Tag: Cellular neuroscience

A brainstem–hypothalamus neuronal circuit reduces feeding upon heat exposure

[ad_1]

Mice

Experimental procedures on mice conformed to the 2010/63/EU directive and were approved by the Austrian Ministry of Education, Science and Research (66.009/0145-WF/II/3b/2014 and 66.009/0277-WF/V3b/2017). All procedures were planned to reduce suffering, as well as mouse numbers. Mice were kept under standard housing conditions (12 h:12 h reverse light:dark cycle with light on at 22:00 and off at 10:00, 25 °C), with food and water available ad libitum. For acute thermal manipulations, ex vivo electrophysiology, neuroanatomy, and behavioural tests, C57Bl6/J mice were used. Rax^{tm1.1(cre/ERT2)Sbls}/J mice (Rax-CreER^T2; JAX 025521) were crossed with B6.Cg-Gt(ROSA)26Sor^{tm14(CAG-tdTomato)Hze}/J (referred to as Ai14; JAX 007914), B6;129S6-Polr2a^{Tn(pb-CAG-GCaMP5g,-tdTomato)Tvrd}/J (PC-G5-tdT; JAX 024477) or B6;129S-Slc17a6^{tm1.1(flpo)Hze}/J (Slc17a6-IRES2-FlpO-D; JAX 030212) at ages between postnatal days (P)60-90. B6;129P2-Mapt^tm2Arbr/J (referred to as Tau^mGFP-loxP; JAX 021162) were used for transsynaptic labelling. Agrp⁺ neurons were visualized by crossing Agrp^tm1(cre)Lowl/J (JAX 012899) and Ai14 reporter mice. Mice of both sexes were used for experiments, as indicated. For primary cultures of tanycytes, both male and female Wistar rats were used. To sample the CSF, male Wistar rats were cannulated, as approved by the Ethical Review Board of Semmelweis University (PE/EA/1234-3/2017, Hungary).

Acute heat exposure

C57Bl6/J mice of both sexes aged P60–P100 were housed individually and habituated in an Aria BIO-C36 EVO incubator (Tecniplast) at 25 °C with a reverse 12 h:12 h light:dark cycle (light on at 22:00) with 42% humidity for 3 days. One day before acute thermal challenge, the temperature of an MIR-254 incubator (Sanyo) was set to the relevant target temperature. To maintain humidity in the incubator, a Becher glass filled with 1 l water was placed in the incubator. Humidity (~42%) and CO₂ levels (~396 ppm) were continuously measured with a CO100 CO₂ monitor (EXTECH Instruments). At 09:00 on day 4 (that is, 1 h before the beginning of the dark (off) phase of the light cycle), the mice were placed in new experimental cages without food and water, exposed to 25 °C for 1 h, and then returned to their home cages. On day 5 (09:00), mice were again placed in experimental cages without food and water, and then exposed to either 4 °C or 40 °C for 1 h. Subsequently, the mice were returned to their cages in an Aria BIO-C36 EVO incubator (Tecniplast) set at 25 °C.

To record skin temperature, C57Bl6/J male mice were singly housed, with their interscapular area above the main brown fat depot shaved 2–3 days prior to the experiments. Mice were then exposed to 40 °C for 1 h. Control mice were kept at 25 °C. Body temperature was recorded at both the interscapular area and the perianal region of each mouse using an infrared thermometer^60,61 (DET-306, Femometer). Baseline temperature was acquired 15 min prior to the thermal challenge, followed by switching them to a thermo-controlled chamber (Memmert, MEMM-OT3007S) set to 40 °C, and left undisturbed for 1 h. Temperature recordings resumed at intervals of 15 min for another 180 min after heat exposure ended, with the mice returned to their home cages.

Measurement of food intake and body weight

Food pellets and mice were measured on an Entris II Essential line scale with 0.01 g accuracy (Sartorius, 1000059011) to determine food intake and body weight, respectively. Baseline parameters were determined 1 h prior to thermal manipulation. In select experiments, food pellets were weighed 2 h (12:00), 4 h (14:00) and 24 h (09:00) after thermal challenge.

