1 h with primary antibodies (anti-HA (C29F4s, Cell Signaling Technologies), 1:1,000; anti-FLAG (M2, Sigma-Aldrich) 1:1,000, anti-SPOCD1 rabbit serum rb175 (O’Carroll laboratory antibody) 1:500 or anti-α-Tubulin (T9026, Sigma-Aldrich) 1:1,000) in blocking buffer. The anti-α-tubulin staining was used as loading control on the same blot as the experimental staining. After three PBS-T washes for 10 min, the membrane was incubated with secondary antibodies (IRDye 680RD donkey anti-rabbit or IRDye 800CW donkey anti-mouse, LI-COR, 1:10,000) in blocking buffer for 1 h. It was washed three times for 10 min in PBS-T and imaged on a LI-COR Odyssey CLx system. Exposure of the entire images was optimized in Image Studio Lite (LI-COR), and areas of interest were cropped for presentation.

    Protein alignments and structure prediction

    The mouse SPOCD1 AlphaFold2 protein structure prediction model22,23 was downloaded from the AlphaFold Protein Structure Database (https://www.alphafold.ebi.ac.uk/). Models for the SPOCD1–SPIN1 interaction, as well as the single SPOCD1 proteins from Anolis, Xenopus and Latimeria, were generated with AlphaFold2 (refs. 22,23) on ColabFold37. The model was visualized using PyMol38. Multiple sequence alignments of SPOCD1 and SPIN1 were generated with ClustalW39 and edited in Jalview40. For SPOCD1, alignments were edited based on secondary-structure elements of the AlphaFold2 model (B1ASB6) using Jalview40.

    Protein purification

    GST-tagged mouse SPOCD1 fragments (amino acids 203–409), Anolis SPOCD1 fragments (XP_008116112.1, amino acids 457–748), Xenopus SPOCD1 fragments (XP_031752218.1, amino acids 1–229), Latimeria SPOCD1 fragments (XP_014348336.1, amino acids 510–1009) and His-tagged SPIN1 (amino acids 49–262) were cloned in a pET-based backbone. Proteins were expressed in Escherichia coli BL21 (DE3). Bacteria were grown in 2xTY media at 37 °C until an optical density of 0.8 was reached. Then, the temperature was reduced to 18 °C, the bacteria were induced with 1 mM IPTG and grown for another 14–16 h. Cells were collected and pellets were stored at −80 °C until purification. The pellets were resuspended in 50 ml lysis buffer (20 mM Tris-HCl, pH 7.5, 200 mM NaCl, 2.5 mM imidazole, 0.5 mM β-mercaptoethanol, Roche cOmplete EDTA-free Protease Inhibitor Cocktail, 0.01 mg ml−1 DNaseI (Sigma) and 2 mM AEBSF (Pefabloc) for SPIN1, or 20 mM Tris-HCl, pH 7.5, 200 mM NaCl, 1 mM DTT, Roche cOmplete EDTA-free Protease Inhibitor Cocktail, 0.01 mg ml−1 DNaseI (Sigma) and 2 mM AEBSF (Pefabloc) for SPOCD1) and cells were lysed with the Constant systems 1.1 kW TS cell disruptor at 25 kPSI. The cleared lysate was used to load on a cOmplete His-Tag Purification Column (Roche) for SPIN1 or incubated with 7 ml glutathione sepharose high-performance beads (Cytiva) for SPOCD1 calibrated in the respective buffer. Elution from column/beads with increasing (2.5–500 mM) imidazole gradient for SPIN1 or GST elution buffer containing 20 mM reduced glutathione for SPOCD1. The fractions of interest were pooled and dialysed overnight in 20 mM Tris-HCl, pH 7.5, 100–150 mM NaCl, 1 mM DTT. The SPIN1 construct was cleaved with GST–3C protease (made in our lab) overnight. The SPOCD1 constructs were concentrated and stored at −80 °C until used. SPIN1 was further purified by ion exchange with a gradient of 100–1,000 mM NaCl (Resource Q, Cytiva) and size-exclusion chromatography (HiLoad 16/600 Superdex 200 pg, Cytiva). Finally, the protein was concentrated and stored at −80 °C until used.

    Nucleosome pull-downs with recombinant SPIN1-SPOCD1 proteins

    Histone H3 site-specifically modified with H3K4me3 and/or H3K9me3 was generated by native chemical ligation (NCL) and assembled into nucleosomes as described previously41,42. In brief, Xenopus H3 and H4 and human H2A and H2B were expressed in E. coli and purified from inclusion bodies. For NCL, a tail-less histone H3 lacking residues 1–31 and containing a threonine-to-cysteine substitution at position 32 and a cysteine-to-alanine substitution at position 110 of Xenopus H3 (H3Δ1–31T32C C110A) was expressed in E. coli and purified in the same way. NCL reactions were carried out with synthetic carboxy-terminal benzyl thioester peptides spanning residues 1–31 of histone H3.1 and carrying the desired modifications at K4 and K9 (Peptide Protein Research) in 6 M guanidine HCl, 250 mM sodium phosphate buffer, pH 7.2, 150 mM 4-mercaptophenylacetic acid (MPAA, Sigma) and 50 mM TCEP for 72 h at room temperature. Ligated full-length modified histone H3 was purified through cation-exchange chromatography on a HiTrap SP column (Cytiva). Histone octamers were reconstituted by dialysis and purified by gel filtration on an S200 size-exclusion column (Cytiva). For the generation of trans-histone octamers carrying H3K4me3 and H3K9me3 on separate copies of histone H3, the H3X–H3Y system was used43, starting from H3Δ1–31T32C C110A constructs that also contained the required H3X and H3Y mutations. H3X was used for H3K4me3 and H3Y for H3K9me3. A biotinylated 209-bp DNA fragment containing the 601 nucleosome positioning sequence was generated by PCR and purified by ion-exchange chromatography on a HiTrap Q column followed by ethanol precipitation. Mononucleosomes were then assembled from histone octamers and 601 DNA by gradient dialysis. Nucleosome assembly was verified by native gel electrophoresis on 6% acrylamide gels in 0.5× TGE buffer (12.5 mM Tris, pH 8.0, 95 mM glycine and 0.5 mM EDTA).

