Tag: Cellular neuroscience

[ad_2]

Source link

  • Whole-brain annotation and multi-connectome cell typing of Drosophila

    [ad_1]

    Annotations

    Base annotations

    At the time of writing, the general FlyWire annotation system operates in a read-only mode in which users can add additional annotations for a neuron but cannot edit or delete existing annotations. Furthermore, the annotations consist of a single free-form text field bound to a spatial location. This enabled many FlyWire users (including our own group) to contribute a wide range of community annotations, which are reported in our companion paper1 but are not considered in this study. As it became apparent that a complete connectome could be obtained, we found that this approach was not a good fit for our goal of obtaining a structured, systematic and canonical set of annotations for each neuron with extensive manual curation. We therefore set up a web database (seatable; https://seatable.io/) that allowed records for each neuron to be edited and corrected over time; columns with specific acceptable values were added as necessary.

    Each neuron was defined by a single point location (also known as a root point) and its associated PyChunkedGraph supervoxel. Root IDs were updated every 30 min by a Python script based on the fafbseg package (Table 1) to account for any edits. The canonical point for the neuron was either a location on a large-calibre neurite within the main arbour of the neuron, a location on the cell body fibre close to where it entered the neuropil or a position within the nucleus as defined by the nucleus segmentation table80. The former was preferred as segmentation errors in the cell body fibre tracts regularly resulted in the wrong soma being attached to a given neuronal arbour. These soma swap errors persisted late into proofreading and, when fixed, resulted in annotation information being attached to the wrong neuron until this in turn was fixed.

    We also note that our annotations include a number of non-neuronal cells/objects such as glia cells, trachea and extracellular matrix that others might find useful (superclass not_a_neuron; listed in Supplementary Data 2).

    Soma position and side

    Besides the canonical root point, the soma position was recorded for all neurons with a cell body. This was either based on curating entries in the nucleus segmentation table (removing duplicates or positions outside the nucleus) or on selecting a location, especially when the cell body fibre was truncated and no soma could be identified in the dataset. These soma locations were critical for a number of analyses and also allowed a consistent side to be defined for each neuron. This was initialized by mapping all soma positions to the symmetric JRC2018F template and then using a cutting plane at the midline perpendicular to the mediolateral (x) axis to define left and right. However, all soma positions within 20 µm of the midline plane were then manually reviewed. The goal was to define a consistent logical soma side based on examination of the cell body fibre tracts entering the brain; this ultimately ensured that cell types present, for example, in one copy per brain hemisphere, were always annotated so that one neuron was identified as the left and the other the right. In a small number of cases, for example, for the bilaterally symmetric octopaminergic ventral unpaired medial neurons, we assigned side as ‘central’.

    For sensory neurons, side refers to whether they enter the brain through the left or the right nerve. In a small number of cases we could not unambiguously identify the nerve entry side and assigned side as ‘na’.

    Biological outliers and sample artefacts

    Throughout our proofreading, matching and cell typing efforts, we recorded cases of neurons that we considered to be biological outliers or showed signs of sample preparation and/or imaging artefacts.

    Biological outliers range from small additional/missing branches to entire misguided neurite tracks, and were typically assessed within the context of a given cell type and best possible contralateral matches within FlyWire and/or the hemibrain. When biological outliers were suspected, careful proofreading was undertaken to avoid erroneous merges or splits of neuron segmentation.

    Sample artefacts come in two flavours:

    (1) A small number of neurons exhibit a dark, almost black cytosol, which caused issues in the segmentation as well as synapse detection. This effect is often restricted to the neurons’ axons. We consider these sample artefacts because it is not always consistent within cell types. For example, the cytosol in the axons of DM3 adPN is dark on the left and normal light on the right. Because the dark cytosol leads to worse synapse detection, probably due to lower contrast between the cytosol and synaptic densities, we typically excluded neurons (or neuron types) with sample artefacts from connectivity analyses. Anecdotally, this appears to happen at a much higher frequency in sensory neurons compared with in brain-intrinsic neurons.

    (2) Some neurons are missing large arbours (for example, a whole axon or dendrite) because a main neurite suddenly ends and cannot be traced any further. This typically happens in commissures where many neurites co-fasculate to cross the brain’s midline. In some but not all cases, we were able to bridge those gaps and find the missing branch through left–right matching. Where neurons remained incomplete, we marked them as outliers.

    Whether a neuron represents a biological outlier or exhibits sample preparation/segmentation artefacts is recorded in the status column of our annotations as ‘outlier_bio’ and ‘outlier_seg’, respectively. Note that these annotations are probably less comprehensive for the optic lobes than for the central brain. Examples plus quantification are presented in Extended Data Fig. 5.

    Hierarchical annotations

    Hierarchical annotations include flow, superclass, class (plus a subclass field in certain cases) and cell type. The flow and superclass were generally assigned based on an initial semi-automated approach followed by extensive and iterative manual curation. See Supplementary Table 3 for definitions and the sections below for details on certain superclasses.

    Based on the superclasses we define two useful groupings which are used throughout the main text:

    Central brain neurons consist of all neurons with their somata in the central brain defined by the five superclasses: central, descending, visual centrifugal, motor and endocrine.

    Central brain associated neurons further include superclasses: visual projection neurons (VPNs), ascending neurons and sensory neurons (but omit sensory neurons with cell class: visual).

    Cell classes in the central brain represent salient groupings/terms that have been previously used in the literature (examples are provided in Supplementary Table 3). For sensory neurons, the class indicates their modality (where known). For optic-lobe-intrinsic neurons cell class indicates their neuropil innervation: for example, cell class ‘ME’ are medulla local neurons, ‘LA>ME’ are neurons projecting from the lamina to the medulla and ‘ME>LO.LOP’ are neurons projecting from the medulla to both lobula and lobula plate.

    Hemilineage annotations

    Central nervous system lineages were initially mapped for the third instar larval brain, where, for each lineage, the neuroblast of origin and its progeny are directly visible81,82,83,84. Genetic tools that allow stochastic clonal analysis85 have enabled researchers to visualize individual lineages as GFP-marked ‘clones’. Clones reveal the stereotyped morphological footprint of a lineage, its overall ‘projection envelope’32, as well as the cohesive fibre bundles—hemilineage-associated tracts (HATs)—formed by neurons belonging to it. Using these characteristics, lineages could be also identified in the embryo and early larva86,87, as well as in pupae and adults31,32,33,34,37,88. HATs can be readily identified in the EM image data, and we used them, in conjunction with clonal projection envelopes, to identify hemilineages in the EM dataset through a combination of the following methods:

    (1) Visual comparison of HATs formed by reconstructed neurons in the EM, and the light microscopy map reconstructed from anti-Neuroglian-labelled brains31,33,34. In cross-section, tracts typically appear as clusters of 50−100 tightly packed, rounded contours of uniform diameter (~200 nm), surrounded by neuronal cell bodies (when sectioned in the cortex) or irregularly shaped terminal neurite branches and synapses (when sectioned in the neuropil area; Fig. 2c). The point of entry and trajectory of a HAT in the neuropil is characteristic for a hemilineage.

    (2) Matching branching pattern of reconstructed neurons with the projection envelope of clones: as expected from the light microscopy map based on anti-Neuroglian-labelled brains31, the majority of hemilineage tracts visible in the EM dataset occur in pairs or small groups (3–5). Within these groups, individual tracts are often lined by fibres of larger (and more variable) diameter, as shown in Fig. 2c. However, the boundary between closely adjacent hemilineage tracts is often difficult to draw based on the EM image alone. In these cases, visual inspection and quantitative comparison of the reconstructed neurons belonging to a hemilineage tract with the projection envelope of the corresponding clone, which can be projected into the EM dataset through Pyroglancer (Table 1), assists in properly assigning neurons to their hemilineages.

    (3) Identifying homologous HATs across three different hemispheres (left and right of FlyWire, hemibrain): by comparison of morphology (NBLAST38), as well as connectivity (assuming that homologous neurons share synaptic partners), we were able to assign the large majority of neurons to specific HATs that matched in all three hemispheres.

    In the existing literature, two systems for hemilineage nomenclature are used: Ito/Lee33,34 and Hartenstein31,32. Although these systems overlap in large parts, some lineages have been described in only one but not the other nomenclature. In the main text, we provide (hemi)lineages according to the ItoLee nomenclature for simplicity. Below and in the Supplementary Information, we also provide both names as ItoLee/Hartenstein, and the mapping between the two nomenclatures is provided in Supplementary Data 3. From previous literature, we expected a total of around 119 lineages in the central brain, including the gnathal ganglia (GNG)31,32,33,34,84. Indeed, we were able to identify all 119 lineages based on light-level clones and tracts, as well as the HATs in FlyWire. Moreover, we found one lineage, LHp3/CP5, which could not be matched to any clone. Thus, together, we have identified 120 lineages.

    By comprehensively inspecting the hemilineage tracts originally in CATMAID and then in FlyWire, we can now reconcile previous reports. Specifically, new to refs. 33,34 (ItoLee nomenclature) are: CREl1/DALv3, LHp3/CP5, DILP/DILP, LALa1/BAlp2, SMPpm1/DPMm2 and VLPl5/BLVa3_or_4—we gave these neurons lineage names according to the naming scheme in refs. 33,34. New to ref. 31 (Hartenstein nomenclature) are: SLPal5/BLAd5, SLPav3/BLVa2a, LHl3/BLVa2b, SLPpl3/BLVa2c, PBp1/CM6, SLPpl2/CP6, SMPpd2/DPLc6, PSp1/DPMl2 and LHp3/CP5—we named these units according to the Hartenstein nomenclature naming scheme. We did not take the following clones from ref. 33 into account for the total count of lineages/hemilineages, because they originate in the optic lobe and their neuroblast of origin has not been clearly demonstrated in the larva: VPNd2, VPNd3, VPNd4, VPNp2, VPNp3, VPNp4, VPNv1, VPNv2 and VPNv3.

    Notably, although light-level clones from refs. 33,34 match very well the great majority of the time, sometimes clones with the same name only match partially. For example, the AOTUv1_ventral/DALcm2_ventral hemilineage seems to be missing in the AOTUv1/DALcm2 clone in the Ito collection33. There appears to be a similar situation for the DM4/CM4, EBa1/DALv2 and LHl3/BLVa2b lineages. When there is a conflict, we have preferred clones as described in ref. 34.

    For calculating the total number of hemilineages, to keep the inclusion criteria consistent with the lineages, we included the type II lineages (DL1-2/CP2-3, DM1-6/DPMm1, DPMpm1, DPMpm2, CM4, CM1, CM3) by counting the number of cell body fibre tracts, acknowledging that they may or may not be hemilineages. Neuroblasts of type II lineages, instead of generating ganglion mother cells that each divide once, amplify their number, generating multiple intermediate progenitors that in turn continue dividing like neuroblasts28,89,90. It has not been established how the tracts visible in type II clones (and included in Extended Data Fig. 3 and Supplementary Data 3 and 4) relate to the (large number of) type II hemilineages.

    There are also 3 type I lineages (VPNl&d1/BLAl2, VLPl2/BLAv2 and VLPp&l1/DPLpv) with more than two tracts in the clone; we included these additional tracts in the hemilineages provided in the text. Without taking these type I and type II tracts into account, we identified 141 hemilineages.

    A minority of neurons in the central brain could not reliably be assigned to a lineage. These mainly include the (putative) primary neurons (3,780). Primary neurons, born in the embryo and already differentiated in the larva, form small tracts with which the secondary neurons become closely associated91. In the adult brain, morphological criteria that unambiguously differentiate between primary and secondary neurons have not yet been established. In cases in which experimental evidence exists27, primary neurons have significantly larger cell bodies and cell body fibres. Loosely taking these criteria into account we surmise that a fraction of primary neurons forms part of the HATs defined as described above. However, aside from the HATs, we see multiple small bundles, typically close to but not contiguous with the HATs, which we assume to consist of primary neurons. Overall, these small bundles contained 3,780 neurons, designated as primary or putative primary neurons.

    Hemilineage annotations in hemibrain

    Hemilineage annotations in hemibrain were generated using the hemilineage annotations in FlyWire as the ground truth. For each hemilineage, we first obtained potential hemibrain matches to FlyWire neurons using a combination of NBLAST38 scores and cell body fibre/cell type annotations. We then clustered neurons in all three hemispheres (FlyWire left, FlyWire right, hemibrain potential candidates) by morphology, and went through the clusters, to make sure that the hemilineage annotations correspond across brains at the finest level possible. To ensure that no neurons within a hemilineage were missed, we examined the cell body fibre bundles of each hemilineage in the hemibrain at the EM level. To further guarantee the completeness of hemilineage annotations, we inventoried all right hemisphere neurons in hemibrain with a cell type annotation, to ensure all neurons with a type annotation were assigned a hemilineage annotation where possible.

    Morphological groups

    Within a hemilineage, subgroups of neurons often share distinctive morphological characteristics. These morphological groups were identified for all hemilineages as follows. Neurons from FlyWire and hemibrain were transformed into the same hemisphere and pairwise NBLAST scores were generated for all neurons within a hemilineage. Intrahemilineage NBLAST scores were then clustered using HDBSCAN92, an adaptive algorithm that does not require a uniform threshold across all clusters, and that does not assume spherical distribution of data points in a cluster, compared to other clustering algorithms such as k-means clustering.

    To test the robustness of the morphological groups, we reran the above analysis across one, two or three hemispheres. This treatment sometimes gave slightly different results. However, some groups of neurons consistently co-clustered across the different hemispheres; we termed these ‘persistent clusters’. Early-born neurons, which are often morphologically unique, frequently failed to participate in persistent clusters, and were omitted from further analysis. We linked these persistent clusters across hemispheres using two- and three-hemisphere clustering: for example, when clustering FlyWire left and FlyWire right together for hemilineage AOTUv3_dorsal, the TuBu neurons from both the left and right hemispheres would fall into one cluster, which we termed a morphological group. Morphological groups are therefore defined by consistent across-hemisphere clustering. When neurons of a given hemilineage were sufficiently contained by the hemibrain volume, all three hemispheres (two from FlyWire and one from hemibrain) were used; otherwise, the two hemispheres from FlyWire were used. As we prioritized consistency across 1, 2 and 3 hemisphere clustering, a minority of neurons with a hemilineage annotation do not have a morphological group. For example, if neuron type A clusters with type B in one-hemisphere clustering, but clusters with type C (and not B) in two-hemisphere clustering, then type A will not have a morphological group annotation.

    After generating the morphological groups, we cross-checked these annotations against existing cross-identified hemibrain types and (FlyWire only) cell types. In a minority of cases, neurons of one hemibrain/cell type were annotated with multiple morphological groups. This occasionally reflected errors in assigning types, which were corrected; and others where individual neurons from a type were singled out due to additional branches/reconstruction issues. We therefore manually corrected some morphological group annotations to make them correspond maximally with the hemibrain/cell type annotations.

    Overall, we divide hemilineages in each hemisphere into 528 morphological groups, with hemilineages typically having 1–6 morphological groups (10/90 quantile) and with each morphological group containing 2–52 neurons in each hemisphere (10/90 quantile).

    Cell typing

    Using methods described in detail in the sections below, we defined cell types for 96.4% of all neurons in the brain—98% and 92% for the central brain and optic lobes, respectively. The remaining 3.6% of neurons were largely (1) optic lobe local neurons for which we could not find a prior in existing literature or (2) neurons without clear contralateral pairings, including a number of neurons on the midline.

    About 21% of our cell type annotations are principally derived from the hemibrain cell type matching effort (see the section below). The remainder was generated either by comparing to existing literature (for example, in case of optic lobe cell types or sensory neurons) and/or by finding left/right balanced clusters through a combination of NBLAST and connectivity clustering (Fig. 6 and Extended Data Figs. 8 and 9). New types were given a simple numerical cross-brain identifier (for example, CB0001) or, in the case of ascending neurons (ANs)/descending neurons(DNs), a more descriptive identifier (see the section below) as a provisional cell type label. A flow chart summary is provided in Extended Data Fig. 12.

    For provenance, we provide two columns of cell types in our Supplementary Data:

    hemibrain_type always refers to one or more hemibrain cell types; in rare occasions where a matched hemibrain neuron did not have a type, we recorded body IDs instead.

    cell_type contains types that are either not derived from the hemibrain or that represent refinements (for example, a split or retyping) of hemibrain types.

    Neurons can have both a cell_type and a hemibrain_type entry, in which case, the cell_type represents a refinement or correction and should take precedence. This generates the reported total count of 8,453 terminal cell types and includes 3,643 hemibrain-derived cell types (Fig. 3h (right side of the flow chart)) and 4,581 proposals for new types. New types consist of 3,504 CBXXXX types, 65 new visual centrifugal neuron types (‘c’ prefix, for example, cL08), 173 new VPN types (‘e’ suffix, for example, LTe07), 602 new AN types (‘AN_’ or ‘SA_’ prefix, for example, AN_SMP_1) and 237 new DN types (‘e’ suffix, for example, DNge094). The remaining 229 types are cell types known from other literature, for example, columnar cell types of the optic lobes.

    Hemibrain cell type matching

    We first used NBLAST38 to match FlyWire neurons to hemibrain cell types (see ‘Morphological comparisons’ section). From the NBLAST scores, we extracted, for each FlyWire neuron, a list of potential cell type hits using all hits in the 90th percentile. Individual FlyWire neurons were co-visualized with their potential hits in neuroglancer (see the ‘Data availability’ and ‘Code availability’ sections) and the correct hit (if found) was recorded. In difficult cases, we would also inspect the subtree of the NBLAST dendrograms containing the neurons in questions to include local cluster structure in the decision making (Extended Data Fig. 4e). In cases in which two or more hemibrain cell types could not be cleanly delineated in FlyWire (that is, there were no corresponding separable clusters) we recorded composite (many:1) type matches (Fig. 3i and Extended Data Figs. 4g and 12).

    When a matched type was either missing large parts of its arbours due to truncation in the hemibrain or the comparison with the FlyWire matches suggested closer inspection was required, we used cross-brain connectivity comparisons (see the section below) to decide whether to adjust (split or merge) the type. A merge of two or more hemibrain types was recorded as, for example, SIP078,SIP080, while a split would be recorded as PS090a and PS090b (that is, with a lower-case letter as a suffix). In rare cases in which we were able to find a match for an untyped hemibrain neuron, we would record the hemibrain body ID as hemibrain type and assign a CBXXXX identifier as cell type.

    Finally, the hemibrain introduced the concept of morphology types and ‘connectivity types’2. The latter represent refinements of the former and differ only in their connectivity. For example, morphology type SAD051 splits into two connectivity types: SAD051_a and SAD051_b, for which the _{letter} indicates that these are connectivity types. Throughout our FlyWire↔hemibrain matching efforts we found connectivity types hard to reproduce and our default approach was to match only up to the morphology type. In some cases, for example, antennal lobe local neuron types like lLN2P_a and lLN2P_b, we were able to find the corresponding neurons in FlyWire.

    Note that, in numerous cases that we reviewed but remain unmatched, we encountered what we call ambiguous ‘daisy-chains’: imagine four fairly similar cell types, A, B, C and D. Often these adjacent cell types represent a spectrum of morphologies where A is similar to B, B is similar to C and C is similar to D. The problem now is in unambiguously telling A from B, B from C and C from D. But, at the same time, A and D (on the opposite ends of the spectrum) are so dissimilar that we would not expect to assign them the same cell type (Fig. 3k and Extended Data Fig. 4h). These kinds of graded or continuous variation have been observed in a number of locations in the mammalian nervous system and represent one of the classic complications of cell typing18. Absent other compelling information that can clearly separate these groups, the only reasonable option would seem to be to lump them together. As this would erase numerous proposed hemibrain cell types, the de facto standard for the fly brain, we have been conservative about making these changes pending analysis of additional connectome data2.

    Hemibrain cell type matching with connectivity

    In our hemibrain type matching efforts, about 12% of cell types could not be matched 1:1. In these cases, we used across-dataset connectivity clustering (for example, to confirm the split of a hemibrain type or a merger of multiple cell types). To generate distances, we first produced separate adjacency matrices for each of the three hemispheres (FlyWire left, right and hemibrain). In these matrices, each row is a query neuron and each column is an up- or downstream cell type; the values are the connection weights (that is, number of synapses). We then combine the three matrices along the first axis (rows) and retain only the cell types (columns) that have been cross-identified in all hemispheres. From the resulting observation vector, we calculate a pairwise cosine distance. It is important to note that this connectivity clustering depends absolutely on the existence of a corpus of shared labels between the two datasets—without such shared labels, which were initially defined by morphological matching as described above, connectivity matching cannot function.

    This pipeline is implemented in the coconatfly package (Table 1), which provides a streamlined interface to carry out such clustering. For example the following command can be used to see if the types given to a selection of neurons in the Lateral Accessory Lobe (LAL) are robust:

    cf_cosine_plot(cf_ids(‘/type:LAL0(08|09|10|42)’, datasets=c(“flywire”, “hemibrain”)))

    .

    An optional interactive mode allows for efficient exploration within a web browser. For further details and examples, see https://natverse.org/coconatfly/.

    Defining robust cross-brain cell types

    In Fig. 6, we used two kinds of distance metrics—one calculated from connectivity alone (used for FC1–3; Fig. 6e–g) and a second combining morphology + connectivity (used for FB1–9; Fig. 6h and Extended Data Fig. 8b–f) to help define robust cross-brain cell types. The connectivity distance is as described in the ‘Hemibrain cell type matching with connectivity’ section above). We note that the central complex retyping used FlyWire connectivity from the 630 release. The combined morphology + connectivity distances were generated by taking the sum of the connectivity and NBLAST distances. Connectivity-only works well in the case of cell types that do not overlap in space but instead tile a neuropil. For cell types that are expected to overlap in space, we find that adding NBLAST distances is a useful constraint to avoid mixing of otherwise clearly different types. From the distances, we generated a dendrogram representation using the Ward algorithm and then extracted the smallest possible clusters that satisfy two criteria: (1) each cluster must contain neurons from all three hemispheres (hemibrain, FlyWire right and FlyWire left); (2) within each cluster, the number of neurons from each hemisphere must be approximately equal.

    We call such clusters ‘balanced’. The resulting groups were then manually reviewed.

    Defining new provisional cell types

    After the hemibrain type matching effort, around 40% of central brain neurons remained untyped. This included both neurons mostly or entirely outside the hemibrain volume (for example, from the GNG) but also neurons for which the potential hemibrain type matches were too ambiguous. To provide provisional cell types for these neurons, we ran the same cell typing pipeline described in the ‘Defining robust cross-brain cell types’ section above on the two hemispheres of FlyWire alone. In brief, we produced a morphology + connectivity co-clustering for each individual hemilineage (neurons without a hemilineage such as putative primary neurons were clustered separately) and extracted ‘balanced’ clusters, which were manually reviewed (Fig. 6i,j and Extended Data Fig. 9). Reviewed clusters were then used to add new or refine existing cell and hemibrain types:

    • Clusters consisting entirely of previously untyped neurons were given a provisional CBXXXX cell type.

    • Clusters containing a mix of hemibrain-typed and untyped neurons typically meant that, after further investigation, the untyped neurons were given the same hemibrain type.

    • Hemibrain types split across multiple clusters were double checked (for example, by running a triple-hemisphere connectivity clustering), which often led to a split of the hemibrain type; for example, SMP408 was split into SMP408a–d.

    • In rare cases, clusters contained a mix of two or more hemibrain types; these were double checked and the hemibrain types corrected (for example, by merging two or more hemibrain types, or by removing hemibrain type labels).

    To validate a subset of the new, provisional cell types, we re-ran the clustering using three hemispheres (FlyWire + hemibrain) on 25 cross-identified hemilineages that are not truncated in the hemibrain (Extended Data Fig. 9). The procedure was otherwise the same as for the double-clustering.

    Optic lobe cell typing

    We provide cell type annotations for >92% of neurons in both optic lobes. The vast majority of these types are based on previous literature42,93,94,95,96,97,98,99. We started the typing effort by annotating well-known large tangential cells (for example, Am1 or LPi12), VPNs (for example, LT1s) as well as photoreceptor neurons. From there, we followed two general strategies, sometimes in combination: (1) for neurons with known connectivity fingerprints, we specifically hunted upstream or downstream of neurons of interest (for example, looking for T4a neurons upstream of LPi12). (2) We ran connectivity clustering as described above on both optic lobes combined. Clusters were manually reviewed and matched against literature. This was done iteratively; with each round adding new or refining existing cell types to inform the next round of clustering. Clusters that we could not confidently match against a previously described cell type were assigned a provisional (CBXXXX) type.

    This effort was carried out independently of other FlyWire optic lobe intrinsic neuron typing, including ref. 23; the sole exception was the Mi1 cell type, which was initially based on annotations reported previously100 and then reviewed. For this reason ref. 100 should be cited for the Mi1 annotations. Note that our typing focuses on previously reported cell types rather than defining new ones, but covers both optic lobes to enable accurate typing of visual project neurons (by defining their key inputs). For the 38,461 neurons of the right optic lobe (for which a comparison is possible), we report 156 cell types for 35,567 neurons compared with 229 cell types for 37,345 neurons in ref. 23.

    VPNs and VCNs

    Similar to cell typing in the central brain, a significant proportion of VPN (61%) and visual centrifugal neuron (VCN) (60%) types are derived from the hemibrain (see the ‘Hemibrain cell type matching’ section). These annotations are listed in the hemibrain_type column in the Supplementary Data.

    To assign cell types to the remaining neurons and in some cases also to refine existing hemibrain types, we ran a double-hemisphere (FlyWire left–right) co-clustering. For VCNs, this was done as part of the per-hemilineage morphology-connectivity clustering described in the ‘Defining new provisional cell types’ section above. For VPNs of which the dendrites typically tile the optic neuropils, we generated and reviewed a separate connectivity-only clustering on all VPNs together. Groups extracted from this clustering were also cross-referenced with new literature from parallel typing efforts100,101 and those new cell type names were preferred for the convenience of the research community. In cases in which literature references could not be found, systematic names were generated de novo using the schemata below.

    For VPNs the nomenclature follows the format [neuropil][C/T][e][XX], where neuropil refers to regions innervated by VPN dendrites; C/T denotes columnar versus tangential organization; e indicates identification through EM; and XX represents a zero padded two digit number.

    For example: ‘MTe47’ for ‘medulla-tangential 47’.

    For VCNs, the nomenclature follows the format [c][neuropil][XX], where c denotes centrifugal; neuropil refers to regions innervated by VCN axons; and XX represents a zero padded two digit number.

    For example, ‘cM12’ for ‘centrifugal medulla-targeting 12’.

    Note that new names were also given to non-canonical, generic hemibrain types, such as IB006. All new names are recorded in the cell_type column in the Supplementary Data.

    The majority of VPNs (99.6%) and VCNs (98.3%) were assigned to specific types. Only 29 VPNs and 9 VCNs could not be confidently assigned a cell type and were therefore left untyped.

    Sensory and motor neurons

    We identified all non-visual sensory and motor neurons entering/exiting the brain through the antennal, eye, occipital and labial nerves by screening all axon profiles in a given nerve.

    Sensory neurons were further cross-referenced to existing literature to assign modalities (through the class field) and, where applicable, a cell type. Previous studies have identified almost all head mechanosensory bristle and taste peg mechanosensory neurons102 in the left hemisphere (at the time of publication: right hemisphere). Gustatory sensory neurons were previously identified in ref. 103 and Johnston’s organ neurons in refs. 104,105 in a version of the FAFB that used manual reconstruction (https://fafb.catmaid.virtualflybrain.org). Those neurons were identified in the FlyWire instance by transformation and overlay onto FlyWire space as described previously102.

    Johnston’s organ neurons in the right hemisphere were characterized based on innervation of the major AMMC zones (A, B, C, D, E and F), but not further classified into subzone innervation as shown previously104. Other sensory neurons (mechanosensory bristle neurons, taste peg mechanosensory neurons and gustatory sensory neurons) in the right hemisphere were identified through NBLAST-based matching of their mirrored morphology to the left hemisphere and expert review. Olfactory, thermosensory and hygrosensory neurons of the antennal lobes were identified through their connectivity to cognate uniglomerular projection neurons and NBLAST-based matching to previously identified hemibrain neurons40,106.

    Visual sensory neurons (R1–6, R7–8 and ocellar photoreceptor neurons) were identified by manually screening neurons with pre-synapse in either the lamina, the medulla and/or the ocellar ganglia93.

    ANs and DNs

    We seeded all profiles in a cross-section in the ventral posterior GNG through the cervical connective to identify all neurons entering and exiting the brain at the neck. We identified all DNs based on the following criteria: (1) soma located within the brain dataset; and (2) main axon branch leaving the brain through the cervical connective.

    We next classified the DNs based on their soma location according to a previous report107. In brief, the soma of DNa, DNb, DNc and DNd is located in the anterior half (a, anterior dorsal; b, anterior ventral; c, in the pars intercerebralis; d, outside cell cluster on the surface) and DNp in the posterior half of the central brain. DNg somas are located in the GNG.

    To identify DNs described in ref. 107 in the EM dataset, we transformed the volume renderings of DN GAL4 lines into FlyWire space. Displaying EM and LM neurons in the same space enabled accurate matching of closely morphologically related neurons. For DNs without available volume renderings, we identified candidate EM matches by eye, transformed them into JRC2018U space and overlaid them onto the GAL4 or Split GAL4 line stacks (named in ref. 107 for that type) in FIJI for verification. Using these methods, we identified all but two (DNd01 and DNg25) in FAFB/FlyWire and annotated their cell type with the published nomenclature. All other unmatched DNs received a systematic cell type consisting of their soma location, an ‘e’ for EM type and a three digit number (for example, DNae001). A detailed account and analysis of DNs has been published108 separately.

    ANs were identified based on the following criteria: (1) no soma in the brain; and (2) main branch entering through the neck connective (note that some ANs make a dendrite after entry through the neck connective and then an axon).

    To distinguish sensory ascending (SA) neurons from ANs, we analysed SA neuron morphology in the male VNC dataset MANC109,110. First, we identified which longitudinal tract they travel to ascend to the brain111 and then found GAL4 lines matching their VNC morphology. We next identified putative matching axons in the brain dataset by morphology and tract membership. A detailed description of this process and the lines used has been published separately108.

    FAFB laterality

    In the fly brain, the asymmetric body is reproducibly around 4 times larger on the right hemisphere than on the left112,113,114, except in rare cases of situs inversus114,115. However, completion of the FlyWire whole-brain connectome and associated cell typing showed the asymmetric body to be larger on the apparent left side of the brain rather than the right, suggesting an inversion of the left–right axis during initial acquisition of EM images comprising the FAFB dataset17. This hypothesis was confirmed by comparing of FAFB sample grids imaged using differential interference contrast microscopy to low-magnification views of corresponding EM image mosaics using CATMAID or neuroglancer. Grids were chosen with particularly obvious staining and sample preparation artefacts visible both in the differential interference contrast and low-magnification EM images (Extended Data Fig. 1), confirming that a left–right axis inversion had taken place during image acquisition.