In multiparametric experiments (Fig. 5h,i and Extended Data Fig. 10i–k), food and fluid intake, as well as horizontal movement were simultaneously recorded by using PhenoTyper cages (Noldus). Herein, food intake was approximated by recording the time spent to consume food when the infrared beam within the pellet dispenser was interrupted by the nose-pokes of the mice (Δt). The same technical setup was used to measure the time spent to drink. Data were analysed by Ethovision XT15 (Noldus).

Immunohistochemistry

For immunofluorescence labelling, mice were anaesthetized with isoflurane and transcardially perfused with ice-cold phosphate buffer (PB) (0.1 M, pH 7.4) followed by ice-cold paraformaldehyde (4% in 0.1 M PB). Subsequently, the brains were removed and kept in the same fixative at 4 °C overnight. Next, the brains were washed with 0.1 M PB and stored with 0.025% NaN₃ as antifungal agent at 4 °C until processing. Fifty-micrometre-thick coronal sections spanning the ARC and PBN were cut on a vibratome (V1000S; Leica) in 0.02 M tris-buffered saline (TBS). Free-floating sections were stored in 0.02 M TBS supplemented with 0.025% NaN₃ at 4 °C. To produce 30-µm glass-mounted sections, brains were cryoprotected in 0.1 M PB containing 30% sucrose and 0.025% NaN₃. Then, brains were flash-frozen in liquid N₂, and embedded in optimal cutting temperature embedding matrix (OCT, Tissue-Tek). Coronal sections were cut on a cryostat microtome (CryoStar NX70; Thermo Scientific). Brain sections were washed in 0.02 M TBS, then blocked with a solution containing 5% normal donkey serum, 2% bovine serum albumin (BSA, Sigma Aldrich), 0.3% Triton X-100 in 0.02 M TBS at 22–24 °C for 2 h. Select combinations of primary antibodies were used as follows: guinea pig anti-cFOS (1:1,000; Synaptic Systems, 226005), rabbit anti-cFOS (1:2,000; Synaptic Systems, 226003), rabbit anti-DsRed (1:200; Clontech/Takara, 632496), rabbit anti-RFP (biotinylated, 1:1,000; Rockland, 600-406-379), chicken anti-RFP (1:500; Rockland, 600-901-379), goat anti-GFP (1:200; Abcam, ab6662), goat anti-mCherry (1:500; Antibodies Online, ABIN1440058), guinea pig anti-GluA1 (1:100; Alomone Labs, AGP-009), rabbit anti-GluA2 (1:100; Alomone Labs, AGC-005), chicken anti-NeuN (1:500; Millipore, ABN91), rabbit anti-p44/42 MAPK (pERK1/2^{Thr202/Tyr204}; 1:200; Cell Signaling Technology, 9101S), rabbit anti-TH (1:500; Millipore, AB152), goat anti-VEGFA (1:100; R&D Systems, AF-493-NA), guinea pig anti-VGLUT2 (1:200; Synaptic Systems, 135404), rabbit anti-VGLUT2 (1:500; Synaptic Systems, 135403), and chicken anti-vimentin (1:500; Synaptic Systems, 172006). Cocktails of the antibodies were incubated on an orbital shaker in 0.02 M TBS to which 2% normal donkey serum, 0.1% BSA, 0.3% Triton X-100 and 0.025% NaN₃ had been added at 4 °C for 3–4 days. Secondary antibodies included: Alexa Fluor 488 donkey anti-rabbit IgG (1:2,000; Invitrogen, AB21206), Alexa Fluor 488-conjugated AffiniPure donkey anti-guinea pig IgG (1:300; Jackson ImmunoResearch, 706-545-148), Alexa Fluor 488-conjugated AffiniPure donkey anti-mouse IgG (1:300; Jackson ImmunoResearch, 715-545-151), Alexa Fluor 647-conjugated AffiniPure donkey anti-rabbit IgG (1:300; Jackson ImmunoResearch, 711-605-152), Cy2-conjugated AffiniPure donkey anti-goat IgG (1:300; Jackson ImmunoResearch, 705-225-147), Cy2-conjugated AffiniPure donkey anti-rabbit IgG (1:300; Jackson ImmunoResearch, 711-225-152), Cy3-conjugated AffiniPure donkey anti-chicken IgG (1:300; Jackson ImmunoResearch, 703-165-155), Cy3-conjugated AffiniPure donkey anti-guinea pig IgG (1:300; Jackson ImmunoResearch, 706-165-148), Cy3-conjugated AffiniPure donkey anti-rabbit IgG (1:300; Jackson ImmunoResearch, 711-165-152), Cy5-conjugated AffiniPure donkey anti-chicken IgG (1:300; Jackson ImmunoResearch, 703-175-155), Cy5-conjugated AffiniPure donkey anti-guinea pig IgG (1:300; Jackson ImmunoResearch, 706-175-148) and Cy5-conjugated streptavidin (1:200; Jackson ImmunoResearch, 016-170-084). Secondary antibodies were applied in 0.02 M TBS containing 2% BSA, 0.3% Triton X-100, and Hoechst 33,342 (1:10,000; Sigma Aldrich, used as nuclear counterstain, B2261) on an orbital shaker at 22–24 °C for 2 h. After washing in 0.02 M TBS, sections were glass-mounted and coverslipped with an antifade solution consisting of 10% Mowiol (Sigma, 81381), 26% glycerol (Sigma, G7757), 0.2M Tris buffer (pH 8.0) and 2.5% Dabco (Sigma, D27802). Ex vivo brain slices (250–300 µm) after patch-clamp recordings were cleared in an ascending series of glycerol (25%, 50%, 80% and 100% for 1 h each, and 100% overnight), and mounted with the same antifading solution as above.