    Nucleosome pull-down assays were done essentially as described previously44. All incubations and washes were performed at 4 °C with end-over-end rotation, and all centrifugation steps were done at 1,500g for 2 min at 4 °C. Then, 23 pmol (3 µg) of recombinant, site-specifically modified nucleosomes were bound to streptavidin sepharose high-performance beads (Cytiva) by overnight incubation in pull-down buffer (20 mM HEPES, pH 7.9, 175 mM NaCl, 10% glycerol, 1 mM EDTA, 1 mM DTT, 0.1% NP-40, 0.1 mg ml−1 BSA). Before incubation, beads were blocked with 1 mg ml−1 BSA in pull-down buffer. Nucleosome-bound beads were washed three times with pull-down buffer before incubation with recombinant SPIN1 and SPOCD1 proteins for 2 h. His-tagged SPIN1 (49–262) and His-tagged SPOCD1 fragment 1b were expressed and purified as above. SPIN1–SPOCD1 fragment 1b complexes were purified by size-exclusion chromatography on an S200 increase column (Cytiva) as above. For the experiment shown in Fig. 1j, 23 pmol of protein was used. After incubation with recombinant proteins, beads were washed three times with high-salt pull-down buffer (as above but with 350 mM NaCl) for 5 min. Nucleosomes and bound proteins were eluted by boiling in 1.5× SDS sample buffer (95 mM Tris HCl, pH 6.8, 15% glycerol, 3% SDS, 75 mM DTT, 0.15% bromophenol blue). Binding was analysed by western blotting with antibodies against His tag (Sigma H1029, lot 033m4785) 1:1,000. Antibodies against histone H3 (Abcam ab176842, lot GR1494741-36) 1:2,500, H3K4me3 (Cell Signaling) 1:2,000 and H3K9me3 (Abcam ab176916) 1:1,000 were used to verify nucleosome loading and modification state.

    Analytical size-exclusion chromatography

    For analytical size-exclusion chromatography, 125 μg SPIN1 and/or 500 μg mouse GST–SPOCD1-F1b were used for each run. Proteins were diluted in 250 μl size-exclusion chromatography buffer (20 mM HEPES, pH 7.5, 150 mM NaCl, 1 mM DTT) and injected on a Superdex 200 10/300 GL column. Peak fractions were collected, loaded on an SDS–PAGE gel and visualized by Coomassie staining.

    Crosslinking mass-spectrometry analysis

    Recombinant fragments (25 μg) of SPOCD1 (GST–F1b) and SPIN1 were incubated in 20 mM HEPES, pH 7.5, 150 mM NaCl, 1 mM DTT and crosslinked with BS3 (bis(sulfosuccinimidyl)suberate) (Thermo Fisher Scientific) at BS3:protein ratios of 1:1, 2:1 and 4:1 (w/w) for 2 h on ice. The crosslinking reaction was stopped by adding 2 μl ammonium bicarbonate (2.0 M). Crosslinking products were run on 4–12% bis-Tris NuPAGE (Invitrogen) for 15 min and briefly stained using Instant Blue (Expedeon). Bands at more than 150 kD were excised and the proteins were reduced with 10 mM DTT for 30 min at room temperature, alkylated with 55 mM iodoacetamide for 20 min at room temperature and digested using 13 ng μl−1 trypsin (Promega) overnight at 37 °C37. The digested peptides were loaded onto C18-Stage-tips38 for liquid chromatography with tandem mass spectrometry (LC-MS/MS) analysis. The LC-MS/MS analysis was performed using Orbitrap Fusion Lumos (Thermo Fisher Scientific) with a ‘high/high’ acquisition strategy. The peptide separation was done on an EASY-Spray column (50 cm × 75 μm internal diameter, PepMap C18, 2-μm particles, 100 Å pore size; Thermo Fisher Scientific). Mobile phase A consisted of water and 0.1% (v/v) formic acid. Mobile phase B consisted of 80% (v/v) acetonitrile and 0.1% (v/v) formic acid. Peptides were loaded at a flow rate of 0.3 μl min−1 and eluted at 0.25 μl min−1 using a linear gradient going from 2% mobile phase B to 40% mobile phase B over 102 or 132 min (each sample was run twice with different gradients), followed by a linear increase from 40% to 95% mobile phase B in 11 min. The eluted peptides were introduced directly into the mass spectrometer. MS data were acquired in the data-dependent mode with a 3 s acquisition cycle. Precursor spectra were recorded in the Orbitrap with a resolution of 120,000 and a mass-to-charge ratio (m/z) range of 350–1,700. Ions with a precursor charge state between 3+ and 8+ were isolated with a window size of m/z = 1.6 and fragmented using high-energy collision dissociation with a collision energy of 30. The fragmentation spectra were recorded in the Orbitrap with a resolution of 15,000. Dynamic exclusion was enabled with single repeat count and 60 s exclusion duration. The mass-spectrometric raw files were processed into peak lists using ProteoWizard (v.3.0)39 and crosslinked peptides were matched to spectra using Xi software (v.1.7.6.4)40 with in-search assignment of mono-isotopic peaks41. Search parameters were: MS accuracy, 3 ppm; MS/MS accuracy, 5 ppm; enzyme, trypsin; crosslinker, BS3; maximum missed cleavages, 4; fixed modification, carbamidomethylation on cysteine; variable modifications, oxidation on methionine; fragments b and y ions with loss of H2O, NH3 and CH3SOH. The linkage specificity for BS3 was assumed to be at lysine, serine, threonine, tyrosine and protein N termini. Identified candidates of crosslinked peptides were validated by Xi software40, and only auto-validated crosslinked peptides were used. Identified crosslinks underlying Fig. 2b are shown in Supplementary Table 1.