    Owing to the extensive post-processing of the FAFB dataset and derived datasets (for example, transformation fields, image mosaicing and stack registrations to produce aligned volumes, segmentation supervoxels, proofread neuron segmentations, skeletons, meshes and myriad 3D visualizations), which had been undertaken at the time at which this error was discovered, we deemed it impractical to correct this error at the raw data level. Instead, we break a convention of presentation: usually, frontal views of the fly brain place the fly’s right on the viewer’s left. Instead, in this paper, frontal views of the fly brain place the fly’s right on the viewer’s right—similar to the view one has of oneself while looking in a mirror. This maintains consistency with past publications. However, note that all labels of left and right in the figures in this paper, our companion papers, the supplemental annotations and associated digital repositories (for example, https://codex.flywire.ai, FAFB/FlyWire CATMAID) have been corrected to reflect the error during data acquisition. In these resources, a neuron labelled as being on the left is indeed on the left of the fly’s brain.

    For consistency with visualizations and datasets obeying the standard convention (fly’s right on viewer’s left), FlyWire data can be mirrored. To facilitate this, we provide tools to digitally mirror FAFB-FlyWire data using the Python flybrains (https://github.com/navis-org/navis-flybrains) or natverse nat.jrcbrains (https://github.com/natverse/nat.jrcbrains) packages (Extended Data Fig. 1c), through the

    navis.mirror_brain()

    and

    nat.jrcbrains::mirror_fafb()

    function calls, respectively. See the fafbseg-py documentation for a tutorial on mirroring.

    We also provide a neuroglancer scene in which both FlyWire and hemibrain data are displayed in the correct orientation: https://tinyurl.com/flywirehbflip783. In this scene, a frontal view has both FAFB and hemibrain RHS to the left of the screen, obeying the standard convention. The scene displays the SA1 and SA2 neurons, which target the right asymmetric body for both FlyWire and the hemibrain, confirming that the RHS for both datasets has been superimposed (compare with Extended Data Fig. 1a).

    Morphological comparisons

    Throughout our analyses, NBLAST38 was used to generate morphological similarity scores between neurons—for example, for matching neurons between the FlyWire and the hemibrain datasets, or for the morphological clustering of the hemilineages. In brief, NBLAST treats neurons as point clouds with associated tangent vectors describing directionality, so called dotprops. For a given query→target neuron pair, we perform a k-nearest neighbours search between the two point clouds and score each nearest-neighbour pair by their distance and the dot product of their vector. These are then summed up to compute the final query→target NBLAST score. It is important to note that direction of the NBLAST matters, that is, NBLASTing neurons A→B≠B→A. Unless otherwise noted, we use the minimum between the forward and reverse NBLAST scores.

    The NBLAST algorithm is implemented in both navis and the natverse (Table 1). However, we modified the navis implementation for more efficient parallel computation in order to scale to pools of more than 100,000 neurons. For example, the all-by-all NBLAST matrix for the full 139,000 FlyWire neurons alone occupies over 500 GB of memory (32 bit floats). Most of the large NBLASTs were run on a single cluster node with 112 CPUs and 1 TB RAM provided by the MRC LMB Scientific Computing group, and took between 1 and 2 days (wall time) to complete.

    Below, we provide recipes for the different NBLAST analyses used in this paper:

    FlyWire all-by-all NBLAST

    For this NBLAST, we first generated skeletons using the L2 cache. In brief, underlying the FlyWire segmentation is an octree data structure where level 0 represents supervoxels, which are then agglomerated over higher levels116. The second layer (L2) in this octree represents neurons as chunks of roughly 4 × 4 × 10 μm in size, which is sufficiently detailed for NBLAST. The L2 cache holds precomputed information for each L2 chunk, including a representative x/y/z coordinate in space. We used the x/y/z coordinates and connectivity between chunks to generate skeletons for all FlyWire neurons (implemented in fafbseg; Table 1). Skeletons were then pruned to remove side branches smaller than 5 μm. From those skeletons, we generated the dotprops for NBLAST using navis.

    Before the NBLAST, we additionally transformed dotprops to the same side by mirroring those from neurons with side right onto the left. The NBLAST was then run only in forward direction (query→target) but, because the resulting matrix was symmetrical, we could generate minimum NBLAST scores using the transposed matrix: min(A + AT).

    This NBLAST was used to find left–right neuron pairs, define (hemi)lineages and run the morphology group clustering.

    FlyWire—hemibrain NBLAST

    For FlyWire, we re-used the dotprops generated for the all-by-all NBLAST (see the previous section). To account for the truncation of neurons in the hemibrain volume, we removed points that fell outside the hemibrain bounding box.

    For the hemibrain, we downloaded skeletons for all neurons from neuPrint (https://neuprint.janelia.org) using neuprint-python and navis (Table 1). In addition to the approximately 23,000 typed neurons, we also included all untyped neurons (often just fragments) for a total of 98,000 skeletons. These skeletons were pruned to remove twigs smaller than 5 μm and then transformed from hemibrain into FlyWire (FAFB14.1) space using a combination of non-rigid transforms116,117 (implemented through navis, navis-flybrain and fafbseg; Table 1). Once in FlyWire space, they were resampled to 0.5 nodes per μm of cable to approximately match the resolution of the FlyWire L2 skeletons, and then turned into dotprops. The NBLAST was then run both in forward (FlyWire to hemibrain) and reverse (hemibrain to FlyWire) direction and the minimum between both were used.

    This NBLAST allowed us to match FlyWire left against the hemibrain neurons. To also allow matching FlyWire right against the hemibrain, we performed a second run after mirroring the FlyWire dotprops to the opposite side.

    In Fig. 3c,d, we manually reviewed NBLAST matches. For this, we sorted hemibrain neurons based on their highest NBLAST score to a FlyWire neuron into bins with a width of 0.1. From each bin, we picked 30 random hemibrain neurons (except for bin 0–0.1 which contained only 27 neurons in total) and scored their top five FlyWire matches as to whether a plausible match was among them. In total, this sample contained 237 neurons.

    Cross-brain co-clustering

    The pipeline for the morphology-based across brain co-clustering used in Fig. 6 and Extended Data Fig. 9 was essentially the same as for the FlyWire–hemibrain NBLAST with two exceptions: (1) we used high-resolution FlyWire skeletons instead of the coarser L2 skeletons (see below); and (2) both FlyWire and hemibrain skeletons were resampled to 1 node per μm before generating dotprops.

    High-resolution skeletonization

    In addition to the coarse L2 skeletons, we also generated high-resolution skeletons that were, for example, used to calculate the total length of neuronal cable reported in our companion paper1 (149.2 m). In brief, we downloaded neuron meshes (LOD 1) from the flat 783 segmentation (available at gs://flywire_v141_m783) and skeletonized them using the wavefront method implemented in skeletor (https://github.com/navis-org/skeletor). Skeletons were then rerooted to their soma (if applicable), smoothed (by removing small artifactual bristles on the backbone), healed (segmentation issues can cause breaks in the meshes) and slightly downsampled. A modified version of this pipeline is implemented in fafbseg. Skeletons are available for download (see the ‘Data availability’ and ‘Code availability’ sections).

    Connectivity normalization

    Throughout this paper, the basic measure of connection strength is the number of unitary synapses between two or more neurons79; connections between adult fly neurons can reach thousands of such unitary synapses2. Previous work in larval Drosophila has indicated that synaptic counts approximate contact area118, which is most commonly used in mammalian species when a high-resolution measure of anatomical connection strength is required. Connectomics studies also routinely use connection strength normalized to the target cell’s total inputs71,79. For example, if neurons i and j are connected by 10 synapses and neuron j receives 200 inputs in total, the normalized connection weight i to j would be 5%. A previous study119 showed that while absolute number of synapses for a given connection changes drastically over the course of larval stages, the proportional (that is, normalized) input to the downstream neuron remains relatively constant119. Importantly, we have some evidence (Fig. 4g) that normalized connection weights are robust against technical noise (differences in reconstruction status, synapse detection). Note that, for analyses of mushroom body circuits, we use an approach based on the fraction of the input or output synaptic budget associated with different KC cell types; this differs slightly from the above definition and will be detailed in a separate section below.

    Connectivity stereotypy analyses

    For analyses on connectivity stereotypy (Fig. 4 and Extended Data Fig. 6) we excluded a number of cell types:

    • KCs, due to the high variability in numbers and synapse densities in the mushroom body lobes between FlyWire and the hemibrain (Fig. 5 and Extended Data Fig. 7).

    • Cell types that exist only on the left but not the right hemisphere of the hemibrain because our comparison was principally against the right hemisphere.

    • Antennal lobe receptor neurons, because truncation/fragmentation in the hemibrain causes some ambiguity with respect to their side annotation.

    • Cell types with members that have been marked as being affected by sample or imaging artefacts (that is, status ‘outlier_seg’).

    • VPNs, as they are heavily truncated in the hemibrain.

    Among the remaining types, we used only the 1:1 and 1:many but not the many:1 matches. Taken together, we used 2,954 (hemibrain) types for the connectivity stereotypy analyses.

    Availability through CATMAID Spaces

    To increase the accessibility and reach of the annotated FlyWire connectome, meshes of proofread FlyWire neurons and synapses were skeletonized and imported into CATMAID, a widely used web-based tool for collaborative tracing, annotation and analysis of large-scale neuronal anatomy datasets79,120 (https://catmaid.org; Extended Data Fig. 10). Spatial annotations like skeletons are modelled using PostGIS data types, a PostgreSQL extension that is popular in the geographic information system community. This enables us to reuse many existing tools to work with large spatial datasets, for example, indexes, spatial queries and mesh representation.

    A publicly available version of the FlyWire CATMAID project is available online (https://fafb-flywire.catmaid.org). This project uses a new extension, called CATMAID Spaces (https://catmaid.org/en/latest/spaces.html), which allows users to create and administer their own tracing and annotation environments on top of publicly available neuronal image volumes and connectomic datasets. Moreover, users can now login through the public authentication service ORCiD (https://www.orcid.org), so that everyone can log-in on public CATMAID projects. Users can also now create personal copies (Spaces) of public projects. The user then becomes an administrator, and can invite other users, along with the management of their permissions in this new project. Invitations are managed through project tokens, which the administrator can generate and send to invitees for access to the project. Both CATMAID platforms can talk to each other and it is possible to load data from the dedicated FAFB-FlyWire server in the more general Spaces environment.

    Metadata annotations for each neuron (root id, cell type, hemilineage, neurotransmitter) were imported for FlyWire project release 783. Skeletons for all 139,255 proofread neurons were generated from the volumetric meshes (see the ‘High-resolution skeletonization’ section) and imported into CATMAID, resulting in 726,831,877 treenodes. To reduce the import time, skeletons were imported into CATMAID directly as database inserts through SQL, rather than through public RESTful APIs. FlyWire root IDs are available as metadata for each neuron, facilitating interchange with related resources such as FlyWire Codex1. Synapses attached to reconstructed neurons were imported as CATMAID connector objects and attached to neuron skeletons by doing a PostgreSQL query to find the nearest node on each of the partner skeletons. Connector objects were linked to postsynaptic partners only if the downstream neuron was in the proofread data release (180,016,288 connections from the 130,054,535 synapses with at least one partner in the proofread set).

    Synapse counts

    Insect synapses are polyadic, that is, each presynaptic site can be associated with multiple postsynaptic sites. In contrast to the Janelia hemibrain dataset, the synapse predictions used in FlyWire do not have a concept of a unitary presynaptic site associated with a T-bar46. Thus, pre-synapse counts used in this paper do not represent the number of presynaptic sites but rather the number of outgoing connections.

    In Drosophila connectomes, reported counts of the inputs (post-synapses) onto a given neuron are typically lower than the true number. This is because fine-calibre dendritic fragments frequently cannot be joined onto the rest of the neuron, instead remaining as free-floating fragments in the dataset.

    Technical noise model

    To model the impact of technical noise such as proofreading status and synapse detection on connectivity, we first generated a fictive ‘100%’ ground-truth connectivity. We took the connectivity between cell-typed left FlyWire neurons and scaled each edge weight (the number of synapses) by the postsynaptic completion rates in the respective neuropil. For example, all edge weights in the left mushroom body calyx (CA), which has a postsynaptic completion rate of 52.5%, were scaled by a factor of 100/52.5 = 1.9.

    In the second step, we simulated the proofreading process by randomly drawing (without replacement) individual synaptic connections from the fictive ground-truth until reaching a target completion rate. We further simulate the impact of false positives and false negatives by randomly adding and removing synapses to/from the draw according to the precision (0.72) and recall (0.77) rates reported previously46. In each round, we made two draws: (1) A draw using the original per-neuropil postsynaptic completion rates; and (2) a draw where we flip the completion rates for left and right neuropils, that is, use the left CA completion rate for the right CA and vice versa.

    In each of the 500 rounds that we ran, we drew two weights for each edge. Both stem from the same fictive 100% ground-truth connectivity but have been drawn according to the differences in left versus right hemisphere completion rates. Combining these values, we calculated the mean difference and quantiles as function of the weight for the FlyWire left (that is, the draw that was not flipped) (Fig. 4i). We focussed this analysis on edge weights between 1 and 30 synapses because the frequency of edges stronger than that is comparatively low, leaving gaps in the data.

    KC analyses

    Connection weight normalization and synaptic budget analysis

    When normalizing connection weights, we typically convert them to the percentage of total input onto a given target cell (or cell type). However, in the case of the mushroom body, the situation is complicated by what we think is a technical bias in the synapse detection methods used for the two connectomes that causes certain kinds of unusual connections to be very different in frequency between the two datasets. We find that the total number of post-synapses as well as the post-synapse density in the mushroom body lobes are more than doubled in the hemibrain compared with in FlyWire (Extended Data Fig. 7b,c). This appears to be explained by certain connections (especially KC to KC connections, which are predominantly arranged with an unusual rosette configuration along axons and of which the functional significance is poorly understood121) being much more prevalent in the hemibrain than in FlyWire (Extended Data Fig. 7d). Some other neurons, including the APL giant interneuron, also make about twice as many synapses onto KCs in the hemibrain compared with in FlyWire (Extended Data Fig. 7a). As a consequence of this large number of inputs onto KC axons in the hemibrain, input percentages from all other cells are reduced in comparison with FlyWire.

    To avoid this bias, and because our main goal in the KC analysis was to compare different populations of KCs, we instead expressed connectivity as a fraction of the total synaptic budget for upstream or downstream cell types. For example, we examined the fraction of the APL output that is spent on each of the different KC types. Similarly, we quantified connectivity for individual KCs as a fraction of the budget for the whole KC population.

    Calculating K from observed connectivity

    Calculation of K, that is, the number of unique odour channels that each KC receives input from, was principally based on their synaptic connectivity. For this, we looked at their inputs from uniglomerular ALPNs and examined from how many of the 58 antennal lobe glomeruli does a KC receive input from. K as reported in Fig. 6 is based on non-thresholded connectivity. Filtering out weak connections does lower K but, importantly, our observations (for example, that KCg-m cells have a lower K in FlyWire than in the hemibrain) are stable across thresholds (Extended Data Fig. 7g).

    KC model

    A simple rate model of neural networks122 was used to generate the theoretical predictions of K, the number of ALPN inputs that each KC receives (Fig. 5k). KC activity is modelled by

    $${\bf{h}}={\bf{W}}\cdot {{\bf{r}}}_{{\rm{P}}{\rm{N}}},$$

    where h is a vector of length M representing KC activity, \({\bf{W}}\) is an M × N matrix representing the synaptic weights between the KCs and PNs, rPN is a vector of length N representing PN activity. The number of KCs and ALPNs is denoted by M and N, respectively. In this model, the PN activity is assumed to have zero mean, \({\bar{{\bf{r}}}}_{{\rm{P}}{\rm{N}}}=0\), and be uncorrelated, \(\bar{{{\bf{r}}}_{{\rm{P}}{\rm{N}}}\cdot {{\bf{r}}}_{{\rm{P}}{\rm{N}}}}={{\bf{I}}}_{N}\). Here, \({{\bf{I}}}_{N}\) is an N × N identity matrix and \({\bar{{\bf{r}}}}_{{\rm{P}}{\rm{N}}}\) denotes the average taken over independent realizations of \({{\bf{r}}}_{{\rm{P}}{\rm{N}}}\). Then, the ijth element of the covariance matrix of h is

    $$[{\bf{C}}{]}_{ij}=\bar{{[{\bf{h}}]}_{i}{[{\bf{h}}]}_{j}}=\mathop{\sum }\limits_{k=0}^{N}[{\bf{W}}{]}_{ik}{[{\bf{W}}]}_{jk}.$$

    More detailed calculations can be found in a previous report122. Randomized and homogeneous weights were used to populate \({\bf{W}}\), such that each row in \({\bf{W}}\) has K elements that are 1 − α and N − K elements that are −α. The parameter α represents a homogeneous inhibition corresponding to the biological, global inhibition by APL. The value inhibition was set to be α = A/M, where A = 100 is an arbitrary constant and M is the number of KCs in each of the three datasets. The primary quantity of interest is the dimension of the KC activities defined by122:

    $$\dim ({\bf{h}})=\frac{{(\text{Tr}[{\bf{C}}])}^{2}}{\text{Tr}[{{\bf{C}}}^{2}]}$$

    and how it changes with respect to K, the number of input connections. In other words, what are the numbers of input connections K onto individual KCs that maximize the dimensionality of their responses, h, given M KCs, N ALPNs and a global inhibition α?

    From Fig. 5k, the theoretical values of K that maximize dim(h) in this simple model demonstrate the consistent shift towards lower values of K found in the FlyWire left and FlyWire right datasets when compared with the hemibrain.

    The limitations of the model are as follows:

    1. (1)

      The values in the connectivity matrix \({\bf{W}}\) take only two discrete values, either 0 and 1 or 1 − α and α. In a way, this helps when calculating analytical results for the dimensionality of the KC activities. However, it is unrealistic as the connectomics data give the number of synaptic connections between the ALPNs and the KCs.

    2. (2)

      The global inhibition provided by APL to all of the mixing layer neurons is assumed to take a single value for all neurons. In reality, the level of inhibition would be different depending on the number of synapses between APL and the mixing layer neurons.

    3. (3)

      It is unclear whether the simple linear rate model presented in the original paper represents the behaviour of the biological neural circuit well. Furthermore, it remains unproven that the ALPN-KC neural circuit is attempting to maximize the dimensionality of the KC activities, albeit the theory is biologically well motivated (but see refs. 49,50).

    4. (4)

      The number of input connections to each mixing layer neuron is kept at a constant K for all neurons. It is definitely a simplification that can be corrected by introducing a distribution P(K) but this requires further detailed modelling.

    Statistical analyses

    Unless otherwise stated, statistical analyses (such as Pearson R or cosine distance) were performed using the implementations in the scipy123 Python package. To determine statistical significance, we used either t-tests for normally distributed samples, or Kolmogorov–Smirnov tests otherwise.

    Cohen’s d124 was calculated as follows:

    $$d=\frac{{\bar{x}}_{1}-{\bar{x}}_{2}}{s}$$

    where pooled s.d. s is defined as:

    $$s=\sqrt{\frac{({n}_{1}\,-\,1){s}_{1}^{2}\,+\,({n}_{2}\,-\,1){s}_{2}^{2}}{{n}_{1}\,+\,{n}_{2}\,-\,2}}$$

    where the variance for one of the groups is defined as:

    $${s}_{1}^{2}=\frac{1}{{n}_{1}-1}{\sum }_{i=1}^{{n}_{1}}{({x}_{1,i}-{\bar{x}}_{1})}^{2}$$

    and similar for the other group.

    Enhanced box plots—also called letter-value plots125—in Fig. 5h and Extended Data Fig. 7f are a variation of box plots better suited to represent large samples. They replace the whiskers with a variable number of letter values where the number of letters is based on the uncertainty associated with each estimate, and therefore on the number of observations. The ‘fattest’ letters are the (approximate) 25th and 75th quantiles, respectively, the second fattest letters the (approximate) 12.5th and 87.5th quantiles and so on. Note that the width of the letters is not related to the underlying data.

    Mapping to the VirtualFlyBrain database

    The VirtualFlyBrain (VFB) database22 curates and extracts information from all publications relating to Drosophila neurobiology, especially neuroanatomy. The majority of published neuron reconstructions, including those from the hemibrain, can be examined in the VFB. Each individual neuron (that is, one neuron from one brain) has a persistent ID (of the form VFB_xxxxxxxx). Where cell types have been defined, they have an ontology ID (for example, FBbt_00047573, the ID for the DNa02 DN cell type). Importantly, VFB cross-references neuronal cell types across publications even if different terms were used. It also identifies driver lines to label many neurons. In this paper, we generate an initial mapping providing FBbt IDs for the closest and fine-grained ontology term that already exists in their database. For example, a FlyWire neuron with a confirmed hemibrain cell type will receive a FBbt ID that maps to that exact cell type, while a DN that has been given a new cell type might only map to the coarser term ‘adult descending neuron’. Work is already underway with the VFB to assign both ontology IDs (FBbt) to all FlyWire cell types as well as persistent VFB_ids to all individual FlyWire neurons.

    Reporting summary

    Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

    [ad_2]

    Source link

  • Neuronal parts list and wiring diagram for a visual system

    [ad_1]

    Reconstruction accuracy and completeness

    The overall quality of our Drosophila brain reconstruction has been evaluated elsewhere24,31 (a summary of the current status is shown in Extended Data Table 3). Here we describe a few additional checks that are specific to the optic lobe. A small percentage of cells have eluded proofreading efforts. The worst cases are some types with visible ‘bald spots’ in the mid posterior side of the right optic lobe (Supplementary Data 2). In this region, we observed a narrowing and discontinuation of neuronal tracks. Many of these tracks appear to terminate within glial cells, suggesting a potential engulfment of neurons by glia. For most types, under-recovery is hardly visible (Supplementary Data 2).

    For a quantitative estimate of under-recovery, we can rely on the ‘modular’ types27, defined as cell types that are in one-to-one correspondence with columns. A previous reconstruction of seven medulla columns identified 20 modular types28. These largely correspond to the cell types that contain from 720 to 800 cells in our reconstruction (Fig. 1d). The top end (800) of this range is probably the true number of columns in this optic lobe. The lower end of this range is 720, suggesting that under-recovery is 10% at most, and typically less than that.

    The inner photoreceptors R7 and R8 are about 650 cells each, and the outer photoreceptors R1–6 total about 3,400 in version 783 of the FlyWire connectome. These numbers are not inconsistent with modularity because photoreceptors are especially challenging to proofread in this dataset and under-recovery is higher than typical.

    In the left optic lobe, we have proofread around 38,500 intrinsic neurons, as well as 3,700 VPNs, 250 VCNs, 150 heterolateral neurons and 5,000 photoreceptor cells. Tables comparing precise left/right counts by superclass as well as by type are available for download (see the ‘Data availability’ section).

    Tm21 (also known as Tm6), Dm2, TmY5a, Tm27 and Mi15 are substantially less numerous than 800, so we agree with the seven column reconstruction28 that they are not modular. On the other hand, some of our types (T2a, Tm3, T4c and T3) contain more than 800 proofread cells (Fig. 1d), which violates the definition of modularity. This partially agrees with the seven column reconstruction28, which regarded T3 and T2a as modular, and T4 and Tm3 as not modular. T4 is an unusual case, as T4c is above 800 while the other T4 types are below 800. It should be noted that all of the above cell numbers could still creep upward with further proofreading.

    A genuine analysis of modularity requires going beyond simple cell counts, and analysing locations to check the idea of one-to-one correspondence. Such an analysis is left for future work. Here we apply the term ‘numerous’ to those types containing 720 or more cells, as well as photoreceptor types, and do not commit to whether these types are truly modular.

    The seven column reconstruction28 provided a matrix of connections between their modular types. This shows good agreement with our data (Methods and Extended Data Fig. 9), providing a check on the accuracy of our reconstruction in the optic lobe. This validation complements the estimates of reconstruction accuracy in the central brain that are provided in the flagship paper24.

    The major limitation of our reconstruction in the optic lobe concerns the automatically detected synapses77. Although accuracy is high overall, outgoing photoreceptor synapses are markedly underdetected. This may be because dark cytoplasm (characteristic of photoreceptors) is not well represented in the example synapse images that were used to train the automated synapse detector. Example images of photoreceptor synapses have been included in the training set of an improved automated synapse detector, but the results were not ready in time for this publication, and will be made available in a future release. The classification of inner photoreceptors as yellow and pale is postponed until the future release. In the present paper, the connectivity from photoreceptors to other cell types in this paper is only qualitative and not quantitative. Furthermore, underdetection of photoreceptor synapses could affect the input fractions of other connections due to normalization.

    Another cautionary note is that weaker connections in the type–type connectivity matrix (Extended Data Fig. 4) could be artifactual, due to false positives of automated synapse detection. There are some heuristics for guessing whether a connection is artifactual, short of manually inspecting the original EM images. For example, one might distrust weak connections between cells, that is, those with less than some threshold number of synapses. The choice of the threshold value depends on the context9. For example, the flagship paper24 discarded connections with less than five synapses, a convention followed by the FlyWire Codex. The predicates of the present work apply a threshold of two synapses rather than five. The different thresholds were chosen because the central brain and optic lobes are very different contexts, as we now explain.

    In the central brain, most cell types have cardinality 2 (cell and its mirror twin in the opposite hemisphere; Extended Data Fig. 1e). In the hemibrain, the cardinality is typically reduced to one. Therefore, whether there is a connection between cell type A and cell type B must be decided based on only two or three examples of the ordered pair (A, B) in all the connectomic data that is so far available. Given the small sample size, it makes sense to set the threshold to a relatively high value, if false positives are to be avoided.

    On the other hand, in the optic lobe, there are often many examples of the ordered pair (A, B), because so many cell types have high cardinality. Therefore, if a connection is consistently found from type A to type B, one can have reasonable confidence even if the average number of synapses in the connection is not so high. That is why we set the threshold to a relatively low value in the optic lobe predicates. In particular, we have found that certain inhibitory types consistently make connections that involve relatively few synapses, and these connections seem real.

    Another heuristic is to look for extreme asymmetry in the matrix. If the number of synapses from A to B is much larger than from B to A, the latter connection might be spurious. The reason is that the strong connection from A to B means the contact area between A and B is large, which means more opportunity for false-positive synapses from B to A. False-positive rates for synapses are estimated in the flagship paper24.

    Finally, it may be known from other studies that a connection does not exist. For example, T1 cells lack output synapses26,78. Therefore, in our analyses, we typically regarded the few outgoing T1 synapses in our data as false positives and discarded them.

    Morphological cell typing

    Our connectomic cell approach to typing is initially seeded with some set of types, to define the feature vectors for cells (Fig. 2a), after which the types are refined by computational methods. For the initial seeding, we relied on the time-honoured approach of morphological cell typing, sometimes assisted by computational tools that analysed connectivity. It is worth noting that ‘morphology’ is a misnomer, because it refers to shape only, strictly speaking. Orientation and position are actually more fundamental properties because of their influence on stratification in neuropil layers. Thus, ‘single-cell anatomy’ would be more accurate than morphology, although the latter is the standard term.

    Stage 1: crowdsourced annotation of known types

    Annotations of optic lobe neurons were initially crowdsourced. The first annotators were volunteers from Drosophila laboratories. They were later joined by citizen scientists. At this stage, the annotation effort was mainly devoted to labelling cells of known types, especially the most numerous types.

    Drosophila lab annotators

    E.K. and D.G. proofread and annotated medulla neurons that were upstream of the anterior visual pathway. These included many of the medulla and lamina neurons discussed in this study. The annotated neurons were primarily Dm2, Mi15, R7, and R8, but also comprised various L, Dm, Mi, Tm, C and Sm cells. Previously known neuron types were identified primarily by morphology and partially by connectivity. Annotators additionally found all Mi1 neurons in both hemispheres to find every medulla column. These Mi1 neurons were used to create a map of medulla layers based on Mi1 stratification6, which later aided citizen scientists to identify medulla cell types.

    Citizen scientists

    The top 100 players from Eyewire79 had been invited to proofread in FlyWire24. After 3 months of proofreading in the right optic lobe, they were encouraged to also label neurons when they felt confident. Most citizen scientists did a mixture of annotation and proofreading. Sometimes they annotated cells after proofreading, and other times searched for cells of a particular type to proofread.

    Citizen scientists were provided with a visual guide to optic lobe cells sourced from the literature6,80. FlyWire made available a 3D mesh overlay indicating the four main optic lobe neuropils. Visual identification was primarily based on single-cell anatomy. Initially, labelling of type families (that is, Dm, Tm, Mi and so on) was encouraged, especially for novices. Annotation of specific types (such as Dm3, Tm2) developed over time. The use of canonical names was further enforced by a software tool that enabled easy selection and submission of preformatted type names.

    Additional community resources (discussion board/forum, blog, shared Google drive, chat, dedicated email and Twitch livestream) fostered an environment for sharing ideas and information between community members (citizen scientists, community managers and researchers). Community managers answered questions, provided resources such as the visual guide, shared updates, performed troubleshooting and general organization of community activity. Daily stats including number of annotations submitted per individual were shared on the discussion board/forum to provide project progress. Live interaction, demonstrations and communal problem solving occurred during weekly Twitch video livestreams led by a community manager. The environment created by these resources allowed citizen scientists to self-organize in several ways: community driven information sharing, programmatic tools and ‘farms’.

    Community-driven information sharing

    Citizen scientists created a comprehensive guide with text and screenshots that expanded on the visual guide. They also found and studied any publicly available scientific literature or resources regarding the optic lobe. They shared findings at discuss.flywire.ai, which as of 10 October 2023 had over 2,500 posts. Community managers interacted with citizen scientists by sharing findings from the scientific literature, consulting Drosophila specialists on FlyWire and providing feedback.

    Programmatic Tools

    Programmatic tools were created to help with searching for cells of the same type. One important script traced partners-of-partners, that is, source cell→downstream partners→their upstream partners, or source cell→upstream partners→their downstream partners. This was based on the assumption that cells of the same type will probably synapse with the same target cells, which often turned out to be true. The tool could either look for partners-of-all-partners or partners-of-any-partners. The resulting lists of cells could be very long, and were filtered by excluding cells that had already been identified, or excluding segments with small sizes or low ID numbers (which had probably not yet been proofread). Another tool created from lobula plate tangential cells (for example, HS, VS, H1) aided definition of layers in the lobula plate. This facilitated identification of various cell types, especially T4 and T5.