Chromogenic histochemistry and electron microscopy for VGLUT2

To localize VGLUT2 in the periventricular area, samples were prepared as previously published³⁸. In brief, mice (n = 4) were transcardially perfused with ice-cold 0.1 M PB (20 ml), followed by 4% PFA and 0.1% glutaraldehyde (GA) in 0.1 M PB. Sections were washed three times in 0.1 M PB. Endogenous peroxidase activity was blocked by treating the sections with 1% H₂O₂ for 10 min. Next, sections were blocked (see ‘Immunohistochemistry’) and immunolabelled with a rabbit anti-VGLUT2 antibody (1:1,000; a gift from M. Watanabe)⁶² and incubated at 4 °C for 2 days to reveal presynaptic terminals in apposition to tanycytes. Following repeated washes in 0.1 M PB, sections were exposed to biotinylated anti-rabbit secondary antibody (Vector Labs BA-1000) at 22–24 °C for 2 h. Next, sections were washed in 0.1 M PB and incubated with pre-formed avidin–biotin–peroxidase complexes (ABC Elite; Vector Laboratories) at 4 °C overnight. Thereafter, sections were osmificated, dehydrated, embedded in durcupan (Fluka, ACM), and cut at 60 nm on an Ultracut UCT microtome (Leica). Imaging was performed on a Transmission Electron Microscope FEI Tecnai 10 (100kV) equipped with a TEM side-mounted camera (EMSIS MegaView III G3).