    ChIP sequencing analysis

    Raw fastq.gz sequencing files for ChIP-seq of H3K4me3 and H4K9me3 were downloaded from the Sequence Read Archive record SRP165187 (ref. 24). Paired-end reads were preprocessed to remove adapter sequences and trim low-quality bases using Trimmomatic v.0.35 (ref. 45). Tru-seq adapter sequences were used in the case of ChIP-seq samples. Trimmed reads were aligned to the mouse mm10 genome with bwa mem v.0.7.16 (ref. 46) using the -M parameter. Alignments were filtered to remove duplicate reads with Picard MarkDuplicates v.2.24.0 (http://broadinstitute.github.io/picard/) and improper alignments with Samtools view v.1.11 -F 260 -f 3 (ref. 47). In the case of multi-mapping reads, a single alignment (marked as primary by bwa) was selected for downstream analysis. BAM files were converted to normalized bigWig files for visualization and plotting using deepTools48 bamCoverage v.3.5.0 with the following parameters: -bs 1 –normalizeUsing BPM.

    ChIP heatmaps and average profile plots

    Genomic annotations for repetitive elements L1Md_A, L1Md_T, L1Md_F (combining elements classified as L1MD_F, L1Md_F2, L1Md_F3), L1Md_Gf, IAPEy and MMERVK_10C were extracted from Repeat Masker using the UCSC table browser. Normalized read coverage was computed across these elements using deepTools v.3.5.0 computeMatrix. The central regions were length-normalized to 5 kb with flanking regions ±2 kb from the start and end positions. Heatmaps were drawn using deepTools v.3.5.0 plotHeatmap, separating each repetitive element and sorting rows in descending order of total signal. LINE1 elements (L1Md_A, L1Md_F and L1Md_T) were further separated into young LINE1 elements based on a divergence of 38 bases per kb or less from a consensus sequence4 or the presence of an intact functional promoter denoted by the presence of specific monomer annotations49. Monomers associated with inert promoters (subtypes 6 and 2) were removed from the analysis. Average profiles were generated for each experiment and each category of repetitive element by calculating the mean signal between replicate samples. Computations were performed in R, with the seqplots package50, using bins of 50 bases, flanking regions of 2 kb and a central-region length normalized to 5 kb. Final plots were drawn and formatted using the tidyverse packages51.

    IP-MS

    IP-MS of SPOCD1–HA from Spocd1HA/+ E14.5 fetal testis using 50 μl of anti-HA beads (Pierce, 88837) was done as previously described4, with a reduced number of 25 testes per replicate. Wild-type fetal testes were used as controls.

    Fluorescence-activated cell sorting (FACS)

    To purify foetal germ cells for CUT&Tag analysis, E14.5 testes were dissected from embryos carrying the Oct4eGFP allele34. A single cell suspension was obtained by sequential treatment with 100 µl collagenase solution at 37 °C for 8 min (10 units of collagenase A (Sigma-Aldrich 10103578001); 2× NEAAs (Gibco); 2× Na-pyruvate (Gibco); 25 mM HEPES–KOH, pH 7.5) and 200 µl TryPLE Express (Gibco) at 37 °C for 5 min with gentle flicking and pipetting of the solution to aid dissociation. Digestion was neutralized by 70 µl prewarmed FBS and cells were collected by spinning at 600g for 4 min at room temperature followed by two washes in FACS buffer (1× PBS; 2 mM EDTA, 25 mM HEPES-KOH, pH 7.5, 1.5% BSA, 10% FBS; 2 µg ml−1 DAPI) and filtering (Corning, 352235) just before sorting. Cell sorting was done on an Invitrogen Bigfoot using a 100 μm nozzle and gating for DAPI-negative (live), OCT4–eGFP-positive (germ cells) populations into collection tubes containing 100 µl 1× PBS.

    For EM-seq, CD9+ spermatogonia were sorted from P14 testes as described previously52 using Fc block (eBioscience, 14-0161-86, clone 93, lot 2297433) 1:50; biotin-conjugated anti-CD45 (eBioscience, 13-0451-85, clone 30-F11, lot 2349865) 1:400, and biotin-conjugated anti-CD51 (Biolegend, 104104, clone RMV-7, lot B308465) 1:100 anti-CD9APC (eBioscience, 17-0091-82, clone eBioKMC8, lot 2450733) 1:200, anti-cKitPE-Cy7 (eBioscience, 25-1171-82, clone 2B8, lot 2191977) 1:1,600, streptavidinV450 (BD bioscience, 560797, lot 1354158) 1:400 and 1 μg ml−1 DAPI. Cells were sorted into DMEM media on a BD Aria II sorter, pelleted for 5 min at 500g and snap frozen in liquid nitrogen.

    For gating strategies, see Supplemental Fig. 2.

    CUT&Tag assays

    CUT&Tag was done on FACS-isolated fetal germ cells as previously described26, with some minor modifications. First, 10,000 to 20,000 germ cells were bound to 10 µl concanavalin A-coated beads (Polysciences, 86057-10). After binding to beads, cells were fixed with 0.2% formaldehyde for 2 min followed by quenching with glycine (125 mM) and washed with Dig-Wash buffer while separated on the magnet. The remaining steps were as previously described26, using pA–Tn5 at a 1:400 dilution (Diagenode, C01070001) and 15 PCR cycles of library amplification. Libraries were cleaned up by magnetic bead-based solid-phase separation and assessed on a Tapestation (Agilent). Antibodies and dilutions used for CUT&Tag were rabbit IgG control (Abcam, ab37415, lot GR3219601-1) at 1:50, rabbit anti-SPIN1 (Cell Signaling, 89139S, lot 2) at 1:50, rabbit anti-H3K4me3 (Merck-Milipore, 07-473, lot 403371) at 1:50, rabbit anti-H3K9me3 (Abcam, ab8898, lot GR27111-1) at 1:50, and guinea pig anti-rabbit IgG (Antibodies Online, ABIN101961, lot NE-200-032309) at 1:100. Pooled libraries were sequenced using paired-end 150 bp on a NextSeq 2000 instrument (Illumina).