    Cell farms

    Citizen scientists created farms in FlyWire or Neuroglancer with all the found cells of a given type visible. Farms showed visually where cells still remained to be found. If they found a bald spot, a popular method to find missing cells was to move the 2D plane in that place and add segments to the farm one after another in search of cells of the correct type. Farms also helped with identifying cells near to the edges of neuropils, where neurons are usually deformed. Having a view of all other cells of the same type made it possible to extrapolate to how a cell at the edge should look.

    Stage 2: centralized annotation and discovery of new types

    A team of image analysts at Princeton finished the annotation of the remaining cells in known types, and also discovered new types. Community annotations were initially compared with existing literature to confirm accuracy. Once validated, these cells were used to query various Codex search tools that returned previously unannotated cells exhibiting connectivity similar to that of the cell in the query. The hits from the search query were evaluated by morphology and stratification to confirm match with the target cell type. In some cases in which cell type distinctions were uncertain, predicted neurotransmitters45 were used for additional guidance. This process enabled us to create a preliminary clustering of all previously known and new types.

    Connectomic cell typing

    Eventually morphology became insufficient for further progress. Expert annotators, for example, struggled to classify Tm5 cells into the three known types, not knowing that there would turn out to be six Tm5 types. At this point, we were forced to transition to connectomic cell typing. In retrospect, this transition could have been made much earlier. As mentioned above, connectomic cell typing must be seeded with an initial set of types, but the seeding did not have to be as thorough as it ended up. We leave for future work the challenge of extending the connectomic approach so it can be used from start to finish.

    Stage 3: connectivity-based splitting and merging of types and auto-correction

    We used computational methods to split types that could not be properly split in stage 2. Some candidates for splitting (such as Tm5) were suggested by the image analysts. Some candidates were suspicious because they contained so many cells. Finally, some candidates were scrutinized because their type radii were large. We applied hierarchical clustering with average linkage, and accepted the splits if they did not violate the tiling principle as described in the ‘Spatial coverage’ section.

    We also applied computational methods to merge types that had been improperly split in stage 2. Here the candidates were types with low spatial coverage of the visual field, or types that were suspiciously close in the dendrogram of cell types (Fig. 2c). Merge decisions were made by hierarchical clustering of cells from types that were candidates for merging, and validated if they improved spatial coverage.

    Once we arrived at the final list of types, we estimated the ‘centre’ of each type using the element-wise trimmed mean. Then, for every cell, we computed the nearest type centre by Jaccard distance. For 98% of the cells, the nearest type centre coincided with the assigned type. We sampled some disagreements and reviewed them manually. In the majority of cases, the algorithm was correct, and the human annotators had made errors, usually of inattention. The remaining cases were mostly attributable to proofreading errors. There were also cases in which type centres had been contaminated by human-misassigned cells (see the ‘Morphological variation’ section), which in turn led to more misassignment by the algorithm. After addressing these issues, we applied the automatic corrections to all but 0.1% of cells, which were rejected using distance thresholds.

    Validation

    On the basis of the auto-correction procedure, we estimate that our cell type assignments are between 98% and 99.9% accurate. For another measure of the quality of our cell typing, we computed the ‘radius’ of each type, defined as the average distance from its cells to its centre. Here we computed the centre by approximately minimizing the sum of Jaccard distances from each cell in the type to the centre (see the ‘Computational concepts’ section). A large type radius can be a sign that the type contains dissimilar cells, and should be split. For our final types, the radii vary, but almost all lie below 0.6 (Extended Data Fig. 3a). Lat has an exceptionally high type radius, and deserves to be split (see the ‘Cross-neuropil tangential and amacrine’ section). The type radii are essentially the same, whether or not boundary types are included in the feature vector (data not shown).

    Discrimination with logical predicates

    Because the feature vector is rather high dimensional, it would be helpful to have simpler insights into what makes a type. One approach is to find a set of simple logical predicates based on connectivity that predict type membership with high accuracy. For a given cell, we define the attribute ‘is connected to input type t’ as meaning that the cell receives at least one connection from some cell of type t. Similarly, the attribute ‘is connected to output type t’ means that the cell makes at least one connection onto some cell of type t.

    An optimal predicate is constructed for each type that consists of 2 tuples: input types and output types. Both tuples are limited to size 5 at most, and they are optimal with respect to the F-score of their prediction of the subject type, defined as follows:

    • Recall of a predicate for type T is the ratio of true positive predictions (cells matching the predicate) to the total number of true positives (cells of type T). It measures the predicate’s ability to identify all positive instances of a given type.

    • Precision is the ratio of true positive predictions (predictions that are indeed of type T) to the total number of positive predictions made by the logical predicate.

    • F-score is the harmonic mean of precision and recall—a single metric that combines both precision and recall into one value.

    On a high level, the process for computing the predicates is exhaustive—for each type, we look for all possible combinations of input type tuples and output type tuples and compute their precision, recall and F-score. A few optimization techniques are used to speed up this computation, by calculating minimum precision and recall thresholds from the current best candidate predicate and pruning many tuples early.

    For example, the logical predicate ‘is connected to input type Tm9 and output type Am1 and output type LPi15’ predicts T5b cells with 99% precision and 99% recall. For all but three of the identified types, we found a logical predicate with 5 or fewer input/output attributes that predicts type membership with an average F-score of 0.93, weighted by the number of cells in type (Extended Data Fig. 4 and Supplementary Data 1). Some of the attributes in a predicate are the top most connected partner types, but this is not necessarily the case. The attributes are distinctive partners, which are not always the most connected partners. The predicate for each type is shown on its card in Supplementary Data 2. For each family, the predicates for all types can be shown together in a single graph containing all of the relevant attributes (Supplementary Data 3).

    We experimented with searching for predicates after randomly shuffling a small fraction of types (namely, swapping types for 5% of randomly picked pairs of neurons). We found that precision and recall of the best predicates dropped substantially, suggesting that we are not overfitting. This was expected because the predicates are short.

    We also measured the drop in the quality of predicates if excluding boundary types (where the predicates are allowed to contain intrinsic types only). As is the case with the clustering metrics, the impact on predicates is marginal (weighted mean F-score drops from 0.93 to 0.92).

    Discrimination with two-dimensional projections

    Another approach to interpretability is to look at low-dimensional projections of the 2T-dimensional feature vector. For each cell type, we select a small subset of dimensions that suffice to accurately discriminate that type from other types (Extended Data Fig. 3c). Here we normalize the feature vector so that its elements represent the ‘fraction of input synapses received from type t’ or ‘fraction of output synapses sent to type t’. In these normalized quantities, the denominator is the total number of all input or output synapses, not just the synapses with other neurons intrinsic to the optic lobe.

    For example, we can visualize all cells in the Pm family in the two-dimensional space of C3 input fraction and TmY3 output fraction (Extended Data Fig. 3c). In this space, Pm04 cells are well-separated from other Pm cells, and can be discriminated with 100% accuracy by ‘C3 input fraction greater than 0.01 and TmY3 output fraction greater than 0.01’. This conjunction of two features is a more accurate discriminator than either feature by itself.

    More generally, a cell type discriminator is based on thresholding a set of input and output fractions, and taking the conjunction of the result. The search for a discriminator finds a set of dimensions, along with threshold values for the dimensions. To simplify the search, we require that the cell type be discriminated only from other types in the same neuropil family, rather than from all other types. Under these conditions, it almost always suffices to use just two dimensions of the normalized feature vector.

    Discriminators for all types in all families containing more than one type are provided in Supplementary Data 4. Many although not all discriminations are highly accurate. Both intrinsic and boundary types are included as discriminative features.

    Computational concepts

    Connectivity: cell-to-cell, type-to-cell, cell-to-type and type-to-type

    Define a (weighted) cell-to-cell connectivity matrix wij, as the number of synapses from neuron i to neuron j. The weighted out-degree and in-degree of neuron i are:

    $$\begin{array}{cc}{d}_{i}^{+}=\sum _{j}{w}_{{ij}} & {d}_{i}^{-}=\sum _{j}{w}_{{ji}}\end{array}$$

    (1)

    The sums are over all neurons in the brain. If neuron i is a cell intrinsic to one optic lobe, the only nonvanishing terms in the sums are due to the intrinsic and boundary neurons for that optic lobe.

    Let Ait be the 0–1 matrix that assigns neuron i to type t. The column and row sums of the assignment matrix satisfy

    $$\begin{array}{cc}{n}_{t}=\sum _{i}{A}_{{it}} & 1=\sum _{t}{A}_{{it}}\end{array}$$

    (2)

    where nt is the number of cells assigned to type t.

    The cell-to-type connectivity matrix Oit is the number of output synapses from neuron i to neurons of type t,

    $${O}_{{it}}=\sum _{j}{w}_{{ij}}{A}_{{jt}}$$

    (3)

    For fixed i, Oit is known as the output feature vector of cell i. Similarly, the type-to-cell connectivity matrix Itj is the number of input synapses from neurons of type t onto neuron j,

    $${I}_{{tj}}=\sum _{j}{A}_{{it}}{w}_{{ij}}$$

    (4)

    For fixed j, Itj is known as the input feature vector of cell j. The ith row and ith column of these matrices are concatenated to form the full feature vector for cell i (Fig. 2a).

    The input and output feature vectors can be normalized by degree to yield input and output fractions of cell i, Oit/di+ and Iti/di. Elements of these matrices are used for the discriminating 2D projections (Extended Data Fig. 3c).

    The type-to-type connectivity matrix is the number of synapses from neurons of type s to neurons of type t,

    $${W}_{{st}}=\sum _{{ij}}{A}_{{is}}{w}_{{ij}}{A}_{{jt}}$$

    (5)

    The weighted degree of type t is the sum of the weighted degrees of the cells in type t,

    $$\begin{array}{cc}{D}_{t}^{+}=\sum _{i}{A}_{{it}}{d}_{i}^{+} & {D}_{t}^{-}=\sum _{i}{A}_{{it}}{d}_{i}^{-}\end{array}$$

    (6)

    The sums are over all neurons in the brain, similar to equation (1). Normalizing by degree yields the output fractions of type s, Wst/Ds+, where t runs from 1 to T. The input fractions of type t are similarly given by Wst/Dt, where s runs from 1 to T. Selected output and input fractions of types are shown in Supplementary Data 5.

    Alternatively, the feature vectors can be based on connection number rather than synapse number, where a connection is defined as two or more synapses from one neuron to another. Then, weighted degree is replaced by unweighted degree in the above definitions. The threshold of two synapses is intended to suppress noise due to false positives in the automated synapse detection. Synapse number and connection number give similar results, and we use both in our analyses.

    We found that it was sufficient for feature dimensions to include only intrinsic types (T = 227). Alternatively, feature dimensions can be defined as including both intrinsic and boundary types (T > 700), and this yields similar results (data not shown).

    For the hierarchical clustering of cell types (Fig. 2c), the feature vector for each cell type is obtained by concatenating the vectors of input and output fractions for that cell type.

    Similarity and distance measures

    The weighted Jaccard similarity between feature vectors x and y is defined by

    $$J\left({\bf{x}},{\bf{y}}\right)=\frac{{\sum }_{t}\min \left({x}_{t},{y}_{t}\right)}{{\sum }_{{t}^{{\prime} }}\max \left({x}_{{t}^{{\prime} }},{y}_{{t}^{{\prime} }}\right)}$$

    (7)

    and the weighted Jaccard distance d(x,y) is defined as one minus the weighted Jaccard similarity. These quantities are bounded between zero and one since our feature vectors are nonnegative. In our cell typing efforts, we have found empirically that Jaccard similarity works better than cosine similarity when feature vectors are sparse.

    Type centres

    Given a set of feature vectors xa, the centre c can be defined as the vector minimizing

    $$\sum _{a}d\left({{\bf{x}}}^{a},{\bf{c}}\right)$$

    (8)

    This cost function is convex, as d is a metric satisfying the triangle inequality. Therefore, the cost function has a unique minimum. We used various approximate methods to minimize the cost function.

    For auto-correction of type assignments, we used the element-wise trimmed mean. We found empirically that this gave good robustness to noise from false synapse detections. For the type radii, we used a coordinate descent approach, minimizing the cost function with respect to each ci in turn. The loop included every i for which some xi was non-zero. This converged within a few iterations of the loop.

    Hierarchical clustering of cell types

    The type-to-type connectivity matrix of equation (5) was the starting point for clustering the cell types. For each cell type, the corresponding row and column of the matrix were normalized to become input and output fractions, as described in the text following equation (6), and then concatenated (this is yet another way of computing type centres). Feature vectors included only dimensions corresponding to cell types intrinsic to the optic lobe. Then, average linkage hierarchical clustering was applied to yield a dendrogram (Fig. 2c). The dendrogram was thresholded to produce a flat clustering (Fig. 2c).

    The precise memberships in the clusters warrant cautious interpretation, as the clusters are the outcome of just one clustering algorithm (average linkage), and differ if another clustering algorithm is used. Each cluster contains core groups of types that are highly similar to each other, that is, types that merge early during agglomeration (closer to the circumference of the dendrogram). These are more certain to have similar visual functions, and tend to be grouped together by any clustering algorithm. Types that are merged late (closer to the origin of the dendrogram) are less similar, and their cluster membership is more arbitrary. Some degree of arbitrariness is inevitable when one divides the visual system into separate subsystems, because subsystems interact with each other, and types that mediate such interactions are borderline cases.

    Each cluster is generally a mixture of types from multiple neuropil families. Sceptics might regard such mixing as arising from the ‘noisiness’ in the clustering noted above at the largest distances. Indeed, the nearest types, those that merge in the dendrogram farther from the centre (Fig. 2c), tend to be from the same neuropil family. But plenty of dendrogram merges between types of different families happen at intermediate distances rather than the largest distances. Thus, some of the mixing of types from different neuropil families seems genuinely rooted in biology.

    Wiring diagrams

    Reduction

    To make the wiring diagrams readable, we display only the top type-to-type connections, which are defined as follows. For every cell type, the top input cell type and top output cell type are selected by ranking connected partners by the total number of synapses in the connection. If cell types are nearly tied, any runner up within 5% of the winner is also displayed. Figure 3 shows the top connections between all optic lobe intrinsic types. Figures 4–7 each focus on one or a few subsystems, but also include the top input/output connections they participate in with the rest of the network as well as top output connections to boundary types (for example, in Fig. 4, Dm2 is selected because it belongs to cluster 5, luminance channel, but then also other types outside of ON, OFF, and luminance channels are included because either Dm2 is their top input/output type or the other way around). Extended Data Figs. 5 and 6 show the top input and top output connections separately, for improved readability. For the top output connections we also include boundary types (VPNs).

    Colours and shapes

    Nodes, representing cell types, are coloured by clusters. Node size encodes the number of drawn connections, so that types that are top input/output of many other types look larger. Node shapes encode type numerosities (number of cells of that type), from most numerous (hexagon) to least (ellipse) (see the figure legends). The lines indicate connections between cell types. The line colour encodes the relationship (top input or top output) and the line width is proportional to the number of synapses connecting the respective types. The line arrowheads encode neurotransmitter predictions (excitatory/cholinergic or inhibitory/GABAergic/glutamatergic).

    Layout

    We used Cytoscape81 to draw the wiring diagrams. Organic layout was used for Figs. 3 and 7c, and hierarchical layout was used for the others. The hierarchical layout tries to make arrows point downwards. After Cytoscape automatically generated a diagram, nodes were manually shifted by small displacements to minimize the number of obstructions.

    Intrinsic versus boundary

    The optic lobes are divided into five regions (neuropils): lamina of the compound eye (LA); medulla (ME); accessory medulla (AME); lobula (LO); lobula plate (LOP). All non-photoreceptor cells with synapses in these regions are split into two groups: optic lobe intrinsic neurons and boundary neurons.

    Optic lobe intrinsic neurons are almost entirely contained in one of the optic lobes (left or right), more precisely, 95% or more of their synapses are assigned to the five optic lobe regions listed above.

    Boundary neurons are those with at least 5% (and less than 95%) of synapses in the optic lobe regions, and are either visual projection, visual centrifugal or heterolateral neurons.

    Axon versus dendrite

    In the main text (in the ‘Class, family and type’ section), we used the term ‘axon’. An axon is defined as some portion of the neuron with a high ratio of presynapses to postsynapses. This ratio might be high in an absolute sense. Or the ratio in the axon might only be high relative to the ratio elsewhere in the neuron (the dendrite). In either case, the axon is typically not a pure output element, but has some postsynapses as well as presynapses. For many types it is obvious whether there is an axon, but for a few types we have made judgement calls. Even without examining synapses, the axon can often be recognized from the presence of varicosities, which are presynaptic boutons. The opposite of an axon is a dendrite, which has a high ratio of postsynapses to presynapses.

    An amacrine cell is defined as one for which the axon–dendrite distinction does not hold, and presynapses and postsynapses are intermingled in roughly the same ratio throughout. The branches of an amacrine cell are often called dendrites, but the neutral term ‘neurite’ is perhaps better for avoiding confusion.

    Columnar neurons

    Fischbach and Dittrich6 defined 13 columnar families based on neuropils (Fig. 1a). Families consisting exclusively of ‘numerous’ (800 cells) types include L (lamina to medulla), C (medulla to lamina), T1 (distal medulla to lamina), T2 (distal and proximal medulla to lobula), T3 (proximal medulla to lobula), T4 (proximal medulla to lobula plate) and T5 (lobula to lobula plate). We follow the convention of grouping the less numerous Lawf1 (distal medulla to lamina) and Lawf2 (proximal and distal medulla to lamina) types in the same family, despite the differences between their neuropils and connectivity. Although T1 shares the same neuropils with Lawf1, T1 lacks output synapses26,78, so it is an outlier and deserves to be a separate family. Distal and proximal medulla are regarded as two separate neuropils6.

    Mi

    Fischbach and Dittrich6 defined Mi as projecting from distal to proximal medulla. Mi contains both numerous and less numerous types. We identified five (Mi1, 2, 4, 9, 10) of the dozen Mi types originally defined6, and three (Mi13, 14, 15) types uncovered by EM reconstruction27. Mi1, Mi4, and Mi9 are consistent with the classical definition, but Mi13 projects from proximal to distal medulla. Other Mi types are less polarized, and the term “narrow-field amacrine” might be more accurate than “columnar”. Nevertheless we will adhere to the convention that they are columnar. Narrow-field amacrine cells are also found in the Sm family, and exist in the mammalian retina82.

    Tm transmedullary

    As classically defined6, Tm cells project from the distal medulla to the lobula. Tm1 through Tm26 and Tm28 were defined6, and Tm27/Tm27Y was reported later83. We were able to identify Tm1, 2, 3, 4, 7, 9, 16, 20, 21, 25 and 27. We split Tm5 into six types, and Tm8 into two types. We merged Tm6 and Tm21 into a single type Tm21. We prefer the latter name because the cells more closely match the Tm21 stratification as drawn by Fischbach and Dittrich6. Tm1a and Tm4a were defined as morphological variants6, but we have found that they do not differ in connectivity and are not common, so we have merged them into Tm1 and Tm4, respectively. We merged Tm27Y into Tm2783. TmY5 was merged into TmY5a6,84, the name that has appeared more often in the literature. These morphological distinctions originally arose because the projection into the lobula plate, the differentiator between Tm and TmY, can vary across cells in a type. We added new types Tm31 to Tm37, which project from the serpentine medulla to the lobula. We moved Tm23 and Tm24 to the Li family. They were originally classified as Tm because their cell bodies are in the distal rind of the medulla, and they send a neurite along the columnar axis of the medulla to reach the lobula6. However, they do not form synapses in the medulla, so we regard them as Li neurons despite their soma locations. Overall, around half of the 26 types in the Tm family are new.

    TmY

    TmY cells project from the distal medulla to the lobula and lobula plate. The Y refers to the divergence of branches to the lobula and lobula plate. Previous definitions include TmY1 to TmY136; TmY5a6,84; TmY1427; TmY1529; and TmY16, TmY18 and TmY2030. We identified TmY3, TmY4, TmY5a, TmY10, TmY11, TmY14, TmY15, TmY16 and TmY20. We divided TmY9 into two types, as discussed in a companion paper60. We added a new type, TmY31.

    Y

    Y cells project from the proximal medulla to the lobula and lobula plate. They are similar to TmY cells, but the latter traverse both the distal and proximal medulla6. Previous definitions were Y1 and Y3 to Y66; and Y11 and Y1210. We have identified Y1, Y3, Y4, Y11 and Y12 in our reconstruction, and have not found any new Y types. Y1, Y11 and Y12 have the majority of their synapses in the lobula plate, and are assigned to the motion subsystem. Y3 and Y4 have few synapses in the lobula plate, and are assigned to the object subsystem (Fig. 2). Y3 is more numerous (300 cells) than Y4, and is the only Y type that is predicted cholinergic.

    Tlp

    A Tlp neuron projects from the lobula plate to the lobula. Tlp1 to Tlp5 were defined first6, and Tlp11 to Tlp14 were defined later on10. We have identified Tlp1, Tlp4, Tlp5 and Tlp14. We propose that the names Tlp11, Tlp12 and Tlp13 should be retired10, as these types can now be unambiguously identified with Tlp5, Tlp1 and Tlp4, respectively.

    Interneurons

    A local interneuron is defined as being completely confined to a single neuropil (Fig. 1b). Interneurons make up the majority of types, but a minority of cells (Fig. 1e). Lai is the only lamina interneuron. Dm and Pm interneurons6 stratify in the distal or proximal medulla, respectively. We have more than doubled the number of Pm types, and slightly increased the number of Dm types. We introduce the Sm family, which is almost completely new and contains more types than any other family (Fig. 1f). Li and LPi interneurons stratify in the lobula or lobula plate, respectively. Interneurons are usually amacrine and presumed inhibitory (GABA or glutamate), but some are tangential or cholinergic. Interneurons are often wide field but some are narrow field.

    Dm

    Dm1 to Dm86; Dm9 and 1027; and Dm11 to Dm2085 were previously defined. We do not observe Dm5 and Dm7, consistent with a previous study85. Most types are predicted to secrete glutamate or GABA, but there are also a few cholinergic types (Supplementary Data 1). To Dm3p and Dm3q61,62,85, we added a third type, Dm3v (Supplementary Data 2). We split Dm8 into Dm8a and Dm8b (see the ‘Correspondences with molecular–morphological types’ section).

    DmDRA

    The DRA differs from the rest of the retina in its organization of inner photoreceptors. Photoreceptors in non-DRA and DRA differ in their axonal target layers and output cell types54,86. Specifically, DRA-R7 connects with DmDRA1, whereas DRA-R8 connects to DmDRA254,87. These distinctive connectivity patterns result in DmDRA1 and DmDRA2 types exhibiting an arched coverage primarily in the M6 layer of the dorsal medulla (Fig. 9b). R7-DRA and R8-DRA are incompletely annotated at present, and this will be rectified in a future release. DmDRA1 receives R7 input, but sits squarely in M7. This could be regarded as an Sm type, but we have chosen not to change the name for historical reasons.

    Pm

    Pm1, 1a and 26 were each split into two types. Pm3 and 4 remain as previously defined85. We additionally identified six new Pm types, for a total of 14 Pm types, numbered Pm01 to Pm14 in order of increasing average cell volume. The new names can be distinguished from the old ones by the presence of leading zeros. All are predicted GABAergic. Pm1 was split into Pm06 and Pm04, Pm1a into Pm02 and Pm01, and Pm2 into Pm03 and Pm08.

    Sm

    Dm and Pm interneurons are defined6 to stratify on the distal or proximal side, respectively, of the serpentine layer (M7) of the medulla. Many interneuron types turn out to have significant stratification in the serpentine layer, and these borderline cases constitute a large new Sm family of interneurons, almost all new. They have been named Sm01 to Sm43, mostly in order of increasing average cell volume. The Sm family includes types recently named medulla tangential intrinsic42. We avoid using this term indiscriminately because some Sm types are tangential while others are amacrine. Some Sm types spill over from M7 into the distal or proximal medulla, and a few reach from M7 to more distant medulla layers.

    Sm stratification in M7 has functional implications. First, Sm types are positioned to communicate with the medulla tangential (Mt) cells and other boundary types that are important conduits of information in and out of the optic lobe (Supplementary Data 5). Second, Sm types are positioned to communicate with the inner photoreceptor terminals, which are in M6 or at the edge of M7. Consequently many Sm types are involved in the processing of chromatic stimuli, and end up being assigned to the colour subsystem.

    The Sm family more than doubles the number of medulla interneuron types, relative to the old scheme with only Pm and Dm. The Sm family might be related to the M6-LN class of neuron previously defined88. The correspondence is unclear because M6-LN neurons are defined to stratify in M6, while Sm mainly stratifies in M7. But some Sm types stratify at the border between M6 and M7, and therefore could be compatible with the M6-LN description.

    Li

    After two lobula intrinsic types (Li1 and Li2) were initially defined6, 12 more (Li11 to 20 and mALC1 and mALC2) were identified by the hemibrain reconstruction9. Of these, we have confirmed Li2, Li12, Li16, mALC1 and mALC2. We identified 21 additional Li types, but have not been able to make conclusive correspondences with previously identified types. As mentioned earlier, we transfer Tm23 and Tm246 from the Tm to the Li family. This amounts to a total of 33 Li types, which have been named Li01 to Li33 in order of increasing average cell volume.

    Collisions with Li1 and Li26 are avoided by the presence of leading zeros in our new names. The hemibrain names Li11 to Li20 and mALC1 and mALC29 have been used by few or no publications, so there is little cost associated with name changes. In any case, we were only able to establish conclusive correspondences for a minority of the hemibrain Li11 to Li20 types, which are detailed in Supplementary Data 1. Hemibrain Li12 is now Li27 (jigsaw pair), and hemibrain Li16 is now Li28 (pair of full-field cells). Hemibrain Li11 was split into Li25 and Li19 (see the ‘Morphological variation’ section). Hemibrain Li18 was split into three types: (1) Li08 covers the whole visual field. (2) Li04 covers a dorsal region except for the dorsal rim. It is tangentially polarized, with the axon more dorsal than the dendrites. Both axon and dendrite point in the posterior direction, perpendicular to the direction of polarization. The dendrites are more thickly stratified than the axon. (3) Li07 has ventral coverage only. The axons are in one layer, and extend over a larger area than the dendrites, which hook around into another layer and are mostly near the ventral rim. We considered merging Li04 and Li07, but their connectivity is quite different. Furthermore, in a hierarchical agglomerative clustering, Li07 would merge with Li08 before Li04.

    LPi

    LPi names were originally based on stratification in layers 1 to 4 of the lobula plate, including LPi1-2 and 2-110; LPi3-4 and 4-38; and LPi2b and LPi34-1210 (we are not counting fragments for which correspondences are not easy to establish). We have added nine new types, for a total of 15 LPi types.

    Now that LPi types have multiplied, stratification is no longer sufficient for naming. The naming system could be salvaged by adding letters to distinguish between cells of different sizes. For example, LPi15 and LPi05 could be called LPi2-1f and LPi2-1s, where ‘f’ means full-field and ‘s’ means small. For simplicity and brevity, we instead chose the names LPi01 to LPi15, in order of increasing average cell volume. Correspondences with old stratification-based names are detailed in Codex.

    Cross-neuropil tangential and amacrine

    Most types that span multiple neuropils are columnar. One tangential type that spans multiple neuropils inside the optic lobe was previously described: Lat has a tangential axon that projects from the medulla to the lamina6. There is some heterogeneity in the Lat population, as reflected in the large type radius (Extended Data Fig. 3a). We have decided to leave splitting for future work, as Lat has many dense core vesicles that are presently unannotated.

    Here we introduce two new families of cross-neuropil types that are tangential (MLt1-8 and LMt1-4), and one that is amacrine (LMa1-5). Along with two new tangential families (PDt, LLPt) that contain only single types, and the known CT1 and Am1 types, that is a total of 21 cross-neuropil types that are non-columnar (Fig. 1c). Each of the new types (except PDt with 6 cells) contains between 10 and 100 cells.

    The tangential types connect neuropils within one optic lobe and do not leave the optic lobe. Our usage of the term ‘tangential’ focuses on axonal orientation only. It should not be misunderstood to imply a wide-field neuron that projects out of the optic lobe, which is the case for the well-known lobula plate tangential cells or lobula tangential cells. The term ‘tangential’ presupposes that we can identify an axonal arbour for the cell (see the ‘Axon versus dendrite’ section).

    PDt

    We found one tangential type that projects from proximal to distal medulla (Supplementary Data 2).

    MLt

    ML1 was previously identified42 as a tangential neuron projecting from the medulla to lobula. We will refer to this type as MLt1, and have discovered more types of the same family, MLt2 to MLt8. Mlt1 and Mlt2 dendrites span both distal and proximal medulla, and Mlt3 dendrites are in the distal medulla, so MLt1 to MLt3 receive L input (Supplementary Data 2 and 5). Mlt4 dendrites are in the proximal medulla (Supplementary Data 2). Mlt5 to Mlt8 have substantial arbour overlap with the serpentine layer M7 (Supplementary Data 2), and are therefore connected with many Sm types to be discussed later on (Supplementary Data 5). Interaction between MLt types is fairly weak, with the exception of MLt7 to MLt5 (Supplementary Data 5). MLt7 and MLt8 are restricted to the dorsal and dorsal rim areas.

    LMt

    We identified four tangential types (LMt1 to LMt4) that project from the lobula to medulla. Their axonal arbours are all in the proximal medulla (Supplementary Data 2), thinly stratified near layer M7, so they have many Pm targets (Supplementary Data 5). Only LMt4 exhibits partial coverage.

    LLPt

    We discovered one tangential type that projected from the lobula to lobula plate, and called it LLPt. This is just a single type, rather than a family.

    LMa

    We discovered four amacrine types that extend over the lobula and medulla. LMa1 to LMa4 are coupled with T2, T2a and T3, and LMa4 and LMa3 synapse onto T4 and T5 (Supplementary Data 5). The LMa family could be said to include CT1, a known amacrine cell that also extends over both the lobula and medulla. However, the new LMa types consist of smaller cells that each cover a fraction of the visual field, whereas CT1 is a wide-field cell.

    MLLPa

    Am1 was defined10 as a wide-field amacrine cell that extends over the medulla, lobula and lobula plate. We found no other amacrine types like Am1 with such an extended reach.

    Correspondences with molecular–morphological types

    Tm5

    Tm5a, Tm5b and Tm5c were originally defined by single-cell anatomy and Ort expression7,50. Tm5a is cholinergic, the majority of the cells extend one dendrite from M6 to M3, and often has a ‘hook’ at the end of its lobula axon. Tm5b is cholinergic, and most (~80%) cells extend several dendrites from M6 to M3. Tm5c is glutamatergic and extends its dendrites up to the surface of the distal medulla. Three of our types are consistent with these morphological descriptions (Fig. 7a), and receive direct input from inner photoreceptors R7 or R8.