Electron microscopy for vimentin, TH and tdTomato

Male C57Bl6/N mice (n = 3) were used for vimentin plus TH immunostaining. Mice were perfused with a fixative containing 4% PFA, 15% picric acid (by volume) and 0.08% GA in 0.1 M PB. Tissue was post-fixed overnight in GA-free fixative, then washed in PB. Sections containing intact ARC were kept in 10% sucrose in 0.1 M PB for 30 min and 20% sucrose in 0.1 M PB for 1 h. The sections were rapidly freeze/thawed (3×), washed (3×) with 0.1 M PB, and double-stained with chicken anti-vimentin antibody (1:1,000; Sigma in goat blocking serum) and mouse anti-TH antibody (1:3,500 Sigma) on a shaker at 4 °C for 48 h. After repeated washes in PB, sections were incubated for 1.5 h in biotinylated goat anti-mouse and biotinylated goat anti-chicken IgG (1:200 each in goat blocking serum; Vector Labs) at 22–24 °C. Sections were then washed (3×) and incubated in ABC complex (1:100 in PB; ABC Elite kit, Vector Labs) at 22–24 °C for 1.5 h. The immunoreaction was visualized with 3,3-diaminobenzidine (DAB), then extensively washed. Agrp-Cre::Ai14 mice were perfused as above, and carried through the same procedures as above but the sections were incubated in chicken anti-RFP antibody (1:2,000; Rockland) at 4 °C for 48 h. This was followed by biotinylated goat anti-chicken IgG, then ABC (both for 1.5 h) to visualize tdTomato⁺ (Agrp-Cre) neurons. Following the DAB reaction, sections were osmificated (1% OsO₄ in 0.1 M PB) for 30 min, washed in PB followed by double-distilled H₂O, and 50% ethanol. Sections were kept in 1% uranyl acetate in 70% ethanol for 1 h, washed in 95% and 100% ethanol, washed (2×) in propylene oxide, and left in a solution of 50% propylene oxide and 50% durcupan for 3 h. Sections were left in pure durcupan overnight, flat-embedded on liquid release-coated slides, coverslipped with Aclar (Electron Microscopy Sciences), glued and trimmed. Sections were collected on Formvar-coated single slot copper grids and imaged using a Philips Tecnai T-12 Biotwin electron microscope.

Fluorescence in situ hybridization

PFA-fixed 30-µm glass-mounted sections were used for FISH. We followed the HCR 3.0 protocol for ‘generic sample on slide’ per the manufacturer’s recommendations (Molecular Instruments; https://files.molecularinstruments.com/MI-Protocol-RNAFISH-FrozenTissue-Rev2.pdf) with Agrp, Flt1, Pomc, Th and Vegfa probes. In brief, slides were defrosted and gradually dehydrated in an ascending ethanol gradient (50%, 70%, 100%) for 5 min each at 22–24 °C. Tissue samples were then hybridized by incubation with 1.2 µl of 1 µM stock of each probe (1.2 pmol) in a humid chamber at 37 °C overnight. Excess probe was washed with warm washing buffer (37 °C) mixed with 5× SSCT buffer (that is, sodium chloride/sodium citrate (5× SCC) and 0.1% Tween 20; Sigma Aldrich, 9005-64-5) at scaled composition (75% washing buffer/25% 5× SSCT; 50% washing buffer/50% 5× SSCT; 25% washing buffer/75% 5× SSCT; 100% 5× SSCT) for 15 min each at 37 °C. Next, 2 µl of amplifiers (hairpins) were diluted (from 3 µM stock) in 100 µl amplification buffer and applied to the samples in a humid chamber at 22–24 °C for 12 h. Thereafter, slides were washed in 5× SSCT buffer. Nuclei were counterstained with Hoechst 33,342 (1:10,000; Sigma Aldrich, B2261) diluted in 5× SSCT at 22–24 °C for 15 min. After another wash with 5× SSCT, the samples were coverslipped with an antifade solution made up of 10% Mowiol (Sigma, 81381), 26% glycerol (Sigma, G7757), 0.2 M Tris buffer (pH 8.0), and 2.5% Dabco (Sigma, D27802).