    CUT&Tag analysis

    First, 150b and 155b paired-end CUT&Tag sequencing reads were processed and aligned to the mouse-genome assembly (version GRCm38) using the NF-core (https://doi.org/10.5281/zenodo.7715959) CUT&RUN Nextflow pipeline version 3.1 (ref. 53). The pipeline performed adapter trimming with Trim Galore (https://doi.org/10.5281/zenodo.5127898) and reference-genome alignment with Bowtie2 (ref. 54). Multimap reads were included using the parameter –minimum_alignment_q_score 0. The pipeline performed further filtering of reads to report only properly paired primary alignments and remove alignments to GRCm38 blacklisted regions. The default for the pipeline is to remove only duplicate reads (alignments that share common start and end points) from IgG controls. However, after further assessment of the sequence duplication rates in all samples, we decided to perform read deduplication on the SPIN1 replicate samples. Deduplication of SPIN1 samples was performed using Picard MarkDuplicates v.2.24.0 (http://broadinstitute.github.io/picard/) with the parameter –REMOVE_DUPLICATES. Individual replicates from each sample were then merged into a single BAM file using Samtools merge v.1.11 (ref. 47) for downstream analysis. Normalized bigWig files of read coverage were generated with deepTools bamCoverage v.3.50 (ref. 48), using the following parameters: -bs 1 –normalizeUsing CPM —exactScaling –ignoreForNormalization MT. Log2 enrichment profiles of CUT&Tag samples over IgG controls were generated with deepTools bamCompare using the following parameters: -bs 1 –normalizeUsing CPM –exactScaling –ignoreForNormalization MT –scaleFactorsMethod None.

    Log2 enrichment profiles of CUT&Tag versus IgG control over various classes of repetitive elements (L1Md_A, L1Md_F, L1Md_Gf, L1Md_T, IAPEy-int and IAPEz-int) were plotted as heatmaps and average profiles, using computeMatrix from the deepTools48 package and the profilePlyr55 R package to include annotations of peak overlaps. Positions of repetitive elements were extracted from a table of mouse mm10 repeatMasker annotations downloaded from the UCSC table browser and filtered for elements greater than 5 kb in length. LINE1 elements (L1Md_A, L1Md_F, L1Md_T) were further separated into young LINE1 elements based on a divergence of 38 bases per kb or less from a consensus sequence4 or the presence of an intact functional promoter denoted by the presence of specific monomer annotations49. Monomers associated with inert promoters (subtypes 6 and 2) were removed from the analysis. The central regions of repetitive elements were length-normalized to 5 kb with flanking regions ±2 kb from the start and end positions. Heatmaps and profile plots show data in consecutive 10b bins with regions subdivided by elements and arranged in descending order of total enrichment across all samples.

    Peak calling was done using MACS2 callpeak56 on individual replicates as well as all replicates together, with IgG samples set as a control. The parameter –keep-dup all was used to include duplicate reads, when present, in the peak calling model. To attain a set of high-confidence peaks, we selected peaks with a minimum coverage of 20 reads in the CUT&Tag sample and a peak score greater than the mean peak score. Peaks of co-localized H3K4me3 and H3K9me3 binding were attained by finding the intersection of both peak sets using the GenomicRanges R package57. Peak sets were overlapped with annotations to provide a breakdown of their intersection with specific genomic features, with each peak assigned to a single classification in the following hierarchy: LINEs, other repetitive elements, genes and intergenic. LINEs included all repeatMasker annotations included in the LINE class. Other repetitive elements included repeatMasker annotations in the classes LTR, Simple_repeat, Satellite, ERVK and Retrotransposon. Genes were defined as any coding or non-coding transcriptional unit plus 500 bases upstream, based on the ENSEMBL gene annotations GRCm38 v.79. Overlaps of peaks with genomic features was performed using the GenomicRanges R package57.

    Downstream data analysis and plotting was predominantly performed using the R programming language (R Core Team, 2021, https://www.R-project.org/) and the Tidyverse libraries51. Genome snapshots and data tracks were prepared using pyGenomeTracks58.

    Histology of mouse samples

    Histology experiments on mouse samples were done as previously described4.

    TUNEL assay

    TUNEL assay experiments were done as previously described4.

    RNA sequencing and analysis

    RNA sequencing experiments and analysis were done as previously described4 with data for Spocd1−/− downloaded from GSE131377 (ref. 4).

    Whole-genome methylation sequencing and analysis

    Whole-genome methylation sequencing of DNA derived from Spocd1ΔSPIN1 and wild-type P14 spermatogonia was performed using the NEBNext Enzymatic Methyl-seq (EM-seq, New England Biolabs) as described4. Analysis of DNA methylation was done as described previously4. Data for Spocd1−/− and corresponding wild-type P14 spermatogonia were retrieved from E-MTAB-7997 (ref. 4).

    Statistical information

    Data were plotted in R (v.2022.07.01 and 554 running R v.4.0.3 (2020-10-10)) using the dplyr, ggplot2, tidyr, cowplot, reshape2, ggrepel, ggpubr, scales and RColorBrewer packages (versions dplyr_1.0.4, ggplot2_3.3.3, tidyr_1.1.2, cowplot_1.1.1, scales_1.1.1, reshape2_1.4.4, ggrepel_0.9.1, ggpubr_0.4.0, scales_1.1.1, RColorBrewer_1.1-2) or Microsoft Excel for Mac (v.16). Statistical testing was done with R (v.4.0.3 (2020-10-10)) using R Studio software or with Perseus59 (v.1.6.5.0) for the mass-spectrometry data and DEseq2 (ref. 60) for the RNA-seq data. We used the regioneR package55 in R to perform permutation tests to assess the statistical significance of overlaps of CUT&Tag peaks with LINE1 elements. Unpaired, two-tailed Student’s t-tests were used to compare the differences between groups and adjusted for multiple testing using Bonferroni correction where indicated, except for RNA-seq data analysis, where Wald’s tests were used. Averaged data are presented as mean ± s.e.m., unless otherwise indicated. No statistical methods were used to predetermine the sample size. The experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment.

    Reporting summary

    Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

    [ad_2]

    Source link

  • Selfish conflict underlies RNA-mediated parent-of-origin effects

    [ad_1]

    Maintenance of worm strains

    Nematodes were grown on modified nematode growth medium (NGM) plates with 1% agar/0.7% agarose to prevent C. tropicalis burrowing. Experiments were conducted at either 25 °C (C. tropicalis) or 20 °C (C. elegans). csr-1(+/−) strains were cultured on 6-cm NGM plates supplemented with 500 μl of G418 (25 mg ml−1) for selecting heterozygous null individuals. Supplementary Table 2 lists all study strains, some of which were provided by the Caenorhabditis Genetics Centre, funded by the NIH Office of Research Infrastructure Programs (P40 OD010440).