    Dm8

    Molecular studies previously divided Dm8 cells into two types (yDm8 and pDm8), depending on whether or not they express DIPγ51,53. Physiological studies demonstrated that yDm8 and pDm8 have differing spectral sensitivities89. The main dendrites of yDm8 and pDm8 were found to connect with R7 in yellow and pale columns, respectively. On the basis of its strong coupling with Tm5a, our Dm8a probably has some correspondence with yDm8, which is likewise selectively connected with Tm5a51,53. It is not yet clear whether there is a true one-to-one correspondence of yDm8 and pDm8 with Dm8a and Dm8b. It is the case that Dm8a and Dm8b strongly prefer to synapse onto Tm5a and Tm5b, respectively. However, Tm5a and Tm5b are not in one-to-one correspondence with yellow and pale columns. Rather, the main dendritic branch of Tm5a is specific to yellow columns, while the main dendritic branches of Tm5b are found in both yellow and pale columns50. Furthermore, Dm8a and Dm8b cells are roughly equal in number, while the yDm8:pDm8 ratio is expected to be substantially greater than one51,53, like the ratio of yellow to pale columns. Thus, the correspondence of Dm8a and Dm8b with yDm8 and pDm8 is still speculative. The yellow/pale issue should be revisited in the future when accurate photoreceptor synapses become available (see the ‘Reconstruction accuracy and completeness’ section).

    Additional validation

    HHMI Janelia has released a preprint detailing cell types in the right optic lobe of an adult male Drosophila brain90. The list of intrinsic cell types is almost identical to ours, apart from naming differences in new types. Since our original submission, we have completed typing of the left optic lobe of our female fly brain reconstruction, and the results match the right optic lobe analysed in the present paper. These replications in another hemisphere of the same brain and in the brain of another individual fly provide additional validation of our findings.

    Reporting summary

    Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

    [ad_2]

    Source link

  • Oligodendrocytes and myelin limit neuronal plasticity in visual cortex

    [ad_1]

    Animals

    All mice were handled in accordance with, and all procedures approved by, the Institutional Animal Care and Use Committee of the University of California San Francisco. Mice were group housed (between two and five per cage) throughout all experiments and given food and water ad libitum on a 12/12 h light/dark cycle in a temperature-controlled (22–24 °C) and humidity-controlled (40–60%) environment. Housing conditions adhered to the standards maintained by University of California San Francisco Institutional Animal Care and Use Committee, which include standard-sized mouse cages, bedding, nestlet, gnawing block and Enviro-dry nesting material. No additional environmental enrichment was provided. Males and females were used for all experiments. For tracking of oligodendrogenesis during adolescence, NG2CreER:tau-mGFP mice51,52 (Jax, nos. 008538 and 021162) received 100 mg kg−1 tamoxifen (Sigma, catalogue no. T5648) by oral gavage from P26 to P28. A subset also received 80 mg kg−1 EdU (Carbosynth, catalogue no. NE08701) by intraperitoneal injection at the same time. For blocking of adolescent oligodendrogenesis, Pdgfra-creER:MyrfFl/Fl mice13,53 (Jax, nos. 018280 and 010607) received 100 mg kg−1 tamoxifen by oral gavage from P10 to P14. For visualization of dendritic spines in vivo, Pdgfra-creER:MyrfFl/Fl mice were crossed with Thy1-YFP-H mice54 (Jax, no. 003782). Experimenters were blinded to animal genotype throughout data acquisition and analysis.

    Immunohistochemistry

    Mice were deeply anaesthetized with Avertin and perfused transcardially with 4% paraformaldehyde in 1× PBS. Brain tissue was isolated and postfixed in this solution overnight at 4 °C, then stored in 1× PBS with 0.1% NaAz. Brains were sucrose protected (30% in PBS) before flash-freezing and sectioning coronally (30 μm) on a sliding microtome. Free-floating sections were permeabilized/blocked with 0.2% Triton X-100 and 10% normal goat serum in 1× PBS for 1 h at room temperature. Sections were incubated with primary antibodies prepared in 0.2% Triton X-100 and 10% normal goat serum in 1× PBS at 4 °C overnight. Sections were incubated with secondary antibodies in 10% normal goat serum in 1× PBS for 2 h at room temperature. Primary antibodies and concentrations used are as follows: rabbit anti-ASPA (1:1,000), chicken anti-GFP (1:1,000), rat anti-MBP (1:200), rabbit anti-PDGFRα (1:200), rabbit anti-cleaved caspase-3 (1:200), mouse anti-glial fibrillary acidic protein (1:1,000), human anti-SOX9 (1:2,000), rabbit anti-IBA1 (1:1,000), mouse anti-NF-L Degenotag (1:1,000), rabbit anti-NF-H (1:1,000), mouse anti-PV (1:1,000), biotinylated WFA (1:400), rabbit anti-CASPR (1:600) and mouse anti-BCAS1 (1:300); additional details are listed in Supplementary Table 2. The primary antibodies above have been validated for use in immunohistochemistry in mouse tissue, in published literature and on the manufacturer’s websites. Secondary antibodies used included the following: Alexa Fluor 488-, 594- or 647-conjugated secondary antibodies to rabbit, mouse, human, chicken, rat or streptavidin (1:1,000, all raised in goat; purchased from Thermo Fisher Scientific or Jackson ImmunoResearch); additional details are listed in Supplementary Table 2. Cell nuclei were labelled with DAPI (Vector Laboratories). TUNEL immunostaining was performed on fixed brain sections according to the manufacturer’s instructions using the Abcam TUNEL Assay Kit—BrdU-Red (abcam, catalogue no. ab66110).

    Fixed-tissue imaging and analysis

    Tiled z-stacks (with 2 µm steps) spanning either 30 µm sections of visual cortex and lateral geniculate nucleus or 20 µm sections of optic nerve were taken with a Zeiss Axio Imager Z1 with ApoTome attachment and Zeiss Zen 2 (blue edition, v.2.0.0.0) software, using a ×10 objective. For quantification, images were taken from two or three sections per mouse. Cell density was quantified manually using Cell Counter in Fiji. Experimenters were blinded to genotype throughout imaging acquisition and analysis.

    Slice electrophysiology

    Mice aged 8–12 weeks were anaesthetized with isofluorane. Brains were quickly removed and placed in ice-cold artificial cerebrospinal fluid (ACSF) containing 125 mM NaCl, 2.5 mM KCl, 2 mM CaCl2, 1.25 mM NaH2PO4, 1 mM MgCl2, 25 mM NaHCO3 and 15 mM d-glucose. ACSF was saturated with 95% O2 and 5% CO2. Osmolarity was adjusted to 300–305 mOsm. Coronal sections (300 µm) containing visual cortex were prepared in ice-cold ACSF using a vibrating-blade microtome (Leica VT1200). Slices were recovered for 20 min at 32 °C and then transferred to ACSF at room temperature. Following the recovery period, slices were moved to a submerged recording chamber perfused with ACSF at a rate of 2–3 ml min−1 at 30–31 °C, and brain slices were recorded within 5 h of recovery. Voltage-clamp recordings of mIPSCs were made using glass pipettes of resistance 2–4 MΩ, filled with internal solution containing 126 mM CsMeSO3, 8 mM NaCl, 10 mM HEPES, 2.9 mM QX-314, 8 mM Na2-phosphocreatine, 0.3 mM GTP-Na, 4 mM ATP-Mg, 0.1 mM CaCl2 and 1 mM EGTA, pH 7.2–7.3, osmolarity 285–290 mOsm. Input resistance was monitored online during recordings; cells with access resistance greater than 20 MΩ were excluded from analysis. Recordings were made at 0 mV holding potential. mIPSCs were pharmacologically isolated with tetrodotoxin (1 μM), NBQX (10 μM) and APV (50 μM) in the bath. Between 200 and 300 events per cell were analysed using a threshold of 2× baseline noise. Recordings were obtained with a Multiclamp 700B amplifier (Molecular Devices) using WinWCP software (University of Strathclyde, UK). Signals were filtered at 2 kHz, digitized at 10 kHz (NI PCIe-6259, National Instruments) and analysed offline using the MiniAnalysis Program (Synaptosoft). The experimenter was blinded to the genotype of the animals throughout recording and analysis.

    Monocular deprivation

    Mice were anaesthetized using 5% isofluorane and anaesthesia was maintained with 2–3% isofluorane. The right eyelid was sutured closed by two mattress stitches, at either P26 for adolescent NG2CreER:tau-mGFP mice or 6–12 weeks for post-critical-period Pdgfra-creER:MyrfFl/Fl mice. Meloxicam and buprenorphine were administered before and after surgery for pain management. Animals were checked daily to ensure that the sutured eye remained closed for the required duration of the experiment. Sutures were removed just before postmonocular deprivation ISI sessions. Eyes were flushed with sterile saline and checked for clarity under a microscope. Only mice without corneal opacities or signs of infection were used.

    ISI

    Repeated optical imaging of intrinsic signals and quantification of ocular dominance were performed as previously described18. In brief, during recording, mice were anaesthetized with 0.7% isoflurane in oxygen applied via a home-made nose mask, supplemented with a single intramuscular injection of 20–25 µg chlorprothixene. Mice underwent a non-invasive procedure in which a headplate was fixed to the surface of the skull to enable head-fixed imaging, and images were recorded transcranially. Intrinsic signal images were obtained with a Dalsa 1M30 CCD camera (Dalsa) fitted with a 135 × 50 mm tandem lens (Nikon) and red interference filter (610 ± 10 nm), using custom Linux software. Frames were acquired at a rate of 30 per second, temporally binned by four frames and stored as 512 × 512 pixel images following spatial binning of 1,024 × 1,024 camera pixels by 2 × 2 pixels. The visual stimulus for recording the binocular zone, presented on a 40 × 30 cm2 monitor placed 25 cm in front of the mouse, consisted of 2°-wide bars that were presented between −5 and 15° on the stimulus monitor (0°, centre of the monitor aligned to centre of the mouse) and moved continuously and periodically upward or downward at a speed of 10° s−1. The phase and amplitude of cortical responses at the stimulus frequency were extracted by Fourier analysis as previously described18. Response amplitude was taken as an average of at least four measurements. Ocular dominance index was computed as previously described18. In brief, the binocularly responsive region of interest (ROI) was chosen based on the ipsilateral eye response map following smoothing by low-pass filtering, using a uniform kernel of 5 × 5 pixels and thresholding at 40% of peak response amplitude. Ocular dominance score (C − I)/(C + I) was computed for each pixel in this ROI, in which C and I represent the magnitude of response to contralateral and ipsilateral eye stimulation, respectively, followed by calculation of ocular dominance index as the average of ocular dominance score for all responsive pixels. Experimenters were blinded to genotype throughout imaging and analysis.

    CW surgery

    At the age of 8–12 weeks, a square 3 × 3 mm2 cranial window (no. 1 coverslip glass, Warner Instruments) was placed over the left hemisphere of the cortex contralateral to the deprived eye. Mice were anaesthetized using 5% isofluorane and anaesthesia was maintained with 2–3% isofluorane. A craniotomy matching the size of the coverslip was cut using no. 11 scalpel blades (Fine Science Tools) and the coverslip carefully placed on top of the dura within the craniotomy without excessive compression of the brain. The window was centred using stereotactic coordinates 2 mm lateral and 3 mm posterior from bregma for visual cortex. The window and skull were sealed using dental cement (C&B Metabond, Parkell). A custom-made metal head bar was attached to the skull during surgery for head-fixed imaging. Mice were allowed to recover for 2–3 weeks before two-photon imaging.

    In vivo longitudinal imaging

    Longitudinal in vivo two-photon imaging was performed, as previously described31, with Pdgfra-creER:MyrfFl/Fl mice crossed with Thy1-YFP-H mice. Specifically, apical dendrites of cortical pyramidal neurons expressing YFP were imaged repeatedly 10–100 μm below the cortical surface through the cranial window in mice under isoflurane anaesthesia. Images were acquired using a Bergamo II two-photon microscope system with a resonant scanner (Thorlabs) and a ×16/0.8 numerical aperture water-immersion objective lens (Nikon), using ThorImage LS software. YFP was excited at 925 nm with a mode-locked, tunable, ultrafast laser (InSightX3, Spectra-Physics) with 15–100 mW of power delivered to the back-aperture of the objective. Image stacks were acquired at 1,024 × 1,024 pixels with a voxel size of 0.12 μm in x and y and a z-step of 1 μm. Imaging frames from resonant scanning were averaged during acquisition to achieve a pixel dwell time equivalent of 1 ns. Up to six imaging regions were acquired for each mouse. Representative images shown in the figures were created by making z-projections of three-dimensional stacks and were median filtered and contrast enhanced.

    Analysis of in vivo spine imaging

    Dendritic spines were analysed using the custom software Map Manager (https://mapmanager.net) written in Igor Pro (WaveMetrics) as previously described31,55. Experimenters were blinded to genotype throughout imaging acquisition and analysis. For annotation, the dendritic shaft was first traced using a modified version of the ‘Simple Neurite Tracer’ plug-in provided in ImageJ. Spine positions along a dendritic segment were manually identified by the location of the spine tip in three-dimensional image stacks of all imaging sessions. For longitudinal analysis, spines were further tracked across time by comparison of images from different sessions and connecting persistent spines. Rates of spine addition and elimination were calculated as the number of newly added or eliminated spines on a given imaging session divided by the total number of spines of that dendritic segment on the previous imaging session. The turnover ratio represents the sum of spine addition and elimination.

    The fluorescence intensity of dendritic spines was used as a proxy for spine size, and therefore a three-dimensional ROI was defined for each spine, the dendritic shaft (4 μm stretch) adjacent to that spine and a nearby background region. For comparison of intensity values between imaging sessions, and to account for small variations in daily imaging conditions, spine signal intensity was normalized to the signal on the adjacent dendritic shaft following background subtraction. Each spine value was subsequently normalized to an average of the baseline imaging sessions by first subtracting the baseline value and then dividing over the sum of the baseline and respective imaging day value. This normalizes spine size change values between −1 and +1. All spine analysis was performed for each dendritic segment, averaged per genotype and is presented as the average of values from two adjacent imaging sessions (−3 and −2, −1 and 0, 1 and 2 and so on) to increase clarity.

    For analysis of spine clustering, spines were classified as either increasing, decreasing or stable based on their average change in size on days 1–4 compared with baseline. The threshold for these categories was set based on the variability in control mice and was defined at baseline ± 1 s.d. of size changes (±0.14). Nearest-neighbour analysis was calculated by finding the closest neighbour of every spine along each dendritic segment. Each nearest-neighbour pair was included once only in the dataset and pairs were excluded if their distance was either below 1.0 μm (to avoid overlapping ROIs) or above 3.5 μm. The fractions of nearest-neighbour spine pairs in which both spines increase, both decrease or changes occur in the same direction or in opposite directions were quantified to compare the degree of clustering between genotypes.

    To test the statistical significance of clustering, nearest-neighbour analysis was performed on a pool of randomized spines in which spine size change values were randomly shuffled along all spine positions in each dendrite. A Monte Carlo P value was calculated by summing the tail of the histograms from 10,000 pools of randomized spine pairings in which the nearest-neighbour analysis resulted in spine pair fractions that exceeded the real observed value.

    Statistics and reproducibility

    All graphed values are shown as mean ± s.e.m. Statistical details of experiments (statistical tests used, statistical values, exact n values) are listed in Supplementary Table 1. The number of animals included in each experiment was based on standards established in the literature. Statistics were performed using GraphPad Prism. Statistical significance was defined as P < 0.05. Tests for normality and equal variances were used to determine the appropriate statistical test to use. All reported t-tests were two-tailed, with Welch’s correction when group variances were significantly different. For experiments with more than two groups, one-way ANOVA was used; for experiments with more than one variable, two-way ANOVA was used; for experiments with repeated measurements from the same animals, two-way repeated-measures ANOVA was used. All representative images were selected from one of a minimum of three independently repeated experiments with similar results.

    Reporting summary

    Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

    [ad_2]

    Source link

  • Large-scale neurophysiology and single-cell profiling in human neuroscience

    [ad_1]

  • Burns, S. P., Xing, D. & Shapley, R. M. Comparisons of the dynamics of local field potential and multiunit activity signals in macaque visual cortex. J. Neurosci. 30, 13739–13749 (2010).

    Article 
    CAS 

    Google Scholar
     

  • Ahmadi, N., Constandinou, T. G. & Bouganis, C. S. Inferring entire spiking activity from local field potentials. Sci. Rep. 11, 19045 (2021).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Tseng, H. A. & Han, X. Distinct spiking patterns of excitatory and inhibitory neurons and LFP oscillations in prefrontal cortex during sensory discrimination. Front. Physiol. 12, 618307 (2021).

    Article 

    Google Scholar
     

  • Cho, K. K. et al. Gamma rhythms link prefrontal interneuron dysfunction with cognitive inflexibility in Dlx5/6+/− mice. Neuron 85, 1332–1343 (2015).

    Article 
    CAS 

    Google Scholar
     

  • Helfrich, R. F. & Knight, R. T. Oscillatory dynamics of prefrontal cognitive control. Trends Cogn. Sci. 20, 916–930 (2016).

    Article 

    Google Scholar
     

  • Kamigaki, T. & Dan, Y. Delay activity of specific prefrontal interneuron subtypes modulates memory-guided behavior. Nat. Neurosci. 20, 854–863 (2017).

    Article 
    CAS 

    Google Scholar
     

  • Pinto, L. & Dan, Y. Cell-type-specific activity in prefrontal cortex during goal-directed behavior. Neuron 87, 437–450 (2015).

    Article 
    CAS 

    Google Scholar
     

  • Lagler, M. et al. Divisions of identified parvalbumin-expressing basket cells during working memory-guided decision making. Neuron 91, 1390–1401 (2016).

    Article 
    CAS 

    Google Scholar
     

  • Kvitsiani, D. et al. Distinct behavioural and network correlates of two interneuron types in prefrontal cortex. Nature 498, 363–366 (2013).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Liebe, S., Hoerzer, G. M., Logothetis, N. K. & Rainer, G. Theta coupling between V4 and prefrontal cortex predicts visual short-term memory performance. Nat. Neurosci. 15, 456–462 (2012).

    Article 
    CAS 

    Google Scholar
     

  • Buschman, T. J., Denovellis, E. L., Diogo, C., Bullock, D. & Miller, E. K. Synchronous oscillatory neural ensembles for rules in the prefrontal cortex. Neuron 76, 838–846 (2012).

    Article 
    CAS 

    Google Scholar
     

  • Hsieh, H. L., Wong, Y. T., Pesaran, B. & Shanechi, M. M. Multiscale modeling and decoding algorithms for spike-field activity. J. Neural Eng. 16, 016018 (2019).

    Article 
    ADS 

    Google Scholar
     

  • Fu, Z. et al. The geometry of domain-general performance monitoring in the human medial frontal cortex. Science 376, eabm9922 (2022). This study is an example of using Behnke–Fried electrodes to collect single neuron activity in large patient cohorts.

    Article 
    CAS 

    Google Scholar
     

  • Steinmetz, N. A., Koch, C., Harris, K. D. & Carandini, M. Challenges and opportunities for large-scale electrophysiology with Neuropixels probes. Curr. Opin. Neurobiol. 50, 92–100 (2018).

    Article 
    CAS 

    Google Scholar
     

  • Chung, J. E. et al. High-density single-unit human cortical recordings using the Neuropixels probe. Neuron 110, 2409–2421.e3 (2022).

    Article 
    CAS 

    Google Scholar
     

  • Khanna, A. R. et al. Single-neuronal elements of speech production in humans. Nature 626, 603–610 (2024).

    Article 
    CAS 

    Google Scholar
     

  • Leonard, M. K. et al. This study highlights use of Neuropixels for investigating columnar processing in human speech encoding. Nature 626, 593–602 (2024). This study highlights the use of Neuropixels probes for investigating columnar processing in human speech encoding.

    Article 
    CAS 

    Google Scholar
     

  • Trautmann, E. M. et al. Large-scale high-density brain-wide neural recording in nonhuman primates. Preprint at bioRxiv https://doi.org/10.1101/2023.02.01.526664 (2023).

  • Tischbirek, C. H. et al. In vivo functional mapping of a cortical column at single-neuron resolution. Cell Rep. 27, 1319–1326.e5 (2019).

    Article 
    CAS 

    Google Scholar
     

  • Khodagholy, D. et al. NeuroGrid: recording action potentials from the surface of the brain. Nat. Neurosci. 18, 310–315 (2015).

    Article 
    CAS 

    Google Scholar
     

  • Tchoe, Y. et al. Human brain mapping with multithousand-channel PtNRGrids resolves spatiotemporal dynamics. Sci. Transl. Med. 14, eabj1441 (2022).

    Article 

    Google Scholar
     

  • Paulk, A. C. et al. Microscale physiological events on the human cortical surface. Cereb. Cortex 31, 3678–3700 (2021).

    Article 

    Google Scholar
     

  • Paulk, A. C. et al. Large-scale neural recordings with single neuron resolution using Neuropixels probes in human cortex. Nat. Neurosci. 25, 252–263 (2022). Refs. 15 and 23 were among the first studies to demonstrate the use of Neuropixels probes in human cortex.

    Article 
    CAS 

    Google Scholar
     

  • Bugeon, S. et al. A transcriptomic axis predicts state modulation of cortical interneurons. Nature 607, 330–338 (2022).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Pollen, A. A. et al. Low-coverage single-cell mRNA sequencing reveals cellular heterogeneity and activated signaling pathways in developing cerebral cortex. Nat. Biotechnol. 32, 1053–1058 (2014).

    Article 
    CAS 

    Google Scholar
     

  • Nowakowski, T. J. et al. Spatiotemporal gene expression trajectories reveal developmental hierarchies of the human cortex. Science 358, 1318–1323 (2017). This study applies next-generation single-cell RNA sequencing technologies to profile human cortical cell atlases in brain development.

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Darmanis, S. et al. A survey of human brain transcriptome diversity at the single cell level. Proc. Natl Acad. Sci. USA 112, 7285–7290 (2015).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Macosko, E. Z. et al. Highly parallel genome-wide expression profiling of individual cells using nanoliter droplets. Cell 161, 1202–1214 (2015). This study introduces a key method in development of next-generation single-cell RNA sequencing technologies.

    Article 
    CAS 

    Google Scholar
     

  • Langlieb, J. et al. The molecular cytoarchitecture of the adult mouse brain. Nature 624, 333–342 (2023).

  • Yao, Z. et al. A high-resolution transcriptomic and spatial atlas of cell types in the whole mouse brain. Nature 624, 317–332 (2023). This study uses single-cell RNA sequencing and spatial transcriptomics to map the entire mouse brain.

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Siletti, K. et al. Transcriptomic diversity of cell types across the adult human brain. Science 382, eadd7046 (2023). This study provides an initial draft of a cell atlas of the human brain.

    Article 
    CAS 

    Google Scholar
     

  • Clark, I. C. et al. Microfluidics-free single-cell genomics with templated emulsification. Nat. Biotechnol. 41, 1557–1566 (2023).

    Article 
    CAS 

    Google Scholar
     

  • Bakken, T. E. et al. Comparative cellular analysis of motor cortex in human, marmoset and mouse. Nature 598, 111–119 (2021). This study is an example that highlights unique cell-type-specific transcriptomic and physiologic properties of human neurons compared to model systems.

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Luo, C. et al. Single-cell methylomes identify neuronal subtypes and regulatory elements in mammalian cortex. Science 357, 600–604 (2017).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Ziffra, R. S. et al. Single-cell epigenomics reveals mechanisms of human cortical development. Nature 598, 205–213 (2021).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Luo, C. et al. Single nucleus multi-omics identifies human cortical cell regulatory genome diversity. Cell Genomics 2, 100107 (2022).

    Article 
    CAS 

    Google Scholar
     

  • Gatto, L. et al. Initial recommendations for performing, benchmarking and reporting single-cell proteomics experiments. Nat. Methods 20, 375–386 (2023).

    Article 
    CAS 

    Google Scholar
     

  • Alon, S. et al. Expansion sequencing: spatially precise in situ transcriptomics in intact biological systems. Science 371, eaax2656 (2021).

    Article 
    CAS 

    Google Scholar
     

  • Niu, M. et al. Droplet-based transcriptome profiling of individual synapses. Nat. Biotechnol. 41, 1332–1344 (2023).

    Article 
    CAS 

    Google Scholar
     

  • Zeng, H. What is a cell type and how to define it. Cell 185, 2739–2755 (2022).

    Article 
    CAS 

    Google Scholar
     

  • Fang, R. et al. Conservation and divergence of cortical cell organization in human and mouse revealed by MERFISH. Science 377, 56–62 (2022).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Zhang, D. et al. Spatial epigenome-transcriptome co-profiling of mammalian tissues. Nature 616, 113–122 (2023).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Wang, X. et al. Three-dimensional intact-tissue sequencing of single-cell transcriptional states. Science 361, eaat5691 (2018).

    Article 

    Google Scholar
     

  • Glasser, M. F. et al. A multi-modal parcellation of human cerebral cortex. Nature 536, 171–178 (2016).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Liharska, L. E. et al. A study of gene expression in the living human brain. Preprint at medRxiv https://doi.org/10.1101/2023.04.21.23288916 (2023).

  • Schneider, A. et al. Transcriptomic cell type structures in vivo neuronal activity across multiple timescales. Cell Rep. 42, 112318 (2023).

    Article 
    CAS 

    Google Scholar
     

  • Ting, J. T. et al. A robust ex vivo experimental platform for molecular-genetic dissection of adult human neocortical cell types and circuits. Sci. Rep. 8, 8407 (2018).

    Article 
    ADS 

    Google Scholar
     

  • Beaulieu-Laroche, L. et al. Enhanced dendritic compartmentalization in human cortical neurons. Cell 175, 643–651.e14 (2018).

    Article 
    CAS 

    Google Scholar
     

  • Moradi Chameh, H. et al. Diversity amongst human cortical pyramidal neurons revealed via their sag currents and frequency preferences. Nat. Commun. 12, 2497 (2021).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Kalmbach, B. E. et al. h-Channels contribute to divergent intrinsic membrane properties of supragranular pyramidal neurons in human versus mouse cerebral cortex. Neuron 100, 1194–1208.e5 (2018).

    Article 
    CAS 

    Google Scholar
     

  • Beaulieu-Laroche, L. et al. Allometric rules for mammalian cortical layer 5 neuron biophysics. Nature 600, 274–278 (2021).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Berto, S. et al. Gene-expression correlates of the oscillatory signatures supporting human episodic memory encoding. Nat. Neurosci. 24, 554–564 (2021).

    Article 
    CAS 

    Google Scholar
     

  • Mahalingam, G. et al. A scalable and modular automated pipeline for stitching of large electron microscopy datasets. eLife 11, e76534 (2022).

    Article 
    CAS 

    Google Scholar
     

  • Chen, X. et al. High-throughput mapping of long-range neuronal projection using in situ sequencing. Cell 179, 772–786.e19 (2019).

    Article 
    CAS 

    Google Scholar
     

  • Foss-Feig, J. H. et al. Searching for cross-diagnostic convergence: neural mechanisms governing excitation and inhibition balance in schizophrenia and autism spectrum disorders. Biol. Psychiatry 81, 848–861 (2017).

    Article 

    Google Scholar
     

  • Krystal, J. H. et al. Impaired tuning of neural ensembles and the pathophysiology of schizophrenia: a translational and computational neuroscience perspective. Biol. Psychiatry 81, 874–885 (2017).

    Article 
    CAS 

    Google Scholar
     

  • Opris, I. & Casanova, M. F. Prefrontal cortical minicolumn: from executive control to disrupted cognitive processing. Brain 137, 1863–1875 (2014).

    Article 

    Google Scholar
     

  • Li, Q. et al. Multimodal charting of molecular and functional cell states via in situ electro-sequencing. Cell 186, 2002–2017.e21 (2023).

    Article 
    CAS 

    Google Scholar
     

  • Billeh, Y. N. et al. Systematic integration of structural and functional data into multi-scale models of mouse primary visual cortex. Neuron 106, 388–403.e18 (2020).

    Article 
    CAS 

    Google Scholar
     

  • Buchin, A. et al. Multi-modal characterization and simulation of human epileptic circuitry. Cell Rep. 41, 111873 (2022).

    Article 
    CAS 

    Google Scholar
     

  • Winkler, E. A. et al. A single-cell atlas of the normal and malformed human brain vasculature. Science 375, eabi7377 (2022). This study describes an example of how an ex vivo platform can be utilized to study non-neuronal cell types in human brain and disease.

    Article 
    CAS 

    Google Scholar
     

  • Eugène, E. et al. An organotypic brain slice preparation from adult patients with temporal lobe epilepsy. J. Neurosci. Methods 235, 234–244 (2014).

    Article 

    Google Scholar
     

  • Schwarz, N. et al. Long-term adult human brain slice cultures as a model system to study human CNS circuitry and disease. eLife 8, e48417 (2019).

    Article 
    CAS 

    Google Scholar
     

  • Mich, J. K. et al. Functional enhancer elements drive subclass-selective expression from mouse to primate neocortex. Cell Rep. 34, 108754 (2021).

    Article 
    CAS 

    Google Scholar
     

  • Zhu, D. et al. Optimal trade-off control in machine learning-based library design, with application to adeno-associated virus (AAV) for gene therapy. Sci. Adv. 10, eadj3786 (2024).

    Article 

    Google Scholar
     

  • Mercuri, E., Pera, M. C., Scoto, M., Finkel, R. & Muntoni, F. Spinal muscular atrophy—insights and challenges in the treatment era. Nat. Rev. Neurol. 16, 706–715 (2020).

    Article 
    CAS 

    Google Scholar
     

  • Neuner, S. M., Tcw, J. & Goate, A. M. Genetic architecture of Alzheimer’s disease. Neurobiol. Dis. 143, 104976 (2020).

    Article 
    CAS 

    Google Scholar
     

  • Tabrizi, S. J., Flower, M. D., Ross, C. A. & Wild, E. J. Huntington disease: new insights into molecular pathogenesis and therapeutic opportunities. Nat. Rev. Neurol. 16, 529–546 (2020).

    Article 

    Google Scholar
     

  • Niestroj, L. M. et al. Epilepsy subtype-specific copy number burden observed in a genome-wide study of 17 458 subjects. Brain 143, 2106–2118 (2020).

    Article 

    Google Scholar
     

  • Epi4K Consortiu. De novo mutations in epileptic encephalopathies. Nature 501, 217–221 (2013).

    Article 
    ADS 

    Google Scholar
     

  • Wang, T. et al. Integrated gene analyses of de novo variants from 46,612 trios with autism and developmental disorders. Proc. Natl Acad. Sci. USA 119, e2203491119 (2022).