Confocal and epifluorescence imaging

Confocal micrographs were acquired on Zeiss LSM710, LSM880/Airyscan or Zeiss LSM900/Airyscan 2 setups. We used a Zeiss AXIO Observer ApoTome.2 platform for epifluorescence microscopy. The number of VGLUT2⁺ presynapses contacting vimentin⁺ tanycytes were determined by using a Zeiss LSM880/Airyscan microscope equipped with a Plan-Apochromat 63×/1.4 NA oil objective (Zeiss). We separately acquired 2 × 2 tile scans covering each tanycyte subcategory in coronal brain sections at both −1.94 mm and −2.30 mm relative to bregma. Orthogonal z-stacks were acquired at a depth of 25 µm. Images to quantify the intensity of pERK1/2 were captured on an LSM880 microscope equipped with a Plan-Apochromat 25×/0.8 Imm Korr DIC M27 objective (Zeiss). Images showing complementary GluA2 and VGLUT2 signals within individual synapses were captured on a Zeiss LSM900/Airyscan 2 microscope equipped with a Plan-Apochromat 40×/1.4 NA oil objective.

Image analysis

Confocal images were loaded in either Imaris 9.0.2 (Biplane) or Fiji 1.52e (https://imagej.net/Fiji).

Mapping of VGLUT2⁺ presynaptic terminals in apposition to tanycytes

α1-, α2-, β1- and β2-tanycytes (all vimentin⁺) were separately captured at −1.94 mm and −2.30 mm relative to bregma, and at a tissue depth of 25 µm (z-scan) on a Zeiss LSM880 microscope with their images loaded in Imaris x64 9.0.2 later (Bitplane). Tanycyte filaments were reconstructed along their vimentin signal using the built-in extension ‘Filament tracer’. First, we determined the thickness of the basal process on x, y and z axes (~1 µm). Subsequently, we traced these basal processes by using the ‘Autopath’ method, and by setting the seeding point on the soma of each tanycyte separately. Next, tracing was centred, smoothed, and adjusted to a diameter of 1 µm. To quantify and to reconstruct the VGLUT2 signal in putative presynapses, we first set their diameter to <0.5 µm. Subsequently, we isolated any such VGLUT2 signal with the built-in ‘Spots’ extension to reconstruct spheres. We then used a ‘find spots close to filaments’ Imaris XTension to quantify the density and distribution of those VGLUT2⁺ presynapses (spots) that apposed vimentin⁺ tanycyte processes (filaments). The maximal accepted distance from the spot centre (VGLUT2⁺) to the filament edge (vimentin⁺) was set to <0.5 µm. Thus, the total number of spots within 0.5 µm was used for statistical analysis.

cFOS in tanycytes and neurons

To quantify the number of tanycytes activated by acute thermal manipulation in C57Bl6/J mice of both sexes or after chemogenetically activating glutamate inputs in B6;129S-Slc17a6^{tm1.1(flpo)Hze}/J mice bilaterally injected with either AAV-EF1a-FRT-hM3D(G_q)-mCherry or AAV2/1-Syn-FRT-hM3D(G_q)-mCherry virus particles, we counted the absolute number of cFOS⁺ nuclei both in vimentin⁺ tanycytes along the wall of the third ventricle, and in mCherry⁺ neurons in the PBN per section from confocal micrographs at a tissue depth of 25 µm (z-scans).

Intensity analysis for pERK1/2 and VEGFA

Five-by-three tiled confocal images over the cross-section of the third ventricle were acquired on a Zeiss LSM880 microscope at an image depth of 8 bit. Confocal micrographs were loaded in Fiji 1.52e, and their signal intensity for either pERK1/2 or VEGFA was quantified in pre-defined tanycyte subgroups in male mice kept at either 25 °C or 40 °C. Images were acquired at identical settings (including laser power output, digital gain/offset) to allow for comparisons be made on signal intensities between the experimental groups.

Vegfa expression and localization

Confocal images of Vegfa mRNA (FISH) from brains of both control and heat-exposed C57Bl6/J male mice that had received scrambled RNAi or Vegfa-targeting RNAi cocktails in the third ventricle were acquired on a Zeiss LSM710 microscope as 2 × 5 image tiles. Thus, the entire length of the ventricular wall was imaged as a z-stack of ∼25 µm. We reconstructed the wall of the third ventricle with the ‘Surface’ method (over a nuclear signal), thus limiting data collection to only the perikarya of tanycytes. To quantify the number of Vegfa mRNA precipitates in tanycytes, images were loaded in Imaris (Bitplane) with the Vegfa signal in the somata of tanycytes transformed into spots with a maximal diameter of <0.5 µm. Then, the number of spots (Vegfa) that had been in close apposition to the surface was determined by the ‘Find spots close to surface’ Imaris XTension (threshold set to 1 unit) and used for statistical analysis.