    Phenotyping and genotyping of crosses

    For crosses, 4–5 L4 hermaphrodites were mated with 30–40 males in a 12-well plate with modified NGM. After 2 days, 10 L4 F1 progeny were transferred to separate plates, genotyped by PCR, and at least 10 embryos per F1 hermaphrodite were singled into 6-cm NGM plates. Each F2 individual was visually inspected daily for up to 7 days, classified for developmental stage, and any phenotypic abnormalities. Embryonic lethality, arrested development, and delayed reproduction were assessed. Sterility was noted for adults not producing progeny. After 7 days, worms were lysed and genotyped. A list of primers used for genotyping can be found in Supplementary Table 3. Crosses involving csr-1(−); slow-1/grow-1 hermaphrodites vs EG6180 males or injected hermaphrodites vs NIL males were selected based on a pmyo-2::mScarlet reporter.

    Generation of C. tropicalis transgenic lines

    For CRISPR–Cas gene editing, we adapted previous protocols53. In brief, 250 ng µl−1 Cas9 or Cas12a proteins were incubated with 200 ng µl−1 CRISPR RNA (crRNA) and 333 ng µl−1 trans-activating crRNA (tracrRNA) before adding 2.5 ng µl−1 co-injection marker plasmid (pCFJ90-mScarlet-I). For HDR, donor oligos (IDT) or biotinylated and melted PCR products were added at a final concentration of 200 ng µl−1 or 100 ng µl−1, respectively. Following injections into young hermaphrodites, mScarlet-positive F1 were singled, and their offspring screened by PCR and Sanger sequencing to detect successful editing. To clone the mScarlet::SLOW-1 donor, we added ~300-bp homology arms amplified from QX2345 genomic DNA to mScarlet-I (from pMS050) in pBluescript via Gibson assembly. Because csr-1 is essential for viability in C. elegans, we first devised a strategy to stably propagate a csr-1 heterozygous line in the absence of classical genetic balancers. To do so, we used CRISPR–Cas9 to introduce a premature stop mutation in the endogenous csr-1 locus followed by a neoR cassette, which confers resistance to the G418 antibiotic (Extended Data Fig. 6d). For the csr-1::neoR donor, we first replaced the C. elegans rps-27 promoter and unc-54 3′ UTR in pCFJ910 with 500 bp upstream and 250 bp downstream of the C. tropicalis rps-20 gene. This rps-20::neoR cassette was then flanked with ~550-bp homology arms amplified from EG6180 worms and inserted into pBluescript. Correct targeting introduces a stop codon after residue L337 of CSR-1 followed by a ubiquitously expressed neomycin resistance. We propagated the mutant line in plates containing G418 and thus actively selecting for heterozygous csr-1(−) null individuals. Upon drug removal, most homozygous csr-1(−) individuals derived from heterozygous mothers developed into adulthood but were either sterile or laid mostly dead embryos. However, a small fraction of null mutants was partially fertile and homozygous csr-1(−) lines could be stably propagated for multiple generations despite extensive embryonic lethality in the population (Extended Data Fig. 6d). All gRNAs and HDR templates are available on Supplementary Tables 4 and 5.

    In vitro RNA transcription and injection

    The slow-1 cDNA was cloned into pGEM-T Easy (Promega, A1360), with a 5′ T7 RNA polymerase site and the start codon mutated RNA-only transcription (ATG>TTG). The plasmid was digested with NotI to release the insert (NEB, R0189), which was subsequently purified by gel-extraction and used as template for RNA synthesis. RNA was prepared using the HiScribe T7 Quick High Yield kit (NEB, E2050) with the following modifications: addition of 3 µl of 10 mM DTT and 1 µl of RNaseOUT (Thermo, 10777019). After overnight transcription, the reaction was diluted, treated with RNase-free DNase I (NEB, M0303S), bead-purified (Vienna Biocenter MBS 5001111, High Performance RNA Bead Isolation), quantified (Thermo, Q32852), and stored at −80 °C. Injections were repeated twice using independently transcribed RNA at concentrations: 150 nM and 400 nM yielding identical results.

    Reciprocal crosses with the mScarlet::slow-1 reporter line

    To assess SLOW-1 expression in F1 progeny from reciprocal crosses between mScarlet::SLOW-1 NIL and EG6180 strains, we conducted 2 sets of crosses: (1) SLOW-1::mScarlet dpy (INK461) hermaphrodites to EG6180 males for maternal inheritance; and (2) EG6180 dpy (QX2355) hermaphrodites to mScarlet::SLOW-1 NIL males (INK459) for paternal inheritance. Wild-type young adult F1 progeny were immobilized in NemaGel on a glass slide and imaged using an Axio Imager.Z2 (Carl Zeiss) widefield microscope with a Hamamatsu Orca Flash 4 camera, (excitation 545/30 nm filter). The analysis was performed in FIJI, by tracing the germline in the DIC channel and measuring mean fluorescence, including gut autofluorescence.

    Sequencing and genome assembly of EG6180

    We extracted high molecular weight genomic DNA using the Masterpure Complete DNA and RNA purification kit (tissue sample protocol, Lucigen). We prepared 8 kb, 20 kb and unfragmented sequencing libraries using the 1D Ligation Sequencing Kit (Oxford Nanopore SQK-LSK109). The 8 kb fragmentation was done using g-TUBE (Covaris). Library was loaded on a MinION MK1B device (Oxford Nanopore). Read calling was done using MinKNOW software. We performed a hybrid assembly, incorporating Illumina sequencing reads of EG6180 with some modifications as detailed below9. We used assembled Illumina reads to correct raw Nanopore reads, which were assembled using Flye Assembler54. The preliminary assembly included 119 contigs in 107 scaffolds (Scaffold N50 was 1,489,504 bp). We derived synteny blocks between the provisional assembly and our chromosome-level NIC203 assembly using Sibelia55 and used the synteny blocks to scaffold the contigs to chromosome level using Ragout56.