    Article 
    CAS 

    Google Scholar
     

  • Fu, J. M. et al. Rare coding variation provides insight into the genetic architecture and phenotypic context of autism. Nat. Genet. 54, 1320–1331 (2022).

    Article 
    CAS 

    Google Scholar
     

  • Singh, T. et al. Rare coding variants in ten genes confer substantial risk for schizophrenia. Nature 604, 509–516 (2022).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Liu, D. et al. Schizophrenia risk conferred by rare protein-truncating variants is conserved across diverse human populations. Nat. Genet. 55, 369–376 (2023).

    Article 
    CAS 

    Google Scholar
     

  • Lin, X. et al. Integrating genetic structural variations and whole-genome sequencing into clinical neurology. Neurol. Genet. 8, e200005 (2022).

    Article 

    Google Scholar
     

  • Neale, B. M. et al. Patterns and rates of exonic de novo mutations in autism spectrum disorders. Nature 485, 242–245 (2012).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Mitra, I. et al. Patterns of de novo tandem repeat mutations and their role in autism. Nature 589, 246–250 (2021).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Nishioka, M., Bundo, M., Iwamoto, K. & Kato, T. Somatic mutations in the human brain: implications for psychiatric research. Mol. Psychiatry 24, 839–856 (2019).

    Article 

    Google Scholar
     

  • Rehen, S. K. et al. Constitutional aneuploidy in the normal human brain. J. Neurosci. 25, 2176–2180 (2005).

    Article 
    CAS 

    Google Scholar
     

  • Wang, Y. et al. Comprehensive identification of somatic nucleotide variants in human brain tissue. Genome Biol. 22, 92 (2021).

    Article 
    CAS 

    Google Scholar
     

  • Luquette, L. J. et al. Single-cell genome sequencing of human neurons identifies somatic point mutation and indel enrichment in regulatory elements. Nat. Genet. 54, 1564–1571 (2022).

    Article 
    CAS 

    Google Scholar
     

  • Chung, C. et al. Comprehensive multi-omic profiling of somatic mutations in malformations of cortical development. Nat. Genet. 55, 209–220 (2023).

    Article 
    CAS 

    Google Scholar
     

  • Hua, Y. & Crino, P. B. Single cell lineage analysis in human focal cortical dysplasia. Cereb. Cortex 13, 693–699 (2003).

    Article 

    Google Scholar
     

  • Rivière, J. B. et al. De novo germline and postzygotic mutations in AKT3, PIK3R2 and PIK3CA cause a spectrum of related megalencephaly syndromes. Nat. Genet. 44, 934–940 (2012).

    Article 

    Google Scholar
     

  • Poduri, A. et al. Somatic activation of AKT3 causes hemispheric developmental brain malformations. Neuron 74, 41–48 (2012).

    Article 
    CAS 

    Google Scholar
     

  • Ribierre, T. et al. Second-hit mosaic mutation in mTORC1 repressor DEPDC5 causes focal cortical dysplasia-associated epilepsy. J. Clin. Invest. 128, 2452–2458 (2018).

    Article 

    Google Scholar
     

  • Baldassari, S. et al. Dissecting the genetic basis of focal cortical dysplasia: a large cohort study. Acta Neuropathol. 138, 885–900 (2019).

    Article 
    CAS 

    Google Scholar
     

  • Wirrell, E. C. et al. Optimizing the diagnosis and management of dravet syndrome: recommendations from a North American consensus panel. Pediatr. Neurol. 68, 18–34.e3 (2017).

    Article 

    Google Scholar
     

  • Gratuze, M., Leyns, C. E. G. & Holtzman, D. M. New insights into the role of TREM2 in Alzheimer’s disease. Mol. Neurodegener. 13, 66 (2018).

    Article 
    CAS 

    Google Scholar
     

  • Ulland, T. K. & Colonna, M. TREM2—a key player in microglial biology and Alzheimer disease. Nat. Rev. Neurol. 14, 667–675 (2018).

    Article 
    CAS 

    Google Scholar
     

  • Braasch, D. A., Liu, Y. & Corey, D. R. Antisense inhibition of gene expression in cells by oligonucleotides incorporating locked nucleic acids: effect of mRNA target sequence and chimera design. Nucleic Acids Res. 30, 5160–5167 (2002).

    Article 
    CAS 

    Google Scholar
     

  • Bladen, C. L. et al. The TREAT-NMD DMD Global Database: analysis of more than 7,000 Duchenne muscular dystrophy mutations. Hum. Mutat. 36, 395–402 (2015).

    Article 
    CAS 

    Google Scholar
     

  • Finkel, R. S. et al. Treatment of infantile-onset spinal muscular atrophy with nusinersen: a phase 2, open-label, dose-escalation study. Lancet 388, 3017–3026 (2016).

    Article 
    CAS 

    Google Scholar
     

  • Hampel, H. et al. The foundation and architecture of precision medicine in neurology and psychiatry. Trends Neurosci. 46, 176–198 (2023).

    Article 
    CAS 

    Google Scholar
     

  • Knowles, J. K. et al. Precision medicine for genetic epilepsy on the horizon: recent advances, present challenges, and suggestions for continued progress. Epilepsia 63, 2461–2475 (2022).

    Article 

    Google Scholar
     

  • Varma, V. R. et al. Brain and blood metabolite signatures of pathology and progression in Alzheimer disease: a targeted metabolomics study. PLoS Med. 15, e1002482 (2018).

    Article 

    Google Scholar
     

  • Noori, A., Mezlini, A. M., Hyman, B. T., Serrano-Pozo, A. & Das, S. Systematic review and meta-analysis of human transcriptomics reveals neuroinflammation, deficient energy metabolism, and proteostasis failure across neurodegeneration. Neurobiol. Dis. 149, 105225 (2021).

    Article 
    CAS 

    Google Scholar
     

  • Quazi, S. Artificial intelligence and machine learning in precision and genomic medicine. Med. Oncol. 39, 120 (2022).

    Article 

    Google Scholar
     

  • Ingusci, S., Verlengia, G., Soukupova, M., Zucchini, S. & Simonato, M. Gene therapy tools for brain diseases. Front. Pharmacol. 10, 724 (2019).

    Article 
    CAS 

    Google Scholar
     

  • Zhu, D., Schieferecke, A. J., Lopez, P. A. & Schaffer, D. V. Adeno-associated virus vector for central nervous system gene therapy. Trends Mol. Med. 27, 524–537 (2021).

    Article 
    CAS 

    Google Scholar
     

  • Sugarman, E. A. et al. Pan-ethnic carrier screening and prenatal diagnosis for spinal muscular atrophy: clinical laboratory analysis of >72,400 specimens. Eur. J. Hum. Genet. 20, 27–32 (2012).

    Article 

    Google Scholar
     

  • Mendell, J. R. et al. Single-dose gene-replacement therapy for spinal muscular atrophy. N. Engl. J. Med. 377, 1713–1722 (2017).

    Article 
    CAS 

    Google Scholar
     

  • Mendell, J. R. et al. Current clinical applications of in vivo gene therapy with AAVs. Mol. Ther. 29, 464–488 (2021).

    Article 
    CAS 

    Google Scholar
     

  • Chien, Y. H. et al. Efficacy and safety of AAV2 gene therapy in children with aromatic l-amino acid decarboxylase deficiency: an open-label, phase 1/2 trial. Lancet Child Adolesc. Health 1, 265–273 (2017).

    Article 

    Google Scholar
     

  • Leone, P. et al. Long-term follow-up after gene therapy for canavan disease. Sci. Transl. Med. 4, 165ra163 (2012).

    Article 

    Google Scholar
     

  • Chan, K. Y. et al. Engineered AAVs for efficient noninvasive gene delivery to the central and peripheral nervous systems. Nat. Neurosci. 20, 1172–1179 (2017).

    Article 
    CAS 

    Google Scholar
     

  • Challis, R. C. et al. Adeno-associated virus toolkit to target diverse brain cells. Annu. Rev. Neurosci. 45, 447–469 (2022).

    Article 
    CAS 

    Google Scholar
     

  • Byrne, L. C. et al. In vivo-directed evolution of adeno-associated virus in the primate retina. JCI Insight 5, e135112 (2020).

    Article 

    Google Scholar
     

  • Hendriks, S. et al. Ethical challenges of risk, informed consent, and posttrial responsibilities in human research with neural devices: a review. JAMA Neurol. 76, 1506–1514 (2019).

    Article 

    Google Scholar
     

  • Loyola-Gonzalez, O. Black-box vs. white-box: understanding their advantages and weaknesses from a practical point of view. IEEE Access 7, 154096–154113 (2019).

    Article 

    Google Scholar
     

  • McLean, S. et al. The risks associated with artificial general intelligence: a systematic review. J. Exp. Theor. Artif. Intell. 35, 649–663 (2023).

    Article 

    Google Scholar
     

  • Feinsinger, A. et al. Ethical commitments, principles, and practices guiding intracranial neuroscientific research in humans. Neuron 110, 188–194 (2022).

    Article 
    CAS 

    Google Scholar
     

  • Kaiser, J. & Brainard, J. Ready, set, share. Science 379, 322–325 (2023).

    Article 
    ADS 

    Google Scholar
     

  • von Thenen, N., Ayday, E. & Cicek, A. E. Re-identification of individuals in genomic data-sharing beacons via allele inference. Bioinformatics 35, 365–371 (2019).

    Article 

    Google Scholar
     

  • Jansen, P. R. et al. Genome-wide analysis of insomnia in 1,331,010 individuals identifies new risk loci and functional pathways. Nat. Genet. 51, 394–403 (2019).

    Article 
    CAS 

    Google Scholar
     

  • Choudhury, S., Fishman, J. R., McGowan, M. L. & Juengst, E. T. Big data, open science and the brain: lessons learned from genomics. Front. Hum. Neurosci. 8, 239 (2014).

    Article 

    Google Scholar
     

  • Van Horn, J. D. & Ball, C. A. Domain-specific data sharing in neuroscience: what do we have to learn from each other. Neuroinformatics 6, 117–121 (2008).

    Article 

    Google Scholar
     

  • Ford, D. et al. Genetic heterogeneity and penetrance analysis of the BRCA1 and BRCA2 genes in breast cancer families. Am. J. Hum. Genet. 62, 676–689 (1998).

    Article 
    CAS 

    Google Scholar
     

  • Maury, E. A. et al. Schizophrenia-associated somatic copy-number variants from 12,834 cases reveal recurrent NRXN1 and ABCB11 disruptions. Cell Genomics 3, 100356 (2023).

    Article 
    CAS 

    Google Scholar
     

  • Paré, G. et al. Effects of CYP2C19 genotype on outcomes of clopidogrel treatment. N. Engl. J. Med. 363, 1704–1714 (2010).

    Article 

    Google Scholar
     

  • Mellinghoff, I. K. et al. Vorasidenib in IDH1– or IDH2-mutant low-grade glioma. N. Engl. J. Med. 389, 589–601 (2023).

    Article 
    CAS 

    Google Scholar
     

  • Wong, C. UK first to approve CRISPR treatment for diseases: what you need to know. Nature 623, 676–677 (2023).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Mathys, H. et al. Single-cell transcriptomic analysis of Alzheimer’s disease. Nature 570, 332–337 (2019).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Yang, A. C. et al. A human brain vascular atlas reveals diverse mediators of Alzheimer’s risk. Nature 603, 885–892 (2022).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Cain, A. et al. Multicellular communities are perturbed in the aging human brain and Alzheimer’s disease. Nat. Neurosci. 26, 1267–1280 (2023).

    Article 
    CAS 

    Google Scholar
     

  • Yuste, R. et al. A community-based transcriptomics classification and nomenclature of neocortical cell types. Nat. Neurosci. 23, 1456–1468 (2020).

    Article 
    CAS 

    Google Scholar
     

  • Speir, M. L. et al. UCSC Cell Browser: visualize your single-cell data. Bioinformatics 37, 4578–4580 (2021).

    Article 
    CAS 

    Google Scholar
     

  • Wan, Z. et al. Sociotechnical safeguards for genomic data privacy. Nat. Rev. Genet. 23, 429–445 (2022).

    Article 
    CAS 

    Google Scholar
     

  • Ngai, J. BRAIN 2.0: transforming neuroscience. Cell 185, 4–8 (2022).

    Article 
    CAS 

    Google Scholar
     

  • Reardon, J. et al. Trustworthiness matters: building equitable and ethical science. Cell 186, 894–898 (2023).

    Article 
    CAS 

    Google Scholar
     

  • Kowal, E. et al. Community partnerships are fundamental to ethical ancient DNA research. HGG Adv. 4, 100161 (2023).

    CAS 

    Google Scholar
     

  • Shim, J. K. et al. Community engagement in precision medicine research: organizational practices and their impacts for equity. AJOB Empir. Bioeth. 14, 185–196 (2023).

    Article 

    Google Scholar
     

  • Han, H. R. et al. Exploring community engaged research experiences and preferences: a multi-level qualitative investigation. Res. Involv. Engagem. 7, 19 (2021).

    Article 

    Google Scholar
     

  • Vollger, M. R. et al. Segmental duplications and their variation in a complete human genome. Science 376, eabj6965 (2022).

    Article 
    CAS 

    Google Scholar
     

  • Wang, T. et al. The Human Pangenome Project: a global resource to map genomic diversity. Nature 604, 437–446 (2022).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Hodge, R. D. et al. Conserved cell types with divergent features in human versus mouse cortex. Nature 573, 61–68 (2019).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Berg, J. et al. Human neocortical expansion involves glutamatergic neuron diversification. Nature 598, 151–158 (2021).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Jorstad, N. L. et al. Transcriptomic cytoarchitecture reveals principles of human neocortex organization. Science 382, eadf6812 (2023).

    Article 
    CAS 

    Google Scholar
     

  • Elston, G. N. Cortex, cognition and the cell: new insights into the pyramidal neuron and prefrontal function. Cereb. Cortex 13, 1124–1138 (2003).

    Article 

    Google Scholar
     

  • Hill, R. S. & Walsh, C. A. Molecular insights into human brain evolution. Nature 437, 64–67 (2005).

    Article 
    ADS 
    CAS 

    Google Scholar
     

  • Markov, N. T. et al. Cortical high-density counterstream architectures. Science 342, 1238406 (2013).

    Article 

    Google Scholar
     

  • Nowakowski, T. J., Pollen, A. A., Sandoval-Espinosa, C. & Kriegstein, A. R. Transformation of the radial glia scaffold demarcates two stages of human cerebral cortex development. Neuron 91, 1219–1227 (2016).

    Article 
    CAS 

    Google Scholar
     

  • Huttenlocher, P. R. & Dabholkar, A. S. Regional differences in synaptogenesis in human cerebral cortex. J. Comp. Neurol. 387, 167–178 (1997).

    Article 
    CAS 

    Google Scholar
     

  • Vanderhaeghen, P. & Polleux, F. Developmental mechanisms underlying the evolution of human cortical circuits. Nat. Rev. Neurosci. 24, 213–232 (2023).

    Article 
    CAS 

    Google Scholar
     

  • Roberts, R. J. V., Pop, S. & Prieto-Godino, L. L. Evolution of central neural circuits: state of the art and perspectives. Nat. Rev. Neurosci. 23, 725–743 (2022).

    Article 
    CAS 

    Google Scholar
     

  • Kebschull, J. M. et al. Cerebellar nuclei evolved by repeatedly duplicating a conserved cell-type set. Science 370, eabd5059 (2020).

    Article 
    CAS 

    Google Scholar
     

  • Defelipe, J. The evolution of the brain, the human nature of cortical circuits, and intellectual creativity. Front. Neuroanat. 5, 29 (2011).

    Article 

    Google Scholar
     

  • [ad_2]

    Source link

  • Author Correction: Restoration of vision after transplantation of photoreceptors

    [ad_1]

    a, Schematic of water-maze apparatus (adapted from ref. 22; see Supplementary Information). Mice were trained to associate striped grating with escape from water by a hidden platform. An animal ‘passes’ a trial by crossing the red line (decision point) on the side of the divider with the striped grating. b, Pass rate of Nrl-GFP-treated (black), sham-injected (dark grey) and non-injected (mid grey) Gnat1−/− and non-injected wild-type (light grey) mice. Nrl-GFP-treated animals with a pass-rate of at least 70% are shown in green throughout. Mouse numbers in red refer to mice shown in Supplementary Movie. c, Average performance rate of all groups. d, Visual acuity and e, contrast sensitivity measurements for responders from Nrl-GFP-treated (green) and wild-type (light grey) groups. f, Swim-time latencies (time-to-platform) for all (light grey) and correct choice-only (dark grey) trials. g, Ability to solve water-maze task plotted against integrated Nrl-GFP photoreceptor number. h, Examples of integration in animals that successfully (top; Nrl-GFP-treated, number 6) or unsuccessfully (bottom; Nrl-GFP-treated, number 5) solved the task, as indicated in g (circled, red). These panel images are cropped from montages composed of multiple smaller images manually assembled across overlapping areas. Scale bar, 100 µm. ik, Pass rate (i), visual acuity (j) and contrast sensitivity (k) for Nrl-GFP-treated (light grey bars) and sham-injected (dark grey bars) Gnat1−/− mice before and after transplantation under photopic conditions. Means ± s.e.m.; ANOVA; n, number of animals.

    [ad_2]

    Source link

  • Senescent glia link mitochondrial dysfunction and lipid accumulation

    [ad_1]

    Fly stocks and maintenance

    Flies were raised at 25 °C and 60% relative humidity on standard cornmeal fly food under a 12–12 h light–dark cycle. All experiments were performed with male flies to minimize biological variance, as male and female flies age at notably different rates. Flies were transferred to fresh food vials every 48 h, housed in cohorts of 20 and randomly assigned to experimental conditions. For geneSwitch (inducible GAL4-UAS)41 experiments, food was prepared with either 100 μl of RU-486 (4 mg ml−1 in 100% EtOH; Sigma-Aldrich, M8046-1G) or vehicle (100% EtOH), pipetted onto food vials and allowed to dry for 24 h. See Supplementary Table 1 in the Supplementary Information for genotypes and stock information.

    For neuronally expressed UAS-RNAi experiments, flies were collected onto RU-486 food at adult eclosion (0 days of age) and reared at 29 °C.

    For AP1 blockade experiments, flies were collected onto vehicle or RU-486 food at adult eclosion (0 days of age). Animals were maintained on RU-486 continuously (7 days per week) or intermittently (3 or 1 day per week) by flipping flies to vehicle food. All experiments and sample collection for 1 day per week RU-486 treated flies were performed with animals on vehicle food, specifically at 6 days after last RU-486 feeding to ensure geneSwitch termination41. Controls were selected on the basis of assay. For BODIPY experiments, genotype-matched vehicle-fed animals were used as controls, as GFP interferes with BODIPY detection.

    Behavioural assays

    To measure survival, the number of dead and/or censored flies was recorded every 2 days after flipping flies to fresh food; flies were housed in vials of 20 each, with a minimum of 100 flies per genotype and experiment, repeated a minimum of two times. To measure climbing, flies were single-housed in empty vials and allowed to acclimate for 30 min. Climbing was measured by tapping flies to the bottom of the vial then recording height climbed after 30 s over three trials with a 5 min testing interval. Averaged climbing height was determined in Fiji. Data are expressed as a percentage of the maximum vial height (8 cm). Heat shock assessment was performed as described in ref. 61. In brief, flies were transferred to clear plastic 13 ml vials, and each vial contained 15 flies. Vials plus flies were transferred to a water bath for 1 h at 38.5 °C for stress. The flies were then transferred to fresh food and allowed to recover overnight at 25 °C then the percentage of flies alive versus dead were recorded per vial. Oxidative stress (H2O2 feeding): adult flies were single-housed and loaded in the Drosophila Activity Monitoring system on either 5% sucrose-agar or 1% H2O2 sucrose-agar. Activity was recorded for 10 days then analysed in the R environment using the rethomics package62 to determine time of animal death and generate survival curves.

    FACS-based isolation of AP1+ glia, AP1neg glia and neurons for bulk RNA-seq or lipidomic analysis

    All work was performed in RNAse-free conditions. To create a cell suspension for FACS-based sorting, adult fly brains (n = 20 brains per replicate for RNA-seq; n = 40 brains per replicate for lipidomic analysis) were rapidly dissected in Schneider’s medium with 45 μM actinomycin D and stored on ice until dissections were complete. Brains were then washed in cold phosphate-buffered saline (PBS) (3×). A single cell suspension was achieved by enzymatic and physical dissociation as follows: whole brains were incubated in dissociation buffer (300 μl of activated papain, Worthington PAP2 LK003178 and 4.1 μl liberase, Roche 5401119001) at 25 °C at 1,000 rpm on a shaker for a total of 20 min. During incubation, at 5 and 10 min, tissue was gently homogenized by pipetting. At 15 min, the entire homogenate was passed through a 25G 5/8 needle (7×). At 20 min, enzymatic activity was halted by the addition of cold Schneider’s medium. Cells were then strained (35 μM filter), pelleted (800g, 7 min) and resuspended in cold Schneider’s medium with actinomycin D and 2.5 μl of RNAse inhibitor (Takara Recombinant RNase Inhibitor, catalogue no. 2313A). Cells were resuspended in 250 μl, counterstained with 5 μM 4,6-diamidino-2-phenylindole (DAPI) and 50 nM syto60 (nuclear marker; ThermoFisher, catalogue no. S11342) and sorted by the Penn Cytomics and Cell Sorting Facility using a BD FACS Aria II SORP (100 μM nozzle; purity). Dead cells were excluded through DAPI uptake. Doublets were excluded through FSC-H by FSC-W and SSC-H by SSC-W parameters. Nucleated cells were included by syto60. Glia were identified by GFP, and neurons were GFP negative. AP1 activity was identified by dsRed. The gating strategy is shown in Extended Data Fig. 1c.

    For bulk RNA-seq, 500 neurons, 500 AP1+ glia and 500 AP1neg glia were collected per replicate, with four replicates per cell type. For lipidomic profiling, 100,000 neurons, 100,000 AP1neg glia and 35,000 AP1+ glia were collected per replicate, with 5–6 replicates per cell type. Cells were immediately frozen at −80 °C until further processing. Total processing of tissue and cell isolation took roughly 3 h. Data from the sort were analysed using FlowJo v.10.8.1. To generate cell and DNA content plots, cell populations with different N were overlaid using absolute cell counts normalized to mode (to the peak height at mode of the distribution).

    For immunostained FACS-isolated cells, following dissociation and resuspension as above, cells were fixed in 4% paraformaldehyde for 15 min at room temperature. Cells were washed then resuspended in 5% normal goat serum (NGS) for 5 min on ice. Cells were next incubated in primary antibody (1:20 mouse anti-γH2Av, DSHB UNC93-5.2.1) for 30 min at room temperature, washed and incubated in secondary antibody (1:200 goat antimouse AlexaFluor 647, ThermoFisher Scientific, catalogue no. A-21235) for 30 min at room temperature. Gating parameters were as above. Cells were immediately analysed using a BD FACS Aria II SORP as above.

    Bulk RNA-seq and analysis

    For sorted cells, RNA isolation, library preparation (SMART-Seq v.4) and RNA-seq (Illumina 2 × 150 40 million paired-end reads per sample; 20 million each direction) were performed by Admera Health. For whole brains, roughly 10–12 brains were dissected per condition. Total RNA was extracted using the Zymo RNA clean & concentrator−5 kit (Zymo, R1013), using their RNA clean-up from the aqueous phase after Trizol/chloroform extraction protocol plus on-column DNaseI treatment. RNA amount was measured by nanodrop, and integrity was validated by an Agilent 2100 Bioanalyzer using an RNA nano chip. The RNA-seq libraries (TruSeq stranded with Poly-A selection) and sequencing (Illumina NovaSeq S4 with 40 million paired-end reads; 2 × 150 bp) were performed by Admera Health. Four biological replicates were generated for each sample type, experimental timepoint, condition and genotype.

    Demultiplexed reads passing the quality control filter (Q > 30) were obtained from BaseSpace then merged across sequencing lanes for each sample, with roughly 20 million reads total per sample. Paired-end reads were aligned to the fly genome using HISAT2 (v.2.1.0)63. The HISAT2 index was built from FlyBase’s Drosophila melanogaster reference genome r6.17. Alignment sorted BAM files (samtools v.15) for each sample were merged across sequencing runs (picard)64. Reads that uniquely aligned to exonic regions were counted with HTSeq (v.0.9.1)65 with the union setting to produce a count matrix for differential expression analysis using the DESeq2 (ref. 66) package in the R environment. The design model formula was ‘~group’ if there were two or more key variables involved (that is, genotype and age) or design model formula was the single key variable (that is, genotype). Pairwise comparisons were made between samples (that is, ‘contrast=c(’group’)’), with an alpha cut-off of 0.05 with lfcShrink() applied. Gene ontology and Reactome pathway enrichment were performed with tools at Flymine.org, using all expressed genes as background (n roughly 15,694). Refer to indicated Supplementary Data for differentially expressed genes between samples and/or groups across experiments.

    Unbiased lipidomics for multiple reaction monitoring profiling and analysis

    For lipidomic profiling cells were FACS-isolated as above. Brains were rapidly dissected in PBS, pelleted by centrifugation and excess PBS was removed for freezing at −80 °C until further processing (n = 8 brains per replicate; 5–6 replicates per genotype and/or age). Lipid extracts from FACS-sorted cells and whole-brain samples were prepared using a slightly modified Bligh & Dyer extraction procedure67. In brief, the frozen samples were thawed for 10 min at room temperature, and 200 μl of ultrapure water was added to promote lysis, followed by 450 μl of methanol and 250 μl of high-performance liquid chromatography-grade chloroform. Samples were vortexed for 10 s, resulting in a one-phase solution, and incubated at 4 °C for 15 min. Next, 250 μl of ultrapure water and 250 μl of chloroform were added, creating a biphasic solution. The samples were centrifuged at 14,000g for 10 min, which resulted in three phases in the tubes. The bottom organic phase containing the lipids was transferred to new tubes, then evaporated in a vacuum concentrator leaving behind the dried lipid extracts.

    Multiple reaction monitoring profiling of the extracted lipids was performed as described previously68. The dried lipid extracts were dissolved in 100 μl of methanol:chloroform (3:1 v/v) to make lipid stock solutions. The lipids were further diluted threefold in the injection solvent 7:3 methanol:acetonitrile with 10 mM ammonium formate immediately before analysis. The injection solvent alone without any lipids was used as the ‘blank’ sample.

    Mass spectrometry data were acquired for 3 min by flow injection (that is, no chromatographic separation). Briefly, 8 μl of diluted lipid extract stock solution delivered to the jet stream technology ion source (AJS) source of an Agilent 6495C Triple Quadrupole mass spectrometer. Multiple reaction monitoring methods were organized into 11 methods on the basis of the ten main lipid classes based on the LipidMaps database; see Extended Data Fig. 9d for total n of lipids screened and Supplementary Data 17 for individual species. TAGs were divided into two separate methods on the basis of fatty acid neutral loss residues.

    Statistical analysis was performed using the EdgeR package69. EdgeR uses a generalized linear model to identify differentially expressed lipids. The generalized linear model is based on the negative binomial distribution that incorporates the blank with a dispersion term using the common dispersion method70. This allows it to model the technical and biological variability. This method was previously described in detail in ref. 68. Significant lipids were chosen on the basis of a false discovery rate value <0.1 (ref. 71).

    Whole-mount brain immunofluorescence

    A standard protocol was used for fixation and staining. In brief, adult fly brains were dissected in cold PBS and fixed in 4% paraformaldehyde (v/v) for 50 min at room temperature. Brains were washed and permeabilized in PBS-0.1% Triton-X (PBST; 3×, 10 min). Samples were blocked in PBST-5% NGS at room temperature for 1 h, then incubated for 24–48 h at 4 °C with 1° antibody (1:25 mouse anti-repo, DSHB 8D12; 1:20 rat anti-elav, DSHB 7E8A10). Brains were washed in PBST then incubated with fluorescently conjugated 2° antibody for 1 h at room temperature. For AP1 activity (all genotypes containing TRE-dsRed) and tdTomato, endogenous fluorophore luminescence was measured without additional antibody staining. Brains were counterstained with Hoechst (0.10 mg ml−1 in PBS) for 15 min, cleared in mounting media (20 mM Tris pH 8.0, 0.5% N-propyl gallate, 80% glycerol, PBS), mounted in mounting media and cover slipped. Brains were imaged by confocal microscopy (Leica DM 6000 CS) with identical laser power and gain settings across experiments. Images were acquired throughout the full brain at 2 μM steps at 1,024 × 1,024 resolution by ×20 (dry) or ×63 (oil) objectives.

    For BODIPY, brains were dissected and fixed as above then incubated for 24–48 h at room temperature in 1:250 dilution of 10 mg ml−1 BODIPY 493/503 (Invitrogen D3922) prepared in NGS. Brains were washed in PBST, counterstained with Hoechst and prepared for imaging as above.

    For DHE, fly brains were rapidly dissected in cold Schneider’s medium, incubated in 60 μM DHE (ThermoFisher, catalogue no. D11347) for 7 min at room temperature shaking. Brains were washed in Schneider’s medium (2×, 5 min) then PBS (1×, 5 min), mounted in mounting media and imaged immediately (excitation 488 nm, emission 515–656 nm).

    Fiji v.2.0 was used for analysing all images. For TRE-dsRed quantification, dsRed was measured in Fiji as raw integrated density in scaled images of the z stacked brain. For BODIPY 493/503 quantification, background was first subtracted from scaled images of the z stacked brains. Automatic thresholding was applied and Analyze Particles (Analyze>Analyze Particles) was used to determine the number, average size and total area of BODIPY+ droplets.

    Whole-mount brain immunohistochemistry for SA-β-Gal activity

    A protocol was adapted72 for staining in fixed dissected whole Drosophila brains. In brief, adult fly brains were dissected in cold PBS and fixed in 2% paraformaldehyde and 0.2% glutaraldehyde (v/v) for 30 min at room temperature. Brains were washed in PBS (3×, 5 min) then incubated in 150 μl of X-Gal staining solution (40 mM citric acid phosphate buffer, 5 mM potassium hexanocyanoferrate(II) trihydrate, 5 mM potassium hexanocyanoferrate(III), 150 mM NaCl, 2 mM MgCl2-6H2O, 2.44 mM x-Gal) at 37 °C in the dark shaking (300 rpm) for a predetermined time on the basis of genotype (roughly 12–24 h). Brains were washed in PBS (3×, 5 min) and cleared in mounting media as above overnight. Brains were imaged on APO16 microscope and staining was quantified in Fiji v.2.0 by converting to a red, green and blue stack and measuring area and median value in the red channel only. Inverted density was calculated by subtracting median grey value from 255 and normalized to controls processed in parallel to account for variability across experiments.

    Western immunoblot

    Fly brains were rapidly dissected in cold PBS (n = 8 brains per biological replicate), then homogenized in 5 μl of sample buffer per brain (1× Laemmli Buffer (Bio-Rad, catalogue no. 161-0737), 1× cOmplete mini EDTA-free protease inhibitor cocktail, 1 mM phenylmethylsulfonyl fluoride (Sigma, catalogue no. P7626), 50 μl β-mercaptoethanol (BME): Sigma, catalogue no. M6250). Samples were denatured (98 °C for 3 min) before loading onto 4–12% Bis-Tris gel. Volume equivalent of one brain per sample was run in 1× MES buffer, transferred to 0.45 μM nitrocellulose membrane overnight by electrophoresis. Membranes were stained by Ponceau S to confirm transfer. Membranes were blocked in 3% bovine serum albumin in 1× Tris-buffered saline, 0.1% Tween 20 detergent, incubated in primary antibody overnight at 4 °C (1:200 mouse anti-γH2Av, DSHB UNC93-5.2.1; 1:2,000 mouse anti-tubulin, DSHB AA4.3). Blots were incubated with 1:5,000 dilution of species-appropriate HRP-conjugated secondary antibody for 1 h at room temperature, then detected by ECL (Cytiva (formerly GE Healthcare Life Sciences), catalogue no. RPN2232) using an Amersham Imager 600. Quantification was performed in Fiji by region of interest. Sample protein was normalized to the loading control alpha tubulin. Mammalian cells were lysed in modified RIPA buffer and blotted using standard techniques as previously described73 using an antibody to JUN (1:1,000; Cell Signaling Technology, catalogue no. 9165).

    Cell proliferation by EdU labelling

    Flies were maintained on 0.2 mM EdU food from eclosion through dissection. EdU staining was performed according to the manufacturer’s protocol (Click-iT EdU Imaging Kit; ThermoFisher, catalogue no. mp10338). In brief, brains were dissected and fixed as above for immunohistochemistry. Following permeabilization, brains were incubated in Click-iT reaction mixture overnight at 4 °C. Brains were washed, counterstained with Hoechst, cleared, mounted and imaged as above.

    Mitochondrial function assay

    The ratio of ATP/cytotoxicity was determined using the Promega Mitochondrial ToxGlo Assay (G8001). The manufacturer’s instructions were followed. Assay lysates consisted of individual dissected fly brains (n = 3–4 brains per genotype or condition) across a minimum of three experiments. Samples were always normalized to parallel processed controls.

    mtDNA PCR

    A protocol was adapted for measuring mtDNA in adult fly heads34. For head collection, whole flies were anaesthetized by CO2, frozen by submersion in liquid nitrogen, then vortexed to separate heads from bodies. Total cellular DNA was extracted by homogenizing five heads (per replicate) in 30 µl working solution (10 mM Tris-HCl, pH 8.0, 1 mM EDTA, 0.1% Triton-X-100 and 10 μg ml−1 protease K). Samples were then incubated at 37 °C for 60 min, and followed by inactivation of protease K at 95 °C for 10 min. Head cuticles were pelleted by centrifuging samples at 12,000g for 10 min at room temperature. Supernatants were transferred into a new tube, before measuring DNA concentration by Nanodrop. mtDNA was quantified using nuclear DNA (GAPDH) as control in real-time quantitative PCR (qPCR). Primer sequences: mtDNA-F1, GAATTAGGACATCCTGGAGC and mtDNA-R1, GCACTAATCAATTTCCAAATCC; GAPDH-F1, GACGAAATCAAGGCTAAGGTCG and GAPDH-R1, AATGGGTGTCGCTGAAGAAGTC.

    Real-time qPCR

    Total RNA was isolated from fly brains or heads (n = 8–20 per replicate) by RNeasy Mini Kit (Qiagen, catalogue no. 74104), with on-column removal of genomic DNA (Qiagen, catalogue no. 79254). Complementary DNA (cDNA) was prepared from total RNA (Applied Biosystems, catalogue no. 4368814) then quantified by Qubit ssDNA Assay (Invitrogen, catalogue no. Q10212). Real-time qPCR reactions were set up using Fast SYBR Green reagents (ThermoFisher, catalogue no. 4385612) in 384-well plates with 20 ng of cDNA per reaction and analysed on a ViiA 7 Real-Time PCR System (Applied Biosystems). Relative expression was determined using the ∆∆CT method. For each sample, mean CT values were determined from 2–3 technical replicates. ∆CT was determined relative to the housekeeping gene, β-tubulin. ∆∆CT was then calculated as fold change relative to the control group. Real-time qPCR primers were sourced from FlyPrimerBank74 or previous publications, BLASTd against the Drosophila genome for specificity and optimized by serial dilution curve and melt curve analysis. See Supplementary Table 2 for primer sequences.

    Mammalian cell culture

    IMR90 primary human fibroblasts (ATCC CCL-186) were grown at 37 °C, 3.5% O2, 5% CO2, in Dulbecco’s modified Eagle’s medium (Gibco, catalogue no. 10313-121) with 10% FBS (Corning, catalogue no. 35-011-CV), 1% penicillin–streptomycin (Gibco, catalogue no. 15140-122) and 2 mM glutamine (Gibco, catalogue no. 25030-081). Cultures were checked routinely for mycoplasma contamination. Irradiation senescence was induced by 20 Gray of X-ray irradiation of 20–30% confluent cells. Cells were split after returning to confluence 3 days after irradiation. On days 4 and 7 after irradiation, cells were transfected with a pool of four small-interfering RNA against JUN (Dharmacon siGENOME) or non-targeting control (siNTC #3, Dharmacon siGENOME) to a final concentration of 100 nM with 0.8% Dharmafect reagent following the manufacturer’s protocol. Medium was changed 18–20 h after each transfection. Medium from days 8–10 after irradiation, or from normal proliferating IMR90 cells cultured in parallel, was collected, centrifuged at 500g for 3 min to remove whole cells and large debris, then added to 20–30% confluent proliferating IMR90 cells plated on 96-well imaging plates (Perkin Elmer, catalogue no. 6055302) for 48 h. Cells were fixed in 10% neutral buffered formalin (Epredia, catalogue no. 9400-1) and stained with 500 µg ml−1 DAPI and 5 µg ml−1 BODIPY 493/503 (Cayman, catalogue no. 25892) in PBS. Automated imaging of cells was done on a Nikon Ti2 microscope and images were analysed in NIS Elements.

    Statistical analysis

    Statistical analysis and data visualization were performed in the R Environment using RStudio with base R and packages as indicated including with tidyverse (dplyr, ggplot2), ggrepel, cowplot, ggsurvplot. No statistical method was used to predetermine sample sizes; standard sample sizes for Drosophila, pooled across two or three independent experiments, were used. See the Source Data files for data and statistical reporting corresponding to each main and Extended Data figure.

    Reporting summary

    Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

    [ad_2]

    Source link

  • Distinct µ-opioid ensembles trigger positive and negative fentanyl reinforcement

    [ad_1]

    Mice

    C57BL/6 J mice were purchased from Charles River. DAT-IRES-cre (B6.SJL-Slc6a3tm1.1(cre)Bkmn/J), GAD-IRES-cre (Gad2tm2(cre)Z) and µOR fl/fl (B6;129-Oprm1tm1.1Cgrf/KffJ or Oprm1fl/fl) mice were from the Jackson Laboratory, µOR cre/cre (B6N-Oprm1tmT2A-eGFP/cre(ICS)/Kf or Oprm1cre) mice were provided by B. L. Kieffer and SST-IRES-cre (Ssttm2.1(cre)Zjh/J) mice were provided by A. Holtmaat. On arrival, the mice were given a period of 7 days for habituation. Both male and female mice, aged from 8–12 weeks, were used and group housed in a temperature-controlled (21 ± 2 °C) and humidity-controlled environment (50 ± 5%), under a 12 h light/dark cycle, and provided with food and water ad libitum. After surgical procedures, mice were single housed and recovered for at least 7 days before any experimental procedure. Weights and sexes were distributed homogeneously among the groups if possible. All behavioural procedures were performed during the light cycle. All procedures were approved by the Institutional Animal Care and Use Committee of the University of Geneva and by the animal welfare committee of the Canton of Geneva, in accordance with Swiss law.

    Virus injection and implantation

    Mice (age 8–12 weeks) were anaesthetized with a mixture of isoflurane (induction 3%, maintenance 1.5%, Attane) and O2 (compact anaesthesia station from Minerve) during surgery and then secured in a stereotaxic frame (Stoeling). Before craniotomy, body temperature was maintained at 37 °C with a temperature controller system, and Lacryvisc (Alcon, Switzerland) was applied to prevent eyes from dehydration. For VTA recording of the different neuronal subtypes (anterior posterior (AP): −3.28; medio–lateral (ML): −0.9; dorso-ventral (DV): −4.3; with a 10° angle) or recording of CeA µOR-expressing neurons (AP: −0.9; ML: −2.8; DV: −3.9) mice were injected with an AAV-DJ-EF1α-FLEX-GCaMP6m (respectively 400 and 150 nl) produced at Stanford University vector core. For the recording of dopamine release, an AAV5-CAG-dLight1.2 (400 nl, from Addgene) was unilaterally injected in NAc (AP: +1.5; ML: −0.7; DV: −4.3). For knockdown experiments, µOR fl/fl mice were injected with an AAV8-hSyn-cre-tdTomato or the control virus AAV5-hSyn-mCherry (150 to 400 nl) in VTA (AP: −3.28; ML: −0.9; DV: −4.3, with an angle of 10°), NAc (AP: +1,5; ML: −0,7; DV: −4.3), BLA (AP: −1.2; ML: −3.2; DV: −4.2), PVT (AP: −0.9; ML: −0.4; DV: −3, with an angle of 10°) and CeA (AP: −0.9; ML: −2.8; DV: −3.9). For ISH (RNAscope) in wild-type or µOR fl/fl mice, 250 nl of an AAV8-hSyn-cre was injected in VTA (AP: −3.28; ML: −0.9; DV: −4.3, with an angle of 10°) or CeA (AP: −0.9; ML: −2.8; DV: −3.9). For immunohistochemistry experiments, Oprm1cre or Sst-cre mice were injected with an AAV5-hSyn-Dio-mCherry in CeA (AP: −0.9; ML: −2.8; DV: −3.9). Finally, for oGABAsi experiments, AAV5-EF1α-eArch3.0-Dio-EYFP was injected in VTA (AP: −3.28; ML: −0.9; DV: −4.3, with an angle of 10°) and for CeA optogenetic manipulation of negative reinforcement an AAV5-EF1α-ChR2(H134R)-Dio-EYFP or the control virus was injected in CeA (AP: −0.9; ML: −2.8; DV: −3.9).

    During the same surgical procedure, for in vivo recording of Ca2+ and dopamine release, an optic fibre (0.4 mm diameter, MFC_400/430_0.48_4mm_ZF2.5(G)FLT, Doric Lenses) was implanted and same for optogenetic experiment (oGABAsi and negative reinforcement) (0.2 mm diameter, FOC-W-1.25-200-0.37-5.0, Inper). Three screws were fixed into the skull to secure the optical implant, then the optic fibre was lowered 200 µm above the injection site and secure using dental cement. After surgery, mice were allowed to recover for 7 days and were habituated to handling.

    Behavioural apparatus

    The behavioural experiment on precipitation of withdrawal (knockdown, cFOS) as well as fibre photometry recording of calcium (Ca2+) GCaMP6m took place in a custom build chamber situated in a sound-attenuated chamber (Med Associates). The experiment chambers consist of a white Plexiglas square chamber (20 × 20 × 25 cm) surmounted by a video camera (Cineplex from Plexon) recording at a rate of 40 frames per second. On top of the chamber, a white transparent piece of Plexiglas with a hole at the centre was inserted to prevent mice from escaping. For fibre photometry recording of dopamine release evoked by fentanyl 0.3 mg kg−1 and apomorphine 10 mg kg−1, the experiment took place in a transparent custom-built open field (30 × 30 × 20 cm) surmounted by a FLIR camera (Blackfly S) recording at 30 Hz. oGABAsi and negative reinforcement experiments took place in an operant chamber (ENV-307A-CT, Med Associates) situated in sound-attenuating cubicle (Med Associates) consisting of a metal/Plexiglas square chamber (15.9 × 14 × 12.7 cm) with a grid floor in which two retractable levers were present on both sides of one wall surmounted by two cues light. The apparatus was controlled and data captured using a PC running MED-PC IV (Med Associates). For CPP or RTPA experiment, a three-compartment chamber (Med Associates) was used. The apparatus consists of two chambers separated by a corridor with equal surface, but distinct walls drawings and floor texture. On top of the context, a FLIR camera recording at 30 Hz (for CPP) or a camera connected to Cineplex (Plexon for RTPA) was used. Finally, for the locomotor response to different intraperitoneal injections, the experiment took place in a transparent custom-built open field (30 × 30 × 20 cm) surmounted by a camera connected to the Cineplex system to track the centre of gravity.

    Behavioural paradigm

    Dependency and withdrawal precipitation

    Mice were first habituated to the intraperitoneal injection of saline at least for 3 consecutive days. Then increasing dose of fentanyl 0.06, 0.12, 0.18, 0.24 and 0.3 mg kg−1 (both injections at 10 ml kg−1) were injected intraperitoneally in their home cage to create dependency. On the challenge day, mice were injected with a dose of fentanyl at 0.3 mg kg−1 and put back in their home cage for 10 min. Then the behaviour was assessed in the video-tracking apparatus for 20 min (pre-period, reward). 30 min after the intraperitoneal injection of fentanyl, naloxone was injected intraperitoneally at a dose of 5 mg kg−1 (injection at dose of 10 ml kg−1) and the mice put back in the apparatus directly to evaluate precipitation withdrawal symptoms for 20 min (post period, withdrawal). Precipitation of withdrawal was manually scored by quantifying rearings, jumps, body licking, wet-dog shakes and defecations. Furthermore, immobility (2 s of immobility) and distance travelled (in metres) were extracted from the video track.

    Optogenetic experiment

    For optogenetic experiments, the implanted optic fibres were connected via patch cords (oGABASI, MFO-F-W1.25-200-0.37-100, negative reinforcement, BFO-1×2-F-W1.25-200-0.37-30, Inper) to a rotary joint (FRJ_1 × 2_FC-2FC; Doric Lenses), suspended above the operant chamber. A second patch cord was connected from the rotary joint to a blue or orange DPSS laser (SDL-473–100 mW, SDL-593–100 mW, respectively; Shanghai Dream Lasers) positioned outside of the context. Laser power was typically 15–20 mW measured at the end of each patch cord. A mechanical shutter was used to control laser output (SR474 driver with SR476 shutter head; Stanford Research Systems, aligned using a connectorized mechanical shutter adapter; Doric Lenses).

    oGABAsi experiment (n = 9 mice) was designed on a fixed ratio 1 schedule (FR1) consisting of 1 h session daily during the conditioning phase and then two sessions for the occlusion experiment (20 min for pre-session and 1 h for post-session). Each ALP was associated with a cue light of 2 s, and, 5 s later, a continuous laser inhibition of GABA neurons lasting 7.5 s the first 7 days and 5 s the consecutive sessions, to reduce the time of optogenetic inhibition. From the ALP to the end of the optogenetic stimulation, every press on the ALP was recorded but did not initiate a protocol of stimulation (time-out period). The occlusion experiment was realized over 15 days and started by a 20-min pre-session. Then mice were injected intraperitoneally with saline (during baseline and recovery days) or fentanyl at different doses (0.06, 0.12, 0.15, 0.21, 0.3 and 0.18 mg kg−1) before the start of the session that lasted 60 min.

    The negative reinforcement experiment (n = 8 mice for the ChR2 group and n = 7 mice for the EYP group, all female) was designed on a 1 h FR1 schedule for 6 days followed by 1 h FR3 schedule for 12 days. The mouse could stop continuous optogenetic stimulation at 20 Hz (5 ms pulse every 50 ms for 1 s every 2 s) by pressing on an ALP. Each ALP was associated with a cue light that lasted 2 s and a pause of the optogenetic stimulation for 20 s. From the ALP to the end of pause of optogenetic stimulation every press on the ALP was recorded but did not initiate a protocol of stimulation pause (time-out period). The occlusion experiment was realized over 12 days consisting of 3 days of baseline followed by 9 days where an injection of fentanyl at different doses was realized every other day (0.12, 0.06, 0.09, 0.3, 0.015 mg kg−1). During the baseline or the recovery day, mice were injected intraperitoneally with saline.

    CPP and RTPA

    For the CPP experiment (n = 10 for the VTA knockdown group and n = 11 for CTL group), mice were habituated to saline intraperitoneal injection at least 3 days before the beginning of the behaviour. On day 1 (pre-test), mice were placed in the corridor and allowed to explore both sides of the context for 20 min. Then 6 days of 20 min conditioning were realized by intraperitoneal injection of saline or fentanyl at 0.3 mg kg−1 in a randomly assigned side of the context. On the last day, the place preference was assessed by allowing the mouse to freely explore both sides of the context (post-test). Mice were video-tracked, and the time spent in each compartment was calculated offline using a markerless pose estimation method (DLC) and a custom-made Matlab script. The centre of gravity was used to assess the time spent in each of the three compartments (corridor, saline, or fentanyl context). CPP was calculated by computing the time spent in the fentanyl compartment divided by the time spent in both compartments per session.

    To achieve real-time place aversion (RTPA), a camera linked to a Cineplex system (Plexon) was used to continuously video-track the mouse within the given context. When the centre of gravity was detected on one side of the context, an uninterrupted digital signal was transmitted to an Arduino device. This digital signal was then conveyed to an Arduino device linked to a blue laser to produce the stimulation pattern utilized in the negative reinforcement task (20 Hz; 5 ms pulse every 50 ms for 1 s every 2 s). After 4–5 weeks of viral expression, mice (n = 9 for ChR2 group and n = 15 for EYFP group) were habituated for 3 days of experimenter manipulations and to the connection of the cable. On day 1 (pre-test), mice were free to explore for 20 min both sides of the context and we assessed their place preference. On days 2, 3 and 4 mice were free to explore both sides of the context for 30 min. During this phase, when the centre of gravity of the mouse entered the preferred side, a stimulation was sent until the mouse left this side of the context. On day 5 (post-test), mice were free to explore for 20 min both sides of the context where we assessed again their place preference. RTPA was calculated by computing the time spent in the stimulated compartment divided by the time spent in both compartments per session.

    Locomotor response to drug injection

    For the fentanyl dose–response on locomotion, mice were first habituated to saline injection for 3 days. Then we randomly daily injected fentanyl (0.06, 0.12, 0.15, 0.18, 0.21 and 0.3 mg kg−1) over 6 days and assessed the locomotor response during 1 h. For the locomotor response in VTA µOR-knockdown mice versus controls, we injected saline intraperitoneal for 3 consecutive days, followed by fentanyl (at 0.2 mg kg−1) the next 2 days. A control group was used were we injected saline intraperitoneally over 5 days.

    Fibre photometry recordings

    After 4–5 weeks of viral expression, mice were first habituated to handling, to the connection cable and intraperitoneal injection of saline for 3 days before testing. On the testing day, mice were connected to the fibre photometry cable and placed in the apparatus for 3 min of habituation before the start of recording. For the study of dopamine release evoked in the VTA knockdown mice vs control, 5 min of baseline fluorescence were made before the intraperitoneal injection, and then the change of fluorescence was monitored during 40 min. Mice were injected intraperitoneally for 3 consecutive days respectively with saline, fentanyl (0.3 mg kg−1), apomorphine (10 mg kg−1). For the recording of the neuronal activity (CeA and VTA) during opioid dependency and withdrawal, mice were recorded during 5 min of baseline and then 20 min after naloxone alone (5 mg kg−1), fentanyl (0.3 mg kg−1). To reduce the entangling of the cable on the challenge day, 20 min after the fentanyl intraperitoneal injection, the photoreceiver was stopped and the cable disentangled and switched on 5 min before the intraperitoneal saline or naloxone (5 mg kg−1) injection. Finally, the neuronal activity was recorded for 20 min.

    Fibre photometry was performed as before, and data were collected with TDT Synapse v.84 (Tucker Davis). During recordings, excitation (470 nm, M470F3, Thorlabs) and control LED light (405 nm, M405FP1, Thorlabs) were passed through excitation filters and focused onto a patch cord. The fibre patch cord was connected to the chronically implanted fibre, and emission light (500–550 nm) was collected through the same fibre and passed onto a photoreceiver (Newport 2151, Doric Lenses). After pre-amplification by the photoreceiver (2 × 1010 V/A) the signal was digitized, demodulated and stored using a signal processor (RZ5P, Tucker Davis Technologies).

    The data were analysed using MATLABR2020 (MathWorks). First, the signal during baseline acquisition originating from the 405 nm excitation source was linearly regressed to the signal originating from the 470 nm excitation source, and scaled to the 470 nm originating signal. ΔF/F was then computed as (470 nm signal – fitted 405 nm signal)/fitted 405 nm signal. Finally, the ΔF/F was binned into 10-s time bins to plot an average graph, additionally to no binning for the study of transient activity evoked by the intraperitoneal injection. Transients were detected using the Matlab function findpeaks, where peaks were defined as a prominence greater than 2 standard deviations of the ΔF/F during baseline recording. For the calculation of the area under the curve (AUC), we used the Matlab function trapz Finally, for the normalization of the AUC to apomorphine we computed the ratio of AUC evoked by apomorphine injection to the one evoked by fentanyl injection.

    Histological analysis

    Ninety minutes after the precipitation of withdrawal, mice were injected with a lethal dose of pentobarbital (150 mg kg−1) and perfused transcardially with PBS and 4% paraformaldehyde solution. Brains were post-fixed overnight at 4 °C. Coronal sections (60 μm) of the region of interest were cut with a vibratome. Immunostaining started by blocking slices in PBS 10% BSA and 0.3% Triton X-100 followed by 48 h incubation in PBS 3% BSA and 0.3%Triton X-100 with primary antibody: rabbit polyclonal anti-cFOS (1:5,000, from SySy, 226003). After three 15 min washes in PBS at room temperature, slices were incubated with 1:500 Alexa-conjugated secondary antibodies against rabbit (Alexa-Fluor 488, Life Technologies, A1108). Then slices were washed three times in PBS. Slices were mounted and covered on microscope slides using DAPI mounting medium vectashield. Images were obtained in a confocal laser-scanning microscopy Leica SP8 confocal microscope using additional 350-nm laser with a 40×/0.7 NA oil immersion. Analysis was performed in at least three sections per mouse per structure of interest. Semi-manual quantification of cFOS was made by an experimenter who was blind to the experimental conditions. For the visualization of dLight expression, after slicing at 60 μm, slices were incubated with a primary antibody (1:500, rabbit polyclonal anti-GFP, Invitrogen, A11122) overnight at 4 °C and the secondary antibody (1:500, Alexa goat anti-rabbit, Life Technologies, A1108) for 2 h at room temperature.

    In situ hybridization

    Staining for Oprm1, Slc6a3, Slc32a1, Sst and Prkcd mRNAs was performed by smFISH. Brains from 7 C57BL/6 J 12-week-old mice were rapidly extracted and snap-frozen on dry ice and stored at −80 °C until use. VTA and CeA coronal sections (14 μm) were collected directly onto Superfrost Plus slides (Fisher Scientific). RNAscope Fluorescent Multiplex labelling kit (ACDBio 323110) was used to perform the smFISH assay according to manufacturer’s recommendations. Probes used for staining are Oprm1 (ACDBio 315841), Slc6a3 (ACDBio 315441-C3), Slc32a1 (ACDBio 319191-C2), Sst (ACDBio 404631-C2) and Prkcd (ACDBio 441791-C3). After incubation with fluorescently labelled probes, slides were counterstained with DAPI and mounted with ProLong Diamond Antifade mounting medium (Thermo Fisher Scientific P36961). Fluorescence images of labelled cells were captured using sequential laser-scanning confocal microscopy (Leica SP8) and co-localization was quantified manually. For the validation of the VTA or CeA µOR knockdown we automatically counted the number of puncta per slide compared to control condition using ImageJ software.

    Video data analysis

    The videos, which have a resolution of 640×480 and a frame rate of 40 fps, were analysed with DeepLabCut18. From a subset of videos, we extracted 25 frames per video using the kmeans algorithm to ensure diversity and labelled them manually. The labelling comprised 15 points of interest (four corners of the box, nose, both ears, both shoulders, body centre, both hips, and base, middle and end of the tail). The labelled images were divided into a training set (90%) and a test set (10%) and a model was trained using ResNet-50 and 800,000 iterations. The resulting error was 2.24 pixels on the training set, and 6.01 pixels on the testing set. The model was used to extract the xy coordinates of the previously mentioned points of interest throughout the videos. These coordinates were corrected in the following way: the points with low confidence (<0.05) and the outliers in speed or position were replaced by a value obtained by a cubic interpolation. The whole set of coordinates was also smoothed with a moving average filter of width 5.

    The body parts coordinates were used to define 14 relative variables, namely the body extension (distance between the middle of the shoulders and the middle of the hips), the distance between the shoulders, the distance between the hips, the distance between the middle of the tail and the body centre, the tail extension (distance between the base and the end of the tail), the head extension (distance between the nose and the middle of the ears), the angle between the body and the tail, the angle in the middle of the tail, the angle between the head and the body, the rotation of the body with respect to a vertical line, the distance between the centre of the mouse body and the centre of the box, the body torsion (ratio of distance between shoulder and hip on the left vs on the right), the speed and rearing.

    We defined a 15th variable describing the likelihood of a jump occurring on each frame. For this purpose, we used the fact that the tracking confidence (values between 0 and 1) would drop during jumps because the mouse would leave the frame for a few milliseconds. Knowing that the tracking confidence was close to perfect while the mouse was in frame, the probability of a jump happening can be roughly approximated by P(jump) ≈ 1 − (tracking confidence). Pairing this observation with a condition on a big enough speed preceding the loss of tracking allows a refinement of the detection of jumps, as we avoid classifying bad tracking as a jump. More precisely, a sequence of consecutive frames was considered as a jump if the confidence of tracking went below the fixed threshold of 50% and the speed around the loss of tracking went above the fixed threshold of 10 cm s−1. These thresholds were defined for the automatic jump detection to closely match the jumps observed during careful examination of a few videos.

    For each mouse, we thereby obtain 15 time series (one per variable). The goal is to compare them and see if there are differences between the control group and each one of the experimental groups. Since a direct comparison between time series is not possible, we use hctsa19 to perform feature extraction: it evaluates more than 7,000 operations on each time series. A given time series is hence characterized by a vector with more than 7,000 entries containing the evaluated operations. For each of the 15 variables, we assess the similarity between a certain experimental group of mice (knockdown of µORs in different brain regions) and the control group (non-knockdown) by training a linear SVM classifier with 5 repeats of 5 folds cross validation on the characterizing vectors. We compute the mean balanced accuracy: mean balanced accuracy = (sensitivity + specificity)/2. The significance of the results is obtained by comparing our original accuracy with 1,000 repeats of a classification on shuffled data.

    Statistical analysis and reproducibility

    Data were analysed with Microsoft excel 16.16.05 and GraphPad prism 10.0.2. Sample size were estimated with G*power (HHU). For each experiment, a minimum of two replications were conducted by experimenters. Statistical analysis was performed in GraphPad Prism 9. For all tests, the significance threshold was placed at α = 0.05. Gaussian distribution was evaluated using the D’Agostino and Pearson normality test. Multiple comparisons were first subject to mixed-factor ANOVA or Kruskal–Wallis test (defining both between- and/or within-group factors), respectively, for normally distributed and non-normally distributed data. Where significant main effects or interactions between factors were found (P < 0.05), further comparisons were made for normally distributed data by a two-tailed Student’s t-test with Bonferonni corrections applied when appropriate or a Dunn test for non-normally distributed data (that is, the level of significance equalled 0.05 divided by the number of comparisons). Mann–Whitney or Wilcoxon tests were used for non-Gaussian distributions when appropriate. For normally distributed data, single comparisons of between- or within-group measures were made by two-tailed unpaired or paired Student’s t-test, respectively.

    Reporting summary

    Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

    [ad_2]

    Source link

  • Control of neuronal excitation–inhibition balance by BMP–SMAD1 signalling

    [ad_1]

    Mice

    All procedures involving animals were approved by and performed in accordance with the guidelines of the Kantonales Veterinäramt Basel-Stadt. All experiments were performed in mice on a C57Bl/6J background, except for some of the experiments performed in cultured wild-type neurons, which used RjOrl:SWISS mice (Janvier). All mice were group housed (weaning at P21–P23) under a 12-h light–dark cycle (06:00–18:00) at 21–24 °C and 50–60% humidity with food and water ad libitum. Both males and females were used at similar numbers for the experiments. Mice were randomly assigned to treatment groups. Mice that exhibited a spontaneous seizure were excluded from molecular, anatomical and slice physiology analyses.

    Smad1fl/fl mice54, Pvalb-cre mice55 and Ai9 mice56 were obtained from Jackson Laboratories (Jax stock no: 008366, 017320 and 007909, respectively). Cux2-CreERT2 mice57 were obtained from the Mutant Mouse Resource and Research Center (MMRRC). Bmp2-2xHA mice were generated using a CRISPR–Cas9 strategy58 inserting a double HA tag at the N terminus of the mature BMP2 protein, between amino acids S292 and S293. The guide RNAs (gRNAs) used were 5′-GTCTCTTGCAGCTGGACTTG-3′ and 5′-CAAAGGGTGTCTCTTGCAGC-3′, together with a 200-bp single-stranded DNA ultramer: 5′-GACTTTTGGACATGATGGAAAAGGACATCCGCTCCACAAACGAGAAAAGCGTCAAGCCAAACACAAACAGCGGAAGCGCCTCAAGTCCGCTAGCTACCCATACGATGTTCCAGATTACGCTGGCTATCCCTATGACGTCCCGGACTATGCAGCTAGCAGCTGCAAGAGACACCCTTTGTATGTGGACTTCAGTGATGTGG-3′ (the sequence encoding the HA tags is highlighted in bold).

    Surgery and drug treatments

    Injections of recombinant AAVs were performed into the barrel cortex of 42–49-day-old male and female mice performed under isoflurane anaesthesia (Baxter). Mice were placed in a stereotactic frame (Kopf) and a small incision (0.5–1 cm) was made over the barrel cortex at the following coordinates targeting two sites: mediolateral (ML) ±3.0 mm and ±3.4 mm, at anteroposterior (AP) 0.6 mm and AP −1.6 mm, dorsoventral (DV) –1.5 mm from Bregma to target layers 2/3 and 4. For injections of FingR intrabodies, two injection sites restricted to layer 2/3 were used: ML ±3.0 mm and ±3.4 mm at AP –1.0 mm, DV –0.96 mm from Bregma. Recombinant AAVs (titre: 1012–1013) were injected via a glass capillary with an outer diameter of 1 mm and an inner diameter of 0.25 mm (Hilgenberg) for a total volume of 100 nl per injection site. The wound was closed with sutures (Braun, C0766194).