    Identification of C. tropicalis Argonaute proteins and piRNA pathway effectors

    We annotated functional domains in C. tropicalis NIC203 using Interproscan 5 as part of our previous NIC203 genome assembly9. We identified Argonaute proteins with PFAM domains, including Piwi (PF02171), PAZ (PF02170), N-terminal domain of Argonaute (PF16486), Argonaute linker 1 (PF08699), Mid domain of Argonaute (PF16487) and Argonaute linker 2 (PF16488) domains. We excluded a protein with low molecular weight (41 kDa) as unlikely to be an Argonaute and the orthologue of C. elegans Dicer that represented an outgroup to the rest of the proteins. After aligning those sequences to C. elegans Argonautes identified in a previous study57 using Clustal Omega we conducted phylogenetic analysis using iqtree2 (ref. 58), with 1,000 replicates of the approximate likelihood-ratio test (–alrt 1000) and 1,000 boostraps (-b 1000). iqtree2 carries out an initial model selection step, and a substitution model with the general Q matrix, empirical codon frequencies, a proportion of invariable sites and a free rate heterogeneity (Q.pfam+F + I + R4) was selected. Additional orthologues of C. elegans piRNA effector genes were identified through reciprocal blastp searches, synteny conservation, and gene trees from Wormbase Parasite59. C. elegans mut-16, rrf-1, and simr-1 have 1:1 orthologues in C. tropicalis. The evolutionary history of SET proteins is complex due to their propensity to gain and lose paralogues within Caenorhabditis. The gene annotated gene as C. tropicalis set-25, is the closest among six paralogues in its genome. Thus, the absence of a phenotype in the mutant may be attributed to genetic redundancy. The gene annotated as C. tropicalis set-32 is a close orthologue of two C. elegans genes: set-21 and set-32. The SET domains of C.tr-SET-32 and C.el-SET-32 are ~48% identical at the protein level. Additionally, using Alphafold2 (ref. 60) we found that these two proteins have high structural similarity (root mean square deviation = 0.962) and using the predicted structure of C.tr-SET-32 as a query retrieved C.el-SET-32 as the top hit in C. elegans (Foldseek)61.

    Transgenerational silencing of slow-1/grow-1

    In the transgenerational inheritance experiments, EG6180 hermaphrodites were crossed to NIL (QX2345) males. F1 individuals were genotyped after laying embryos to distinguish between self-progeny from cross-progeny. F2 embryos from cross-progeny mothers were singled, allowed to lay eggs and genotyped. F3 homozygous carriers for slow-1/grow-1 propagated for multiple generations and mated to EG6180 males. The slow-1/grow-1 TA activity was assessed by determining the proportion of delayed EG/EG non-carriers.

    Single molecule in situ hybridization

    Stellaris FISH Probes targeting slow-1, slow-2 and pgl-1 were designed using the Stellaris RNA FISH Probe Designer (Biosearch Technologies). The probes were labelled with Quasar 570, CAL Fluor Red 610 or Quasar 670, respectively (Biosearch Technologies). The protocol was adapted from Raj et al.62 and described in ref. 9. For imaging, an Axio Imager.Z2 (Carl Zeiss) widefield microscope with a Hamamatsu Orca Flash 4 camera and a 63×/1.4 plan-apochromat Oil DIC objective was used. Filters used were: DAPI excitation 406/15 nm, emission 457/50 nm and Quasar 570 excitation 545/30 nm, emission 610/75 nm. z-stack images with 40 slices (step size 0.2 µm) were acquired. Image analysis was performed with the FIJI plugin RS-FISH63 with parameters set at Sigma 1.44, and threshold 0.0062.

    RNA extraction and RNA-seq

    Total RNA was extracted from approximately 100 young adult hermaphrodites and F1 progeny, with the later using recessive mutations to visually discriminate cross-progeny from self-progeny. Reciprocal crosses were set up between parental strains for maternal or paternal inheritance of slow-1/grow-1 by mating INK531 hermaphrodites (uncoordinated worms in NIC203 background) to EG6180 males and QX2355 hermaphrodites (dumpy worms in EG6180 background) to NIC203 males and selecting phenotypically wild-type progeny for RNA extraction. Reciprocal crosses between NIL and EG6180 strains were performed analogously (INK255 hermaphrodites (dumpy worms in NIL background) to EG6180 males and QX2355 hermaphrodites (dumpy worms in EG6180 background) to QX2345 NIL males). Total RNA was extracted following a modified version of the protocol in64 including multiple M9 washes, TRizol and chloroform incubation, phase-separation, isopropanol precipitation and resuspension in RNase-free water. Samples with RNA integrity number (RIN) > 8 were used for library preparation using the NEBNext Poly(A) kit and sequenced on NextSeq2000 P2 SR100 or NovaSeq S1 PE100 at the Vienna Biocenter NGS facility. To reduce reference bias, raw reads were aligned to a concatenated NIC203 + EG6180 genome/transcriptome assembly using STAR and bcbio-nextgen (https://github.com/bcbio/bcbio-nextgen). Transcript quantification and normalization were performed with tximport and Deseq2 (ref. 65). We used Deseq2 to fit a model for the normalized counts using the strain identity of the mother and sequencing batch (Nextseq vs NovaSeq libraries) as fixed effects and compared the model to a null model that included only batch using a likelihood-ratio test. Despite identifying an outlier in the slow-1/grow-1 paternal inheritance samples (Fig. 1d), no obvious difference between the outlier and the other samples in terms of RNA quality and mRNA-seq quality control were identified. However, since each library was derived from an independent genetic cross, we cannot discard a human error, and therefore decided that it would be best practice to keep the outlier in the final analysis.