    LMI070 (25 mg kg−1, MedChemExpress, HY-19620, suspended in 20% cyclodextrin and 10% dimethyl sulfoxide (DMSO) to 5 mg ml−1 concentration) was administrated by oral gavage. Clozapine N-oxide (CNO) (5 mg kg−1, Sigma Aldrich, C0832) and doxycycline (50 mg kg−1, Thermo Fisher Scientific, BP26531, suspended in 0.9% NaCl to 5 mg ml−1 concentration) were administered by intraperitoneal injection.

    Antibodies and probes

    Primary antibodies were: monoclonal mouse anti-synaptotagmin-2 (Zebrafish International Resource Center, ZNP-1), rabbit anti-SMAD1 (Cell Signaling 6944, 1:100 for ChIP and 1:1,000 for western blot), H3K27ac (Abcam 4729, 1:1,000), rabbit anti-SMAD5 (Cell Signaling, 12534, 1:100 for ChIP and 1:1,000 for western blot), anti-phospho-SMAD1/5/9 (Cell Signaling 13820, 1:1,000), mouse anti-BMPR2 (BD Pharmingen, 612292, 1:1,000), rabbit anti-calnexin (StressGen, SPA-865, 1:2,000), mouse anti-MAP2 (Synaptic Systems, 188011, 1:1,000), mouse anti-CAMKII alpha (Thermo Fisher Scientific, MA1-048, 1:800), rat anti-GAPDH (Biolegend, 607902, 1:10,000), rabbit anti-NeuN (Abcam, ab177487, 1:500), mouse anti-GAD67 (Millipore MAB5406, 1:500), rabbit anti-vGLUT1 (Synaptic Systems 135303, 1:5,000), biotinylated WFA (Vector Laboratories B-1355-2, 1:500), rabbit anti-HA (Cell Signaling 3724, 1:1,000), mouse anti-GFP antibody (Santa Cruz, sc-9996, 1:1,000) and goat anti-parvalbumin antibody (Swant PVG213, 1:5,000). Secondary antibodies were: HRP goat anti-rabbit (Jackson 111-035-003, 1:10,000), HRP goat anti-rat (Jackson 112-035-143, 1:10,000), HRP goat anti-mouse (Jackson 115-035-149, 1:10,000), Alexa405 goat anti-rabbit (Thermo Fisher Scientific A-31556, 1:500), Alexa488 donkey anti-rabbit (Thermo Fisher Scientific R37118, 1:1,000), Alexa647 donkey anti-mouse (Jackson 715-605-151, 1:1,000), Alexa647 streptavidin (Thermo Fisher Scientific, S32357, 1:1,000), Cy2 Streptavidin (Jackson 016-220-084, 1:1,000), Cy3 donkey anti-mouse (Jackson 715-165-151, 1:500), Cy3 donkey anti-rabbit (Jackson 711-165-152, 1:500), Cy5 donkey anti-goat (Jackson 705-175-147, 1:500), Cy5 donkey anti-rabbit (Jackson 711-175-152, 1:500) and Cy5 donkey anti-mouse (Jackson 715-175-511, 1:500). DAPI dye was used for nuclear staining (TOCRIS Bio-Techne, 5748, 1:5,000).

    Immunohistochemistry and image acquisition

    Mice were deeply anaesthetized with a ketamine–xylazine mix (100 and 10 mg per kg, respectively, intraperitoneally) and were transcardially perfused with fixative (4% paraformaldehyde (PFA) in 0.1 M phosphate buffer, pH 7.4). For synapse quantifications with FingR probes the fixative also contained 15% picric acid. After perfusion, brains were post-fixed overnight in fixative at 4 °C and washed three times with 100 mM phosphate buffer.

    For quantifications of parvalbumin and WFA expression and BRX reporter analyses, coronal brain slices were cut at 40 µm with a Vibratome (VT1000S, Leica). For FingR-PSD95 analysis with the Cre-dependent reporter, coronal brain slices were cut at 30 µm with a Cryostat (Microm HM560, Thermo Fisher Scientific). Brain sections were incubated for 30 min in blocking solution (0.3% Triton X-100 and 3% bovine serum albumin in phosphate-buffered saline (PBS)). Sections were incubated with primary antibodies in blocking solution overnight at 4 °C and washed three times (10 min each) with 0.05% Triton X-100 in PBS, followed by incubation for 1.5 h at room temperature with secondary antibodies in blocking solution. Sections were washed three times with PBS and DAPI dye (1.0 µg ml−1) co-applied during the wash. Sections were mounted using Microscope cover glasses 24 × 60 mm (Marienfeld Superior 0101242) on Menzel-Gläser microscope slides Superfrost Plus (Thermo Fisher Scientific, J1800AMNZ) with ProLong Diamond Antifade Mountant (Invitrogen, P36970).

    For S5E2 PV enhancer FingR-PSD95 quantifications, coronal brain slices were cut at 120 µm on a Vibratome (VT1000S, Leica) and cleared with CUBIC-L solution (10% w/v N-butyldiethanolamine, 10% w/v Triton X-100) for 3 h at 37 °C with gentle shaking59. Sections were stained with goat anti-parvalbumin antibodies and mounted with Ce3D Tissue Clearing Solution (Biolegend, 427704).

    For parvalbumin and WFA analysis, images were acquired on an inverted LSM700 confocal microscope (Zeiss) using 20×/0.45 and 40×/1.30 Apochromat objectives. For quantifications of the cell density of PV interneurons, tile-scan images from the barrel cortex were acquired. For synapse quantifications, images were acquired with a PlanApo 63×/1.4 oil immersion objective.

    For primary neocortical neurons in culture, fixation was with 4% PFA in 1× PBS for 15 min. followed by ice-cold methanol (10 min at −20 °C). Cells were blocked (5% donkey serum, 0.3% Triton X-100 in PBS) for 1 h at room temperature and primary antibody incubation was performed overnight at 4 °C in a humidified chamber. Secondary antibody incubation was 1 h at room temperature. Imaging was performed on a widefield microscope (Deltavision, Applied Precision) with a 60× objective (NA 1.42, oil).

    Image analysis

    Mean intensity analyses for parvalbumin and WFA stainings were performed in ImageJ with a custom-made script in Python. In brief, H-Watershed was applied to segment PV interneurons on the basis of the tdTomato signal on the soma. To detect the WFA signal, the soma was eroded and dilated in all optical sections. After applying thresholding, parvalbumin and WFA mean intensity values were automatically calculated and displayed as arbitrary units. Integrity analysis of PNNs was done from PV interneurons with a positive WFA signal (>2,000 arbitrary units). Images were post-processed by conservative deconvolution with the Huygens Deconvolution software with the classic maximum likelihood estimation deconvolution algorithm. Quantitative analyses of the number of peaks and the distance between the peaks were performed by using plot profile function in ImageJ as described60.

    For BRX-reporter experiments, cell identity and reporter intensity were quantified with ImageJ. A region of interest was drawn around the nuclei (marked by DAPI) and the mean intensity was measured for the nuclear GFP signal and normalized to background fluorescence in the same image. Cells were identified on the basis of immunostaining for markers: mCherry (genetically restricted to PV interneurons), NeuN (marking neurons with high intensity in pyramidal cells) and GAD67 (marking all GABAergic cells).

    For synapse quantification, images were post-processed by conservative deconvolution with the Huygens Deconvolution software with the classic maximum likelihood estimation deconvolution algorithm. Quantitative analysis was performed using Imaris 9.9.1 by application of spots and surface detection tool.

    All data collection and image analysis were done blinded to the genotype or treatment of the mouse. Statistical analyses were done with GraphPad Prism v.9. Images were assembled using ImageJ and Adobe Illustrator software.

    ChIP–seq analysis

    For ChIP–seq analysis with cultured neurons, 24 × 106 cells (DIV14) were cross-linked with 1% formaldehyde for 10 min at room temperature. Cross-linking was stopped by the addition of glycine solution (Cell Signaling Technology, 7005) for 5 min at room temperature. Cells were scraped, pelleted and lysed for 10 min on ice in 100 mM HEPES-NaOH pH 7.5, 280 mM NaCl, 2 mM EDTA, 2 mM EGTA, 0.5% Triton X-100, 1% NP-40 and 20% glycerol. Nuclei were pelleted by centrifugation, washed in 10 mM Tris-HCl pH 8.0, 200 mM NaCl and suspended in 10 mM Tris-HCl pH 8.0, 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 0.1% Na-Deoxycholate and 0.5% N-lauroylsarcosine. Chromatin was sheared using a Covaris Sonicator for 20 min in sonication buffer (SimpleChIP Plus Sonication Kit, Cell Signaling Technology, 57976) to obtain fragments in the range of 200–500 bp. After sonication, sheared chromatin was centrifuged at 16,000g for 20 min at 4 °C and dissolved in 1× ChIP buffer (Cell Signaling Technology, 57976). Input (2%) was taken and the chromatin was incubated with antibodies overnight at 4 °C. Incubation with Protein G magnetic beads, de-cross-linking and elution were performed as described in the SimpleChIP Plus Sonication Kit.

    Libraries were generated using the KAPA Hyper Prep (Roche KK8504) according to the manufacturer’s instructions, and were amplified by PCR. Library quality was assessed using the High Sensitivity NGS Fragment Analysis Kit (Advanced Analytical DNF-474) on the Fragment Analyzer (Advanced Analytical). Libraries were sequenced paired-end 41 bases on NextSeq 500 (Illumina) using two NextSeq 500 High Output Kit 75-cycles (Illumina, FC-404-1005) loaded at 2.5 pM and including 1% PhiX. Primary data analysis was performed with Illumina RTA v.2.4.11 and Basecalling v.bcl2fastq-2.20.0.422. Two NextSeq runs were performed to compile enough reads (on average per sample in total: 50 million ± 2 million pass-filter reads).

    ChIP–seq analysis from P35–P42 mouse cortex was performed using the SimpleChIP Enzymatic Chromatin IP Kit (Cell Signaling Technology, 9003), following the manufacturer’s instructions with slight modifications. In brief, neocortices from both hemispheres were cross-linked in 1.5% formaldehyde for 20 min at room temperature. Cross-linking was stopped by the addition of glycine solution for 5 min at room temperature. Tissue was pelleted, washed and disaggregated by using a Dounce homogenizer in 1× PBS containing protease inhibitor cocktail. Nuclei were pelleted by centrifugation and chromatin was digested by using micrococcal nuclease for 20 min at 37 °C by frequent mixing to obtain fragments in the range of 150–900 bp. Nuclei were pelleted, resuspended in 1× ChIP buffer, sonicated with Bioruptor Pico (Diagenode B01060010) to release sheared chromatin and centrifuged at 9,400g for 10 min at 4 °C. Input (2%) was taken and the chromatin was incubated with primary antibodies overnight at 4 °C. After subsequent incubation with 30 μl Protein G magnetic beads for 2 h at 4 °C, beads were washed three times with low salt, one time with high salt, one time with NP-40 buffer (8 mM Tris-HCl pH 8.0, 2 mM LiCl, 0.8 mM EDTA, 0.4% NP-40 and 0.4% sodium-deoxycholate) and one time with TE buffer (10 mM Tris-HCl, pH 8.0 and 1 mM EDTA) at 4 °C. De-cross-linking and elution were performed as described in the Enzymatic Chromatin IP Kit. Libraries were generated using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs, E7645L) according to the manufacturer’s instructions and were amplified by PCR. Library quality was assessed using the High Sensitivity NGS Fragment Analysis Kit (Advanced Analytical, DNF-474) on the Fragment Analyzer (Advanced Analytical) and cleaned up by using 1.0× Vol SPRI beads (Beckman Coulter). Libraries were sequenced paired-end 41 bases on NextSeq 500 (Illumina) using two NextSeq 500 High Output Kit 75-cycles (Illumina, FC-404-1005). Two NextSeq runs were performed to compile enough reads (19–32 million pass-filter reads).

    RNA library preparation and sequencing

    Libraries of BMP2-stimulated naïve cortical cultures were prepared from 200 ng total RNA by using the TruSeq Stranded mRNA Library Kit (20020595, Illumina) and the TruSeq RNA UD Indexes (20022371, Illumina). Fifteen cycles of PCR were performed.

    Quality checking was performed by using the Standard Sensitivity NGS Fragment Analysis Kit (DNF-473, Advanced Analytical) on the Fragment Analyzer (Advanced Analytical) and quantified (average concentration was 213 ± 15 nmol l−1 and average library size was 357 ± 8 bp) to prepare a pool of libraries with equal molarity. The pool was quantified by fluorometry using using the QuantiFluor ONE dsDNA System (E4871, Promega) on a Quantus instrument (Promega). Libraries were sequenced single-reads 76 bases (in addition: 8 bases for index 1 and 8 bases for index 2) on NextSeq 500 (Illumina) using the NextSeq 500 High Output Kit 75-cycles (Illumina, FC-404-1005). Flow lanes were loaded at 1.4 pM of pool and including 1% PhiX. Primary data analysis was performed with Illumina RTA v.2.4.11 and Basecalling v.bcl2fastq-2.20.0.422. The NextSeq runs were performed to compile, on average per sample, 56 million ± 3 million pass-filter reads (illumina PF reads).

    For the libraries from control and Smad1 mutant primary cortical cultures (four biological replicates), 100 ng total RNA was used and library preparation and quality check were performed as described above. Quantification yielded an average concentration of 213 ± 15 nmol l−1 and an average library size of 357 ± 8 bp. Libraries were sequenced paired-end 51 bases (in addition: 8 bases for index 1 and 8 bases for index 2) set-up using the NovaSeq 6000 instrument (Illumina). SP Flow-Cell was loaded at a final concentration in flow lanes of 400 pM and including 1% PhiX. Primary data analysis was performed as described above and 43 million ± 5 million per sample (on average) pass-filter reads were collected on 1 SP Flow-Cell.

    ChIP–seq and RNA-seq data analysis

    ChIP–seq reads were aligned to the December 2011 (mm10) mouse genome assembly from UCSC61. Alignments were performed in R using the qAlign function from the QuasR package1 (v.1.14.0) with default settings62. This calls the Bowtie aligner with the parameters “-m 1 –best –strata”, which reports only reads that map to a unique position in the genome. The reference genome package (BSgenome.Mmusculus.UCSC.mm10) was downloaded from Bioconductor (https://www.bioconductor.org). BigWig files were created using qExportWig from the QuasR package with the bin size set to 50. Peaks were called for each ChIP replicate against a matched input using the MACS2 callpeak function with the default options. Peaks were then annotated to the closest gene and to a genomic feature (promoter, 3′-UTR, exon, intron, 5′-UTR or distal intergenic) using the ChIPseeker R package. The promoter region was defined as −3 kb to +3 kb around the annotated transcription start site. Transcripts were extracted from the TxDb.Mmusculus.UCSC.mm10.ensGene annotation R package. All analyses in R were run in RStudio v.1.1.447 running R v.3.5.1. The enrichment of BMP2-induced peaks over constitutive peaks was analysed by using default settings in the voom–limma analysis software packages63. Motif enrichment analysis for BMP2-responsive peaks and constitutive peaks was performed separately by screening for the enrichment of known motifs with the default settings of HOMER64. Output motif results with the lowest P value and highest enrichment in targets compared to the background sequences were shown for each peak set.

    RNA-seq reads were aligned to mm10 using STAR and visualized in the IGV genome browser to determine strand protocol. By using QuasR’s qQCReport, read quality scores, GC content, sequence length, adapter content, library complexity and mapping rate were checked and a QC report was generated. Reads with quality scores less than 30, mapping rates lower than 65 or contaminations from noncoding RNAs were not considered for further analysis. For reads that passed QC, QuasR’s qCount function was used to count the reads that mapped to annotated exons (from Ensembl genome annotations). Each read was counted once on the basis of its start (if reads are on the plus strand) or end (if reads are on the minus strand) position. For each gene, counts were summed for all annotated exons, without double-counting exons present in multiple transcript isoforms (exon-union model). Correlations between replicates and batch structure were checked by plotting correlation heat maps, PCA plots of samples and scatter plots of normalized read counts. The EdgeR package from R was used to build a model and test for differentially expressed (DE) genes. For DE analysis, counts were normalized using the TMM method (built into edgeR). Any genes with fewer than, in total, 30 reads from all samples were dropped from further analysis. DE analyses were conducted with the voom–limma analysis software packages by using the total number of mapped reads as a scaling factor. Results were extracted from edgeR as tables and used for generating volcano or box plots in ggplot2 in RStudio.

    To generate IGV genome browser tracks for ChIP–seq and RNA-seq data, all aligned bam files for each replicate of a given experiment were pooled and converted to BED format with bedtools bamtobed and filtered to be coverted into coverageBED format using bedtools. Finally, bedGraphToBigWig (UCSC-tools) was used to generate the bigWig files displayed on IGV browser tracks in the manuscript.

    GO analysis was performed by using the statistical overrepresentation test and cellular component function in PANTHER (http://pantherdb.org/). All genes that were detected as expressed in RNA-seq data were used as reference. GO terms with at least ten genes and at least 1.5-fold enrichment with a false discovery rate of less than 0.05 were considered to be significantly enriched. Significant GO terms were plotted in GraphPad Prism v.9.

    EEG recordings and behavioural monitoring

    EEG electrodes were implanted in mice at the age of 12–16 weeks. EEG signals were recorded using two stainless steel screws inserted ipsilaterally into the skull. One was inserted 1.2 mm from the midline and 1.5 mm anterior to bregma, and the other was inserted 1.7 mm from the midline and 2.25 mm posterior from to bregma. Seven days after surgery, mice were transferred to individual behaviour cages with a 12:12 h light–dark cycle and a constant temperature of about 23 °C. Mice had access ad libitum to food and water and were allowed to recover from surgery for seven days. Analysis was performed in individual cages equipped with overhead cameras (FLIR). Mice were connected to an amplifier (A-M Systems 1600) through a commutator. EEG signals were amplified and analog filtered (Gain 500; low-pass filter, 0.3 Hz; high-pass filter, 100 Hz) and then digitized at 200 Hz using Spike2 (CED Micro1401). Spontaneous sleep–wake behaviour was monitored continuously through EEG recordings and video tracking for three weeks. Epileptic episodes were identified at first by inspecting the EEG signals, and were subsequently examined further in the simultaneous video recordings.

    Statistics and reproducibility

    All experiments were performed in at least three fully independent replications (on different days, with different mice or cell cultures). Details about the numbers of mice and cultures are provided in the figure legends. When single micrographs or western blots are shown, their results are representative of all independent replicates analysed. Analysis was conducted in R and with GraphPad Prism v.9. Sample sizes were chosen on the basis of previous experiments and literature surveys. No statistical methods were used to predetermine sample sizes. Exclusion criteria used throughout this manuscript were predefined. See the descriptions in the respective sections of the methods. Mice were randomly assigned to treatment groups. Appropriate statistical tests were chosen according to the sample size and the distribution of data points, and are indicated in individual experiments.

    Reporting summary

    Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

    [ad_2]

    Source link

  • Network-level encoding of local neurotransmitters in cortical astrocytes

    [ad_1]

    Animals

    Experiments were carried out using young adult mice, in accordance with protocols approved by the University of California, San Francisco Institutional Animal Care and Use Committee. Animals were housed in a 12:12 light/dark cycle with food and water provided ad libitum. Animal housing rooms were kept at 68–74 °F and 30–70% humidity. Male and female mice were used whenever available. Transgenic mice used in this study were Cx43fl/fl mice56 from the Bhattacharya Lab (University of California, San Francisco, USA) and EAAT2-tdT mice57 from the Yang Lab (Tufts University, USA). For in vivo imaging, all experiments were carried out at the same time each day.

    Surgical procedures

    For viral expression for ex vivo experiments, neonatal Swiss Webster or C57Bl/6 (P0–3) mice were anaesthetized on ice for 3 min before injecting viral vectors (AAV5.GfaABC1D.GCaMP6f.SV40 (Addgene, 52925-AAV5), AAV9.hGfap.pinkFlamindo, pENN.AAV9.Gfap.iGluSnFr.WPRE.SV40 (Addgene, 98930-AAV9) or AAV5.GFAP(0.7).RFP.T2A.iCre (Vector Biolabs, 1133)). Pups were placed on a digital stereotax and coordinates were zeroed at lambda. Four injection sites in a 2 × 2 grid pattern over V1 were chosen. Injection sites were 0.8–0.9 mm and 1.6–1.8 mm lateral, and 0 and 0.8–0.9 mm rostral. At each injection site, 30–120 nl of virus was injected at a rate of 3 nl s−1 at two depths (0.1 mm and 0.2 mm ventral/below pia) using a microsyringe pump (UMP-3, World Precision Instruments).

    For viral expression for the in vivo experiments, adult C57BL/6 mice (2–4 months at the time of surgery) were administered dexamethasone (5 mg kg−1, subcutaneously) >1 h before surgery, and anaesthetized using 1.5% isoflurane (Patterson Veterinary Supply, 78908115). After hair removal and three alternating swabs of 70% ethanol (Thermo Fisher Scientific, 04-355-720) and Betadine (Thermo Fisher Scientific, NC9850318), a custom-made titanium headplate was attached to the skull using cyanoacrylate glue and C&B Metabond (Parkell, S380). A 3-mm craniotomy was made over the right visual cortex. Virus was injected at two sites in the right visual cortex at coordinates centred on +2.4 mm and +2.7 mm medial–lateral, +0.35 mm and +0.65 mm anterior–posterior and −0.3 mm dorsal–ventral from lambda. A 300 nl volume of AAV5.GfaABC1D.GCaMP6f.SV40 (Addgene, 52925-AAV5) was injected at each site through a glass pipette and microsyringe pump (UMP-3, World Precision Instruments). After allowing at least 10 min for viral diffusion, the pipette was slowly withdrawn and a glass cranial window was implanted using a standard protocol.

    Ex vivo two-photon imaging and uncaging

    Coronal, acute V1 slices (400-µm thick) from P28–32 (bath-application) and P27–42 (uncaging) mice were cut with a vibratome (VT 1200, Leica) in ice-cold slicing solution containing (in mM) 27 NaHCO3, 1.5 NaH2PO4, 222 sucrose, 2.6 KCl, 2 MgSO4, 2 CaCl2. Slices were transferred to pre-heated, continuously aerated (95% O2/5% CO2) standard artificial cerebrospinal fluid (ACSF) containing (in mM) 123 NaCl, 26 NaHCO3, 1 NaH2PO4, 10 dextrose, 3 KCl, 2 MgSO4, 2 CaCl2. Younger mice were sliced in the same solutions for GCaMP bath-application of LY379268 and baclofen (P20–25), Pink Flamindo (P20–22) and GluSnFR (P14–17). Slices were kept at room temperature until imaging. Bath-application experiments were carried out at room temperature and two-photon uncaging experiments were carried out at 29 °C using an in-line heater (TC-324B and SH-27B, Warner Instruments). To block neuronal action potentials during all slice imaging experiments, except for GluSnFr recordings, tetrodotoxin (TTX; 1 µM) was added to the ACSF >10 min before imaging and remained in the circulating bath for the duration of the experiments.

    Images were acquired on an upright microscope (Bruker Ultima IV) equipped with two Ti:sapphire lasers (MaiTai, SpectraPhysics). Laser beam intensities were modulated using two independent Pockels cells (Conoptics) and images were acquired by scanning with linear galvanometers. Images were acquired with a 16×, 0.8 NA (Nikon) or a 40×, 0.8 NA (Nikon) water-immersion objective via photomultiplier tubes (Hamamatsu) using PrairieView (Bruker) software. For GCaMP imaging, 980-nm excitation and a 515/30 emission filter were used. For RFP imaging, 980-nm excitation and a 605/15 emission filter were used. For Pink Flamindo and Alexa Fluor 594 imaging, 1,040-nm excitation and a 605/15 emission filter were used. Images were acquired at a 1.42 Hz frame rate, 512 × 512 pixels and 0.64–1.61 µm per pixel resolution. For GluSnFR imaging alone, images were acquired at a 6.21 Hz frame rate, 200 × 200 pixels and 0.64 µm per pixel resolution, with 980-nm excitation and a 515/30 emission filter.

    For bath-application experiments, a 5-min baseline was recorded to monitor spontaneous activity, after which receptor agonists were added along with a fluorescent dye (Alexa Fluor 594 hydrazide) to assess the time at which drugs reached the imaging field (except for Pink Flamindo owing to spectral overlap). An ACSF washout period (>10 min), followed by a TTX incubation period (>10 min), occurred between trials when imaging the same slice sequentially for bath-application of different receptor agonists or uncaging of different RuBi subtypes. To account for any changes resulting from prior agonist exposure or uncaging, we alternated the order of agonists between concentrations or RuBi subtypes between slices.

    For simultaneous two-photon imaging and uncaging, a second Ti:sapphire laser beam was tuned to 800 nm and controlled using an independent set of linear galvanometers from those used for scanning. Laser beam intensity was modulated using an independent Pockels cell (Conoptics) to achieve a power measurement of about 2–8 mW at the slice. The beam paths for imaging and uncaging were combined after the linear galvanometers using an 855-longpass dichroic mirror (T855lpxr, Chroma). The uncaging laser was calibrated each experimental day by burning spots into a fluorescent slide. RuBi compounds (300 µM) and TTX (1 µM) were added to the ACSF >10 min before imaging each slice. FOVs were chosen on the basis of the location of GCaMP expression, which was often biased to (brighter in) deeper cortical layers (distance of FOV from pia: 615 ± 196 µm (mean ± s.d., n = 121 FOV)). Before imaging at each FOV, a 60-s period was recorded to identify potential uncaging sites. Areas of GCaMP expression that exhibited moderate levels of spontaneous Ca2+ activity were chosen as uncaging sites. For FOVs with sequential GABA and glutamate uncaging, a continuous 5-min recording was used to monitor activity in each FOV. For FOVs with three sequential rounds of glutamate uncaging, a continuous 12.5-min recording was used to monitor activity in each FOV. Each recording began with a 2.5-min baseline period, and at the 2.5-min mark, NT was uncaged with 10 × 100 ms pulses, 100 ms apart. Sequential recordings of GABA and glutamate uncaging within the same FOV were separated by >20 min. Rounds of sequential glutamate uncaging were separated by ≥25 min. Voltage from the uncaging laser Pockels cell was recorded to mark the time of uncaging pulses. As RuBi–GABA and RuBi–glutamate are light-sensitive, care was taken to ensure experiments were carried out in minimal light. The computer screen and redshifted headlamp were covered with two layers of red filter paper (Roscolux number 27 filter, Rosco) and all indicator lights on equipment were covered.

    In vivo two-photon imaging

    In vivo two-photon imaging was carried out on the same microscope as ex vivo imaging, using a Nikon 16×, 0.8 NA water-dipping objective with a ×2 optical zoom (frame rate: 1.7 Hz, FOV: 412 µm2, resolution: 512 × 512 pixels). Animals were given >1 week after surgery for recovery and viral expression. They were then habituated on a custom-made circular running wheel over at least 2 days, and for a cumulative time of at least 2.5 h, before recording. After habituation, mice were head-fixed on the wheel and movements were recorded by monitoring deflections of coloured tabs on the edge of the wheel using an optoswitch (Newark, HOA1877-003). To compute wheel speed, a detected break in the optoswitch circuit was determined when the absolute value of the derivative of the raw voltage trace was at least 2 standard deviations above the mean. For recordings with little movement (s.d. < 0.1), this threshold generated false positives, so a set threshold of 0.1 was used. The number of breaks in the optoswitch circuit per second was then calculated, and using the circumference and number of evenly spaced coloured tabs at the edge of the wheel, the wheel speed was determined and used for all subsequent analyses using speed. Movement periods were defined by wheel speed ≥10 cm s−1 and movement bouts that were separated by ≤2 s were considered one event. To ensure that movement-related dynamics were not included in stationary analysis, data were excluded from <10 s around identified movement periods. GCaMP was imaged with 950-nm excitation light and a 515/30 emission filter. Recordings lasted 30 min.

    Ex vivo pharmacology

    The following concentrations of each pharmacological reagent were used for experiments as indicated in the text: tetrodotoxin citrate (TTX, 1 µM, Hello Bio); carbenoxolone disodium (CBX, 50 µM, Tocris Bioscience); R(+)-baclofen hydrochloride (5–100 µM, Sigma-Aldrich); (1S,3R)-ACPD (t-ACPD, 5–100 µM, Tocris); LY379268 disodium salt (100 µM, Tocris); Alexa Fluor 594 hydrazide (0.1–2 µM, Thermo Fisher Scientific); RuBi GABA trimethylphosphine (RuBi-GABA-Pme3, 300 µM, Tocris); RuBi–Glutamate (300 µM, Tocris); CGP 55845 hydrocholoride (10 µM, Tocris); and LY341495 (10 µM, Tocris).

    Immunohistochemistry and image quantification

    After recording, slices from two-photon imaging experiments were immersed in 4% PFA for 30 min and switched to 30% sucrose for 1 day at 4 °C before being embedded in OCT and stored at −80 °C. Slices were re-sectioned coronally at 40 µm on a cryostat and then stored in cryoprotectant at −20 °C until staining. For immunohistochemistry, sections were washed three times in 1× PBS for 5 min and permeabilized for 30 min with 0.01% Triton-X in 1× PBS. Sections were next blocked with 10% NGS (Abcam) for 1 h and incubated overnight with primary antibodies at 4 °C in 2% NGS. The next day, they were washed three times in 1× PBS before incubating with secondary antibodies for 2 h at room temperature. Sections were washed three times in 1× PBS for 5 min before being mounted on slides with Fluoromount-G (SouthernBiotech).

    To validate reduction of Cx43 protein in astrocytes transduced with adeno-associated viruses to express GCaMP–GFP and Cre–RFP, primary antibodies to anti-Cx43 (1:1,500, rabbit, Sigma-Aldrich), anti-GFP (1:3,000, chicken, Abcam) and anti-mCherry (1:2,000, rat, Thermo Fisher Scientific) in 2% NGS were used. Secondary antibodies include anti-rabbit Alexa Fluor 405, anti-chicken Alexa Fluor 488 and anti-rat Alexa Fluor 555 (all Thermo Fisher Scientific), which were all used at 1:1,000 dilution. ×60 multi-channel z-stack images were acquired on a CSU-W1 spinning-disc confocal microscope (Nikon) using MicroManager from V1 in which adeno-associated viruses were injected. To quantify loss of Cx43 in RFP+ and RFP astrocytes, Fiji (ImageJ) was used. Through batch processing, cell maps were created through a semi-automated pipeline to segment astrocytes, with post hoc ROI adjustments for vasculature artefacts. Multi-channel z-stacks were split into 405, 488 and 555 channels, and unstacked into sequential 8-bit z-plane images. For each z-plane, RFP+ and RFP astrocytes were detected using a Gaussian blur (sigma = 3), thresholding using the Phansalkar method (radius = 1,000) and applying ImageJ’s Analyze Particles command (size > 175 µm2, circularity = 0–0.60) to outline ROIs using the wand tool. Corresponding Cx43 images were binarized and the Fiji plugin SynQuant58 was used to detect Cx43 puncta number within each RFP+ and RFP astrocyte in a z-plane’s cell map. Puncta counts were normalized to astrocyte area, and the normalized count from each z-stack was averaged for each slice.

    Two-photon image and data analysis

    Individual-astrocyte cell maps for time-series images were created in Fiji using the following process. For each FOV, an 8-bit z-projection of the time series was created. The z-projection was binarized using the Auto Local Threshold feature, using the Niblack method and a radius of 30 or 75, for 16× and 40× images, respectively. Cell maps were drawn on binarized images using a combination of the Lasso and Blow Tool and the freehand drawing tool in Fiji, and verified on the z-projected image. Cell maps were also verified against a static indicator of astrocyte morphology when available (EAAT2-tdT+ mice for bath-application of LY379268 and baclofen; GFAP(0.7)-RFP-T2A-iCre in Cx43-floxed mice). To load cell masks into AQuA, regions were saved to the ROI manager and filled in with a colour. The regions were projected onto a black image the same size as the original (512 × 512 pixels). The overlay of regions was flattened, converted to an 8-bit image and saved as a tiff. For the 12.5-min recordings with sequential rounds of glutamate uncaging, drift of the slice in x and y was corrected post hoc using moco59.

    AQuA

    GCaMP and GluSnFR two-photon image sequences were analysed using AQuA8 and custom MATLAB (MATLAB R2018b) and Python (v3.8.18) code. Signal detection thresholds were adjusted for each video to account for differences in noise levels after manually checking for accurate AQuA detection. Cell maps were loaded into AQuA to define cells consistently over multiple time series featuring the same FOV. For all bath-application experiments, the direction of pia was marked as anterior. For two-photon uncaging experiments, the uncaging site was marked as a 3 × 3-pixel landmark.

    Bath-application event-based analysis

    For baclofen and t-ACPD Ca2+ imaging experiments, event count per frame was quantified by counting all AQuA-detected events, new or ongoing, in each frame (Fig. 1c). Percentage of field active values were calculated by recording the number of active pixels in each frame, as determined by the frame-by-frame footprints of AQuA-detected events. These values were normalized by the total number of active pixels in the recording and multiplied by 100. For the percentage of field active dose–response curve (Fig. 1e), the percentage of field active values from all frames within the chosen time points were averaged by slice. Event propagation was calculated by summing the growing propagation from all cardinal directions, using the AQuA feature propGrowOverall. For dose–response curves for discrete event features (area, duration and propagation; Fig. 1f–h), all detected Ca2+ events within the chosen time points were averaged by slice.

    The frame in which the agonist entered the recording chamber was estimated using fluorescence from Alexa Fluor 594 (0.1–2 µM, added to the ACSF reservoir along with the agonist) by using the maximal curvature method on frames 1–600 of the raw Alexa Fluor 594 fluorescence trace. The maximum curvature method60 defines the onset fluorescence changes as the point of maximum curvature during the rising phase of the signal. To identify this point, traces were fitted using a modified Boltzmann’s sigmoidal equation:

    $$f\left(x\right)=\frac{a}{1+{{\rm{e}}}^{\left(b-x\right)/d}}+c$$

    in which a is the difference between the minimum and the maximum fluorescence, b is the inflection point, c is the baseline fluorescence and d is the slope, using a nonlinear least-squares algorithm (Levenberg–Marquardt) in MATLAB (Mathworks). Next, the frames of maximum curvature were calculated by setting the fourth derivative of the fitted curve equal to zero and solving for its three solutions. The earliest frame identified out of these three solutions was recorded as the onset frame.

    Bath-application ROI-based analysis

    Pink Flamindo and GCaMP imaging experiments were analysed using ROI-based approaches in Fiji. To identify responding cells in Pink Flamindo experiments (Extended Data Fig. 1j), sigmoidal curves were fitted to ΔF/F traces using the modified Boltzmann’s sigmoidal equation detailed above. Cells were defined as responding if the difference between the minimum and maximum values of the fit curve (a in the Boltzmann’s sigmoidal equation) was greater than the baseline noise (3 s.d. of baseline fluorescence). Responding cells were defined as increasing if \(f\left({x}_{{\rm{start}}}\right) < f\left({x}_{{\rm{end}}}\right)\) and decreasing if \(f({x}_{{\rm{start}}}) > f({x}_{{\rm{end}}})\).

    To identify fluctuations in Pink Flamindo and GCaMP fluorescence (Extended Data Fig. 1k), peaks were detected from ΔF/F traces from individual cells. Peaks were counted if they were 3 s.d. above the mean baseline fluorescence, and had a minimum peak width of 5 frames and a minimum distance of 10 frames between detected peaks. The baseline period was defined as all frames before the frame of agonist entry. For GCaMP, all astrocytes exhibiting ≥1 AQuA-detected event during the 10-min recording were run through peak finding. For Pink Flamindo, all detected astrocytes were run through peak finding.

    For GCaMP experiments, the frame in which the agonist entered the recording chamber was estimated using the fluorescence from Alexa Fluor 594 (0.1–2 µM) added to the ACSF reservoir along with the agonist. The time of agonist entry in the recording chamber was estimated by identifying the first frame in which Alexa Fluor 594 fluorescence reached ≥3 s.d. above the baseline mean (frames 1–300); only frames >375 were considered for evaluation of exceeding the threshold. For Pink Flamindo experiments, dye was not added with the agonist to avoid spectral overlap. The time of agonist entry in the recording chamber was estimated by adding 90 frames (the average number of frames for ACSF to travel from the reservoir to the recording chamber) to the frame in which the agonist was added to the reservoir of ACSF.

    Two-photon uncaging event-based analysis

    Individual astrocytes were excluded from analyses (Figs. 2–4 and Extended Data Figs. 2–7) if the baseline event rate changed significantly. Changes in baseline event rate for each cell were determined by carrying out Poisson regression of events in 1-s bins during the period from 90 to 10 s pre-uncaging. Cells with a regression coefficient with P < 0.1 at the baseline and with >5 AQuA-detected events throughout the recording were excluded from all analyses, except for Extended Data Fig. 7d RuBi–glutamate uncaging control. ∆F/F values in raster plots (Figs. 2h and 3c) were calculated using the AQuA output dffMatFilter(:,:,2), the ∆F/F traces from events after removing the contributions from other events in the same location. Cells (Fig. 2h) or local astrocyte networks (Fig. 3c) were sorted on the basis of the onset time of a response following uncaging. A response was defined as the first post-stimulus peak greater than or equal to the threshold (mean baseline ΔF/F + 3 s.d.), with thresholds calculated by cell or local network using 90–0 s before uncaging. For Fig. 3c, the z score of each local network was calculated using the mean ΔF/F from AQuA-detected events in the network, using a baseline period of 90–0 s before uncaging. For the Sholl-like analysis (Fig. 3h), events were sorted into 50-µm bands radiating out from the uncaging site using the minimum distance between an event and the uncaging site at event onset (using the AQuA output ftsFilter.region.landmarkDist.distPerFrame). The 50-µm-wide bands began 25 μm and ended 175 µm from uncaging, as events <25 μm from the uncaging site occur within the stimulated astrocyte and those >175 μm from the uncaging site can be outside the FOV (Extended Data Fig. 3i). The periods 90–0 s before and 0–150 s after uncaging were used to calculate the change in event number per 30 s per band. To categorize events as propagative or static (Fig. 4d–m and Extended Data Figs. 5b–j, 6 and 7c), the total propagation distance of each event was computed by summing the growing propagation from all cardinal directions, using the AQuA feature propGrowOverall. Events were categorized as propagative if the total propagation distance was >1 µm.

    Statistics and reproducibility for representative micrographs and spatial heat maps

    Representative micrographs were chosen from experiments repeated with similar results from the following n—Fig. 1b: n = 4 slices, 4 mice; Fig. 2c: n = 72 trials, 12 recordings, 4 slices, 2 mice; Fig. 2f,g: n = 28 astrocytes, 7 slices, 4 mice (note the heterogeneity shown in Fig. 2h for individual astrocyte responses to NT); Fig. 3b: n = 28 FOV, 7 slices, 4 mice; Fig. 4a: n = 28 FOVs, 7 slices, 4 mice; Fig. 4c: n = 15 recordings, 5 mice; Extended Data Fig. 1i: n = 8 slices, 3 mice; Extended Data Fig. 3b: n = 91 FOVs, 16 slices, 8 mice; Extended Data Fig. 5a: n = 28 FOVs, 7 slices, 4 mice.

    Statistics for Figs. 1–3 and associated Extended Data figures

    All statistical tests used and the exact n values can be found for each figure in the corresponding figure legend. Adjustments for multiple comparisons using Bonferroni–Holm correction were implemented using fwer_holmbonf61. Significance levels were defined as follows: NS: P ≥ 0.05; *P < 0.05; **P < 0.01; ***P < 0.001.

    Permutation testing

    Statistical significance for time-series data was computed using permutation testing with custom-written code in MATLAB. A total of 10,000 permutations were run and one- or two- sided P values for each time point were calculated. P values were corrected for multiple comparisons using the Benjamini–Yekutieli procedure (implemented using ref. 62) with a false discovery rate of ≤0.05.

    Data were shuffled (permuted) in the following way. To test change in event number per cell (Fig. 1c and Extended Data Figs. 2b and 3g,h), events were shuffled independently for each active cell (≥1 AQuA-detected event) in each time series. For each active cell, events were randomly placed in time bins spanning the duration of the recording (time bins of 60 s (Fig. 1c) and 30 s (Extended Data Figs. 2b and 3g,h)) and the change in number of events per time bin was calculated as for the experimental data. Permuted changes in event number per cell were averaged across active cells in each time series and across all time series to obtain the permuted mean for one round of permutation testing.

    To test change in event number per band (Fig. 3h), permutation tests were run separately for each band and events were shuffled independently for each time series. For each time series, events from the tested band were randomly placed in 30-s time bins spanning the duration of the recording, and the change in event number per 30 s was calculated as for the experimental data. Permuted changes in event number per 30 s were averaged across all time series to obtain the permuted mean for one round of permutation testing. To test the magnitude of change in experimental data versus permuted data, two-sided P values were calculated as:

    $$\frac{({\rm{number}}\,{\rm{of}}\,{\rm{times}}| {\rm{permuted}}\,{\rm{change}}| \ge | {\rm{experimental}}\,{\rm{change}}| )+1}{{\rm{number}}\,{\rm{of}}\,{\rm{permutations}}+1}$$

    For testing increases in ∆F/F (Extended Data Fig. 1d), frames were shuffled independently for each time series. For each time series, the average ∆F/F per frame from active regions (≥1 AQuA-detected event in either condition (baclofen or t-ACPD)) was calculated, the frame order was shuffled, and the mean ∆F/F per 30 s was calculated. Permuted mean ∆F/F was averaged across all time series to obtain the permuted mean for one round of permutation testing. To test the magnitude of increases in experimental data versus permuted data, one-sided P values were calculated as:

    $$\frac{({\rm{number}}\,{\rm{of}}\,{\rm{times}}\,{\rm{the}}\,{\rm{permuted}}\,{\rm{mean}}\ge {\rm{the}}\,{\rm{experimental}}\,{\rm{mean}})+1}{{\rm{number}}\,{\rm{of}}\,{\rm{permutations}}+1}$$

    Statistics for Figs. 3i–l and 4, and associated Extended Data figures

    Two-photon uncaging grid-based ROI analysis

    Grid-based ROIs were determined by dividing the 300 × 300 µm imaging field into a uniform 20 × 20 µm grid (Fig. 3i–l). Each identified Ca2+ event was assigned to the ROI in which the centroid of its spatial footprint was located. ROIs with any baseline events were identified as ROIs with ≥1 events in the baseline window 60–0 s before uncaging. Active ROIs for each NT were identified as ROIs with a ≥50% increase in event rate in the window 0–120 s after uncaging for that NT, as compared with the rate during the baseline window. Active ROIs were a subset of ROIs with baseline events, as the relative increase in event rate is not defined when there are no baseline events, which results in division by 0. The distance from the uncaging site to each active ROI was determined using the Euclidean distance between the uncaging site, at (0, 0), and the centre of each grid ROI (Fig. 3j).

    The fraction of overlap (that is, Jaccard index) Oi between active ROIs for GABA and glutamate was determined for the ith FOV by

    $${O}_{i}=\frac{\left|{A}_{\text{GABA},i}\cap {A}_{\text{glutamate},i}\right|}{\left|{A}_{\text{GABA},i}\cup {A}_{\text{glutamate},i}\right|}$$

    in which AGABA,i and Aglutamate,i are the sets of active ROIs for GABA and glutamate, respectively, and and |X| denotes the number of elements of the set X. The overall fraction of overlap O between active ROIs for GABA and glutamate was computed as the mean of the individual Oi (Fig. 3l).

    To determine whether the observed fraction of overlap was expected because of chance, a distribution of n = 10,000 surrogate fractions of overlap was computed. The kth surrogate value, \({\widetilde{O}}^{(k)}\), was computed as above, but replacing, for each NT, the set of active ROIs ANT,i with a new set, \({\widetilde{A}}_{\text{NT},i}^{(k)}\), which was chosen as a random subset of size |ANT,i| of the set of ROIs with any baseline events for that NT. The P value for this comparison was estimated63 as

    $$P=\frac{({\rm{number}}\,{\rm{of}}\,{\widetilde{O}}^{(k)}\ge O)+1}{n+1}$$

    (1)

    Propagation probability (Fig. 4b)

    Each Ca2+ event was identified as growing in the depth axis if the frontier of that event’s spatial footprint extended over time either towards the pia or away from the pia, as determined by the posterior and anterior component of the propGrowOverall metric computed through segmentation by AQuA8.

    The probability of events growing in the depth axis was computed separately for recordings of GABA and glutamate uncaging within each examined time window. Probabilities were estimated for the baseline window of 60–0 s before uncaging, as well as in non-overlapping 30-s bins ranging from 0 to 150 s post-uncaging, by computing the fraction of events that were identified as growing in the depth axis among all events from all recordings within the relevant time window. The change in the probability of events growing in the depth axis was then estimated for each bin as the difference between the fraction of events growing in the depth axis for that bin versus for the baseline period.

    To empirically determine the distribution of each of these estimators, we carried out this same procedure for estimating the probability of events growing in the depth axis for each NT and time bin on surrogate data generated by hierarchically bootstrapping Ca2+ event data, for which the hierarchy was sampled cells within sampled recordings (that is, all events for an individual recording of one individual cell always remained together); this procedure was repeated 10,000 times for each bin. Standard errors were computed as the standard deviation of these empirical distributions.

    To determine the probability of observing effects this large under a null hypothesis of no effect of time on the probability of events growing in the depth axis, we computed the distribution of the estimator under an imposed condition in which the overall temporal structure of astrocyte Ca2+ events was disrupted. To do this, we carried out the same procedure as above for estimating the probability of events growing in the depth axis for each bin, but on surrogate data generated by circularly shifting the timing of each individual cell’s Ca2+ events from 90 s before to 150 s after uncaging by its own independent, uniform random shift between 0 s and 240 s; this procedure was repeated n = 10,000 times for each bin. As it was unknown whether event propagation would increase or decrease post-uncaging, two-sided P values were estimated63 as

    $$P=\frac{({\rm{number}}\,{\rm{of}}\,| {\widetilde{X}}^{(k)}| \ge | X| )+1}{n+1}$$

    (2)

    in which X denotes the actual observed value of the estimator, and each \({\widetilde{X}}^{(k)}\) is the value of the estimator computed from the kth shifted dataset. These P values were adjusted across tested time bins and NTs using the Benjamini–Hochberg procedure to obtain q values, as implemented in statsmodels 0.12.2 (ref. 64).

    Event feature changes (Extended Data Fig. 4a,b)

    Each Ca2+ event is assigned several metrics by AQuA-segmentation8, including size (area, perimeter, circMetric (circularity, based on area and perimeter)), amplitude (dffMax) and dynamics (rise19 (rise time), fall91 (fall time), decayTau (decay time constant), width11 (duration)). For each non-propagation metric, the mean metric value among events was computed separately for recordings of GABA and glutamate uncaging for the baseline window 60–0 s before uncaging, as well as in non-overlapping 30-s bins from 0 to 150 s post-uncaging. For each bin, the ratio of that bin’s mean metric value to the baseline mean metric value was computed.

    AQuA metrics also capture information about events’ directional propagation. Each Ca2+ event was identified as growing or shrinking in each cardinal direction if the frontier of that event’s spatial footprint extended or receded, respectively, over time in that direction, as determined by the components of the propGrowOverall and propShrinkOverall metrics. For each propagation metric, the change in the probability of events growing or shrinking in each axis was computed separately for recordings of GABA and glutamate uncaging within each examined time window, as in the section entitled “Propagation probability”, but using the ‘growing’ or ‘shrinking’ identifiers for each cardinal direction.

    To empirically determine the distribution of each of these estimators (that is, binned post/baseline ratio for non-propagation metrics, binned change in growing or shrinking probability for propagation metrics), we carried out the same procedures for computing each metric’s relevant estimators for each NT and time bin outlined above on 10,000 surrogate datasets generated by hierarchically bootstrapping Ca2+ event data, as described in the section entitled “Propagation probability”. Standard errors were computed as the standard deviation of these empirical distributions.

    To determine the probability of observing effects this large under a null hypothesis of no effect of time on the probability of events growing in the depth axis, we computed the distribution of each estimator under 10,000 realizations of an imposed condition in which the overall temporal structure of astrocyte Ca2+ events was disrupted by randomly circularly shifting each cell’s Ca2+ events, as described in the section entitled “Propagation probability”. As it was unknown whether event propagation would increase or decrease post-uncaging, two-sided P values were estimated using equation (2) above63. These P values were adjusted across tested time bins and NTs using the Benjamini–Hochberg procedure to obtain q values, as implemented in statsmodels 0.12.2 (ref. 64).

    Comparison of in vivo and ex vivo event propagation (Fig. 4d)

    Events were categorized as propagative or static, as outlined in the section ‘Two-photon uncaging event-based analysis’. The fraction of propagative events observed in vivo and ex vivo was calculated using baseline events. Ca2+ events in in vivo recordings were labelled as baseline events if they occurred during periods when the mouse was stationary, as outlined in the section entitled “In vivo two-photon imaging”. Ca2+ events in ex vivo recording were labelled as baseline events if they occurred in neighbouring astrocytes (that is, cells not directly stimulated by NT) during the 60–0 s before NT uncaging.

    To determine the distribution of the two median propagative event fractions empirically, we computed the medians of 10,000 bootstrapped samples of the per-recording fractions for each setting. Standard errors for each statistic were determined from the standard deviations of these empirical distributions.

    Computing rate changes for propagative and static events (Fig. 4f,j and Extended Data Fig. 6b,c)

    The overall rates of propagative and static events for neighbouring astrocytes were computed separately for recordings of GABA and glutamate uncaging.

    For each event class (that is, propagative and static events), for each recording, the event rate was computed in each time window as the total number of events from all neighbouring cells in that recording in the given time window divided by the duration of that time window. These recording-level rates were computed for the baseline window of 60–0 s before uncaging and in non-overlapping 30-s bins ranging from 0 to 150 s post-uncaging. For each recording, the relative rate of propagative and static events was computed for each time bin as the ratio of the event rate for the given event class in that time bin divided by the corresponding event rate in the baseline window. For each time bin, the overall relative rate was estimated as the median of the per-recording relative rates in that time bin.

    To determine the distribution of each of these relative rate estimators empirically, we carried out this same procedure for estimating relative event rates on surrogate data generated by hierarchically bootstrapping Ca2+ event data 10,000 times for each bin (as in the section ‘Propagation probability’). Standard errors were computed as the standard deviation of these empirical distributions.

    To determine the probability of observing effects this large under a null hypothesis of no effect of time post-uncaging on the rate of astrocyte Ca2+ events, we computed the distribution of the relative rate estimators under an imposed condition in which the overall temporal structure of astrocyte Ca2+ events was disrupted using a random circular shift of the events in each cell, as in Fig. 4b; this procedure was repeated n = 10,000 times for each bin. Motivated by results in bath-application experiments above demonstrating robust aggregate astrocyte Ca2+ event rate increases in response to agonism of glutamate or GABA receptors (Fig. 1c), we estimated one-sided P values from these permuted datasets, as in equation (1). These P values were adjusted across tested time bins and NTs using the Benjamini–Hochberg procedure to obtain q values, as implemented in statsmodels 0.12.2 (ref. 64).

    Determining responding cells on the basis of static and propagative events (Fig. 4h,k and Extended Data Fig. 6e,f)

    The overall rates of propagative and static events were computed for each neighbouring astrocyte, with paired measurements made for recordings of GABA and glutamate uncaging. For each neighbouring astrocyte, for each event class (that is, propagative and static events), the event rate was computed in each time window as the total number of events from that cell in the given time window divided by the window’s duration (baseline window: 60–0 s before uncaging, response window: 0–120 s after NT uncaging; Extended Data Fig. 5c). Relative event rates were calculated as for Fig. 4f,j and Extended Data Fig. 6b,c. Cell-recording combinations with zero events of a given type in the baseline window were excluded for computation of relative rates of propagative (GABA: 36 recordings of cells (26.7% of total); glutamate: 37 (32.2%)) and static (GABA: 0; glutamate: 0) events, as the relative rate would require a division by zero and be undefined in those cases. Astrocytes were identified as ‘responders’ with a particular event type (that is, static or propagative) to GABA or glutamate if their relative rate of that type of event was ≥1.5 for the corresponding NT uncaging recording (Extended Data Fig. 5d). The fraction of astrocytes that were responders was computed for each individual recording, as well as the overall fraction of responders averaged across all recordings for each NT.

    To determine the distribution of these overall responder fractions, we carried out this same procedure for estimating relative event rates on surrogate data generated by hierarchically bootstrapping Ca2+ event data 10,000 times (as in the section ‘Propagation probability’). Standard errors were computed as the standard deviation of these empirical distributions.

    To determine whether there were significant differences between the overall responder fractions for GABA and glutamate, we computed the distribution of the difference between these two fractions under an imposed condition in which there was no systematic difference between GABA and glutamate. To do this, we carried out the same procedure as above for estimating the difference between the overall responder fractions for ‘GABA’ and ‘glutamate’, but on surrogate data generated by, for each cell, swapping the labels for ‘GABA’ and ‘glutamate’ responses from that in the experimental data with probability 1/2; this procedure was repeated 10,000 times. As it was unknown a priori whether GABA or glutamate would have a higher fraction of responder cells, a two-sided P value was estimated as in equation (2).

    Decoding NT identity from propagative event responses (Fig. 4i)

    To quantify the extent to which the observed difference in propagative event responses to uncaged glutamate and GABA enabled reliable identification of NT identity on a trial-by-trial basis, we built a simple classifier that took as input a single value, the relative change in propagative event rate across a FOV in the window 0–120 s post-uncaging relative to the window 60–0 s pre-uncaging, and classified that FOV as responding to glutamate if the value was greater than or equal to a set threshold, and GABA if the value was less than the threshold. To evaluate this classifier’s performance, we built a receiver operating characteristic curve by varying the classification threshold across the entire domain of the feature, and at each value of the threshold, computing the empirical true positive rate and false negative rate of the classifier. With the threshold fixed in the receiver operating characteristic analysis, the classifier did not have any remaining free parameters, so did not need to be trained on data and was therefore not a function of any of the data, obviating the need for cross-validation. We computed the AUC using the trapezoidal rule. To determine the distribution of the observed AUC statistic, we carried out this same analysis on 10,000 surrogate datasets generated by bootstrapping (that is, resampling FOVs with replacement). To determine whether the observed AUC statistic was above 0.5 (indicating completely non-informative decoding) to a degree greater than expected by chance alone, we carried out this same analysis on 10,000 surrogate datasets generated by permuting the NT labels.

    Determining correlations between GABA and glutamate responses (Fig. 4l)

    To determine whether individual cells’ responses to GABA and glutamate—as determined in Fig. 4h—were correlated, we computed the Spearman ρ between the binary paired responses to GABA and glutamate across cells that could be assessed in both conditions (that is, had >0 propagating baseline Ca2+ events in both recordings) using SciPy 1.6.2 (ref. 65). To determine the probability of observing a correlation at least this large under a null hypothesis of independence between cells’ responses for GABA and glutamate, we computed the Spearman ρ on surrogate data in which the identities of the cells’ responses to GABA and glutamate were independently permuted; this procedure was repeated 10,000 times. To maintain the ability to identify correlation or anticorrelation, we estimated a two-sided P value from these surrogate values, as in equation (2).

    To complement this analysis, we computed the fraction of overlap (that is, Jaccard index) between the sets \({C}_{\text{GABA}}\) and \({C}_{\text{glu}}\) of cells that were responders to GABA and glutamate, respectively:

    $$O=\frac{\left|{C}_{\text{GABA}}\cap {C}_{\text{glu}}\right|}{\left|{C}_{\text{GABA}}\cup {C}_{\text{glu}}\right|}$$

    This statistic is larger when the fraction of overlap between responders for the two NTs is larger. To determine the probability of observing an overlap at least this large under a null hypothesis of independent responses for GABA and glutamate, we computed this same statistic, but on 10,000 permuted surrogate datasets, as above. To determine significant overlap, we estimated a one-sided P value from these surrogate values, as in equation (1).

    Segregating responding cells on the basis of baseline propagation (Fig. 4m)

    For each neighbouring astrocyte with propagative events during the baseline period of 60–0 s pre-uncaging, we computed the fraction of baseline events that were propagative (number of propagative baseline events/total number of baseline events). Separately for GABA and glutamate, we used the propagative fraction across all given astrocytes to define the threshold fraction of baseline propagative activity, f50, as the 50th percentile of all observed values; cells with fractions strictly less than f50 were said to have a low fraction of propagative events at the baseline, whereas cells with fractions greater than or equal to f50 were said to have a high fraction of propagative events at the baseline (Extended Data Fig. 5e, top). The fraction of astrocytes that were responders with propagative events to GABA or glutamate were separately estimated from among those astrocytes that had low baseline propagation and those that had high baseline propagation, as described in the section entitled “Determining responding cells based on static and propagative events”. Owing to the low number of cells in each split group for individual FOVs, the overall average was estimated by pooling all neighbouring astrocytes in each group across FOVs.

    Similarly for each neighbouring astrocyte with baseline propagative events, we computed the rate of all events within the baseline period. Separately for GABA and glutamate, we used the baseline event rate across all neighbouring astrocytes to define the threshold baseline event rate, r50, as the 50th percentile of all observed values; cells with baseline rates strictly less than r50 were said to have low overall baseline event rates, whereas cells with fractions greater than or equal to r50 were said to have high overall baseline event rates (Extended Data Fig. 5e, bottom). The fraction of astrocytes that were responders with propagative events to GABA or glutamate were separately estimated from among those astrocytes that had low overall baseline event rates and those that had high overall baseline event rates, as above.

    To determine the distribution of these responder fractions (among astrocytes with low and high fractions of propagative events at the baseline, or among astrocytes with low and high overall baseline event rates), we carried out the same procedure for estimating these fractions on surrogate data generated by hierarchically bootstrapping Ca2+ event data 10,000 times (as in the section entitled “Propagation probability”). Standard errors were computed as the standard deviation of these empirical distributions.

    For each NT, we next sought to determine whether there were significant differences between the fraction of astrocytes that were responders with propagative events among cells within the two groupings (that is, a low versus a high fraction of propagative events at the baseline; low versus high overall baseline event rate). Separately for GABA and glutamate, for each group comparison, we computed the difference between the two responder fractions, as well as the distribution of this difference under an imposed condition in which there was no systematic difference in uncaging response between astrocytes in the two groups. To do this, we carried out the same procedure as above for estimating responder fractions in the specified groups (for example, low fraction of propagative events at the baseline and high fraction of propagative events at the baseline) as well as the difference between the two, but on surrogate data generated by permuting the group labels; this procedure was repeated 10,000 times. As it was unknown a priori which group in either comparison—low or high baseline propagation, or low or high overall baseline event rate—would have a higher fraction of responder cells, a two-sided P value was estimated from these surrogate values, as in equation (2).

    Simulations to validate characteristics of responder fraction estimates (Extended Data Fig. 5k)

    Stratifying propagative event responses by the fraction of propagative events in the baseline may induce regression to the mean (RTM) effects, resulting in a bias towards higher observed responsiveness in the low fraction of propagative events at the baseline group as compared to the high-fraction group. In general, observed effects in differences of repeated measurements stratified by baseline values can arise from a combination of RTM effects and real effects—with the strength of the contribution from RTM depending on the dependency structure and measurement error characteristics in the data—complicating attribution of the observed total effect. To contextualize the observed effect sizes relative to the distribution of effects produced from a pure RTM process, we carried out the same procedure as above for estimating responder fractions in the low and high fraction of propagative events at the baseline groups, but using surrogate data generated using a random point process model. This model produced simulated event data structured in the same way as the observed dataset: for each cell, the model generated two independent homogeneous Poisson processes, one corresponding to static events and the other corresponding to propagative events. During the simulated baseline period, from 60 s to 0 s pre-‘uncaging’, the rates of these two processes in each cell were set to the observed rate of the corresponding type of event during the veridical baseline period. During the simulated post-‘uncaging’ period, from 0 s to 120 s, the rates of these two processes in each cell were determined by multiplying that cell’s baseline rate for the corresponding event type by a response ratio, which was chosen from the empirical distribution of observed post-/pre-uncaging event ratios from among all neighbouring cells for the given event type. In this way, the simulation modelled the overall response characteristics for propagative events, but in a way that was decoupled from the propagative event fraction in the baseline period.

    This simulation procedure was repeated 10,000 times, resulting in a distribution of low–high response fraction differences observed in surrogate data structured in the same way as either the GABA or glutamate uncaging datasets, but with no explicit dependence of cells’ propagative event responses on the baseline propagative event fraction. To summarize the observed effect relative to the effects seen in these simulations, we calculated the fraction of simulations with low–high differences larger than the observed effect.

    Reporting summary

    Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

    [ad_2]

    Source link