    RT–qPCR

    RNA was extracted from adult worms (50 males or 100 hermaphrodites per biological replicate) using TRIzol-chloroform extraction, followed by Dnase I digestion66 and then RNA concentrations were measured using the Qubit High-Sensitivity RNA fluorescence kit (Thermo). cDNA was prepared with SuperScript III reverse transcriptase (Thermo) using random hexamers. Intron-spanning primers were validated with standard curves from QX2345 cDNA to ensure amplification efficiency and an r2 value above 0.95. The following primers were used: FW-slow-1-mRNA: 5′-GAGCTACCGGAACTGGATAAAG-3′, RV-slow-1-mRNA: 5′-CAGAGTTCTCGGAAGTCTCCTC-3′, FW-slow-1-pre-mRNA: 5′-CGGACTGGATGAAACATTTAGC-3′, RV-slow-1-pre-mRNA: 5′-GAGCGGTGTTGACctgaatc-3′, FW-cdc-42: 5′-CGATTAAATGTGTCGTCGTAGG-3′, and RV-cdc-42: 5′-ACCGATCGTAATCTTCTTGTCC-3′. All samples had at least 3 biological replicates. We used the ∆∆Ct method to calculate relative fold change and chose cdc-42 as a housekeeping gene67,68. Cdc-42 expression showed a low coefficient of variation in our RNA-seq datasets suggesting its validity as a housekeeping gene. All RT–qPCR reactions were prepared with the Luna Universal qPCR and RT–qPCR kit (NEB) and run with an annealing temperature of 58 °C. All biological replicates were run in technical quadruplicate and any reactions with abnormal amplification curves or melting temperatures were omitted before analysis (distinct from reactions for which we observed no amplification, which were not omitted). Representative samples from each condition were Sanger sequenced. We confirmed the absence of genomic DNA contamination in RNA samples by performing PCRs with gDNA-specific primers using the RNA as template and observed no amplification after 40 cycles. RT–qPCR indicated specific amplification of slow-1 in both hermaphrodites and males. However, the higher Ct values for males (34.27 versus 28.31 on average) and greater variability (s.d. of 1.55 versus 0.65 in the NIL) suggest much lower expression levels in males. This variability hinders a reliable estimate of abundance and assessment of the parent-of-origin effect in males.

    Small RNA library preparation and sequencing

    We isolated sRNAs, using the TraPR protocol69. In brief, frozen worm pellets (2,000 worms per parental line) were supplemented with 350 µl lysis buffer, (20 mM HEPES-KOH, pH 7.9, 10% (v/v) glycerol, 1.5 mM MgCl2, 0.2 mM EDTA, 1 mM DTT, 0.1% v/v Triton X-100). Samples were mechanically disintegrated and subjected to 4 freeze–thaw cycles in liquid nitrogen. The resulting lysates were cleared by centrifugation and the sRNA fraction was isolated using the TraPR Small RNA Isolation Kit (135.24, LEXOGEN). Isolated sRNA was treated with RppH (M0356S, BioLabs), to ensure 5′ monophosphate-independent capturing of small RNAs70, following purification with Agencourt RNA Clean XP magnetic beads (BECKMAN COULTER). The sRNA was ligated to a 32-nt 3′ adapter with unique barcodes (sRBC, Supplementary Table 6, IDT) using truncated T4 RNA ligase 2 (M0373L, NEB). The resulting RNA was run on 12% SequaGel–UreaGel (National Diagnostics) and purified with ZR small-RNA PAGE Recovery Kit (R1070, ZYMO RESEARCH). The 37-nt-long 5′ adapter was ligated to the sRNAs using T4 RNA ligase (M0204S, NEB). The resulting RNA was cleaned up (R1015, ZYMO RESEARCH), reverse-transcribed, and PCR amplified. The cDNA fragments (160–190 nt) were extracted and gel purified (D4008, ZYMO RESEARCH). Small RNA Libraries were sequenced in triplicates on a NovaSeq S1 SR100 mode (Illumina) at the Vienna Biocenter NGS facility. All sequencing libraries generated for this project are listed in Supplementary Table 7.

    sRNA immunoprecipitation

    To study piRNA binding preferences of PRG-1.1 and PRG-1.2, we performed sRNA immunoprecipitation of N-terminally Flag-tagged PRG-1.1 (INK775) and PRG-1.2 (INK735) followed by sRNA-seq. For each of the 3 biological replicates (50,000 worms each), 18 worm plates (9 cm) were bleached to synchronize the population. Young adults were collected, frozen at −70 °C, thawed and washed with RIP buffer (50 mM Hepes pH 7.2, 150 mM NaCl, 0.01% NP-40). For lysis, RIP buffer and Benzonase were added and sonicated in a Diagenode Bioruptor followed by cleaning via centrifugation. For immunoprecipitation, 200 µl of Anti-Flag M2 Magnetic Beads (Millipore) were used (4 °C, overnight). The bound proteins were eluted in 500 µl 0.1 M GlycinHCl pH 2.7 for 5 min at room temperature. And transferred into a vial with 50 µl 1 M Tris-HCl pH 8. The proteins were digested with Proteinase K (0.7 mg ml−1), and denatured proteins were removed by centrifugation following proteinase K inactivation. Samples were stored at −70 °C until library preparation.

    Small RNA analysis

    Sequencing adapters were trimmed from 5′ and 3′ ends using Cutadapt v1.18 (ref. 71). Extracted 21U and 22G reads aligned to the genome using hisat2 v2.1 (ref. 72). For 22 G, only reads mapped to the coding sequences were analysed; for 21U, reads mapped to coding sequences, tRNAs and rRNAs were excluded using seqkit v0.13 and samtools v1.10. 22 G reads were quantified using featureCounts (Rsubread, R), normalized by the total number of 22 G per replicate, and visualized using the Gviz R package62. Candidate 21U-RNAs were identified based on perfect mapping and abundance criteria (>0.1 ppm). A custom script quantified 21U-RNAs and reads were normalized to miRNAs predicted based on homology to C. elegans miRNAs. To identify potential 21U-RNAs slow-1 candidates we used known targeting rules in C. elegans and binding energies. First, putative binding sites and energies for all 21U-RNAs against slow-1 mRNA were predicted with RNAduplex (ViennaRNA Package v2.0.58)63, of which five best duplexes for every piRNA were taken. Candidate piRNAs without bubbles during binding and no more than 4 mismatches outside the seed region were extracted and ranked by binding energy (Supplementary Data 1). The second candidate list was generated considering the overall level of binding continuity by using Nucleotide blast v2.2.26 in blastn-short mode. Only 21U-RNAs with no mismatches or gaps in the seed region were selected for further analysis. Finally, we ranked 21U-RNAs by the total length of the ungapped alignment to slow-1 (Supplementary Data 1).

    Chromatin immunoprecipitation

    For chromatin immunoprecipitation, we collected an F4 population of homozygous carriers for the repressed slow-1 allele after paternal inheritance, which was highly enriched in s22G-RNA complementary to slow-1 (Fig. 3i,j). First, we crossed EG6180 hermaphrodites to NIL males. The F2 were genotyped to identify repressed slow-1/grow-1 (NIC/NIC) worms which were expanded for two generations (F4) and collected as young adults. Each ChIP sample represents an independent genetic cross. Worms (200 µl) were collected, washed and incubated to minimize bacterial content and frozen in liquid nitrogen. For ChIP, we used the protocol described64. Shortly the frozen worm pellet was pulverized by grinding in mortar with liquid nitrogen and the powder was crosslinked in 1 ml ice-cold RIPA buffer supplemented with 2% formaldehyde to crosslink (10 min, 4 °C). After quenching by addition of 100 µl 1 M Tris-HCl (pH 7.5), the sample was sonicated using Covaris for 600 s to achieve chromatin fragments of 200–500 bp. Fifty microlitres of the lysate was saved as an input fraction. Chromatin was immunoprecipitated using anti-H3K9me3 antibody (Ab8898, Abcam). The immunoprecipitation product was incubated with Protein A Dynabeads (Thermofisher scientific) and washed with LiCl. The immunoprecipitation product was eluted from beads and DNA was purified using ChIP DNA Clean and Concentrator kit (Zymo Research). Input control fractions were treated similarly to immunoprecipitation samples. DNA libraries were prepared with NEBNext Ultra II DNA Library Prep Kit (Illumina), deduplicated using bbmap v38.26, aligned using bwa mem v0.7.17 (ref. 65), and normalized by the number of reads that mapped to the genome with samtools v1.10 (ref. 73). Peaks were called by macs2 v2.2.5 with –broad and –mfold 1 50 options74. Quality control plots were made using deeptools v3.3.1 (ref. 75). H3K9me3 signal was calculated as read counts per genomic position in the ChIP sample normalized by counts in the corresponding input sample using bedtools v2.27 (ref. 76) and custom R (v4.3) script.

    Immunohistochemistry

    Gravid nematodes were washed from plates, and embryos were extracted using bleach solution. The embryo suspension was applied to prepared poly-l-lysine slides (Sigma-Aldrich, P8920), and immersed into liquid nitrogen, fixed in ice-cold methanol (10 min) followed by acetone (10 min), and rehydrated in descending ethanol concentrations (95%, 70%, 50% and 30% ethanol). Fixed embryos were blocked in 3% BSA (VWR Life Science, 422351 S), followed by incubation with anti-Flag M2 primary antibody (Sigma-Aldrich, F3165, diluted 1:3,000). After washing, a secondary antibody Alexa Fluor A568 (ThermoFisher Scientific, A-11031, diluted 1:3,000) was applied, followed by additional washes. The final wash contained DAPI (Merck, D9542, 5 ng ml−1). Processed embryos were mounted with Fluoroshield (Sigma-Aldrich, F6182) and imaged at Axio Imager 2 (ZEISS).

    Fluorescence intensity quantification

    Twenty-four-bit raw images were analysed in Fiji (v1.53r)77. Embryos were selected by freehand tool and the same selection mask was used to capture background fluorescence intensity for each embryo. To compare fluorescence intensities between strains we used corrected total cell fluorescence (CTCF) parameter (CTCF = integrated density − (area of selected cell × mean fluorescence of background readings)). At least 23 embryos were used for quantification.

    Worm protein lysate preparation and western blot

    Gravid adult worms were collected, washed, and flash-frozen in the liquid nitrogen. Worm pellets were resuspended in ice-cold lysis buffer (30 mM HEPES pH 7.4, 100 mM KCl, 2 mM MgCl2, 0.05% IGEPAL, 10% glycerol and 1 tablet of protease inhibitors (Roche, 11836153001)) and lysed by sonication in Bioruptor (UCD-200, Diagenode) followed by centrifugation to obtain the supernatant. After protein quantification by Bradford assay (Thermo Scientific, 23238), samples were diluted, resuspended in SDS loading buffer, and loaded onto NuPAGE gels (Invitrogen). Samples were transferred to 0.45 µm PVDF membrane (Thermo Scientific, 88518) and blocked with 4% non-fat milk in TBS-T. Membranes were incubated with anti-Flag M2 (mouse, 1:2,000, Sigma-Aldrich, F3165) or anti-actin (rabbit, 1:3,000, Abcam, ab13772) primary antibody overnight followed by incubation with HRP-conjugated anti-mouse (1:10,000, Invitrogen, G-21040) or anti-rabbit (1:10,000, Jackson Immuno, 111-035-045) secondary antibody. Detection was performed using ECL reagent (Cytiva, RPN2106) and imaged with ChemiDoc MP (Bio-Rad). Membranes were stripped before reprobing (Thermo Scientific, 21059).

    Live imaging of mScarlet::SLOW-1

    Approximately 20 gravid adults were dissected in M9 medium under a stereo microscope. Embryos were transferred to individual wells in a Thermo Scientific Nunc MicroWell 384-Well Optical-Bottom Plate (Thermo Scientific). Embryos were imaged using an Olympus spinning disk confocal based on an Olympus IX3 Series (IX83) inverted microscope, equipped with a dual-camera Yokogawa W1 spinning disk (Yokogawa Electric Corporation) and two ORCA-Flash 4.0 V3 Digital CMOS cameras (Hamamatsu). Each field was imaged using a 40×/0.75 NA (air) objective, 16 z-sections at 2 µm and conditions were as follows: bright-field (100% power 30 ms) 568 nm, (100% power, 500 ms). Image acquisition was performed using CellSense software (Olympus). Image processing and montages were created using Fiji and embryoCropUI78.

    Reporting summary

    Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

    [ad_2]

    Source link