Chemogenetic induction of PBN projections onto tanycytes

To test whether tanycytes are directly activated by long-range glutamatergic projections, the PBN of B6;129S-Slc17a6^{tm1.1(flpo)Hze}/J was bilaterally injected with AAV-EF1a-FRT-hM3D(G_q)-mCherry or AAV2-Syn1-FRT-hM3D(G_q)-mCherry particles. Twenty-one days after virus delivery, mice were moved to an incubator (Tecniplast, Aria BIO-C36 EVO) set at 25 °C with a reverse 12 h:12 h light:dark cycle for 24 h. The following day, mice were injected intraperitoneally with either sterile physiological saline or CNO (5 mg kg⁻¹; Tocris, 6329) dissolved in saline. After 1.5 h, mice were transcardially perfused with 0.1 M PB followed by ice-cold 4% PFA for histochemistry.

RNA isolation from the wall of the third ventricle wall and quantitative PCR

Two groups of P60-P90 C57Bl6/J male mice (n = 4 per group) were acutely exposed to 40 °C for 1 h and compared to mice kept at 25 °C. Their brains were rapidly removed, and 1-mm coronal brain slices were cut by using a steel brain matrix (Stoelting, 51386). The wall of the third ventricle was manually dissected, flash-frozen in liquid N₂, and stored at −80 °C until processing. RNA was extracted with the RNeasy mini kit (Qiagen, 74536). To eliminate genomic DNA, samples were treated with DNase I. Thereafter, RNA was reverse transcribed to cDNA with the high-capacity cDNA reverse transcription kit (Applied Biosystems, 4368814). Quantitative real-time PCR was performed (CFX-connect, Bio-Rad) with primer pairs as follows: mouse Vegfa (forward: 5′-gaggggaggaagagaaggaa-3′, reverse: 5′-ctcctctcccttctggaacc-3′) and mouse glyceraldehyde-3-phosphate dehydrogenase (Gapdh; forward: 5′-aactttggcattgtggaagg-3′, reverse: 5′-acacattgggggtaggaaca-3′), which were designed with the NCBI Primer Blast software. Quantitative analysis of gene expression was performed with SYBR Green master mix (Life Technologies, 4364344). Expression levels were normalized to Gapdh, used as a housekeeping standard. Fold changes were determined with the Livak method⁶³.

Primary cultures of tanycytes

Primary cultures of tanycytes were generated as described⁶⁴. P10 Wistar rats (local breeding) were decapitated, and their brains were extracted and immersed in ice-cold sterile Hank’s balanced salt solution (HBSS; Thermo Fisher). The median eminence was dissected under a stereomicroscope (Leica, M205) and crushed on 80-µm nylon meshes. Dissociated cells were cultured in DMEM/F12-phenol red free medium (Thermo Fisher) supplemented with 10% fetal calf serum (Invitrogen). Primary cultures of tanycytes were kept in 5% CO₂ atmosphere at 37 °C. Media were half-refreshed every three days. Two days before protein extraction, primary cultures of tanycytes were split in 6-well plates and cultured in DMEM/F12-phenol red free medium supplemented with 5 µg ml⁻¹ insulin from bovine pancreas (Sigma) and 100 µM putrescine dihydrochloride (Sigma).

Protein extraction from cultured tanycytes

Primary cultures of tanycytes were washed with ice-cold HBSS (Thermo Fisher), harvested, and pelleted at 1,000 rpm for 60 s. The supernatant was discarded. Pellets were resuspended in 300 mM NaCl, 50 mM HEPES (pH 8.0), 1% IGEPAL CA-630, 0.1% sodium deoxycholate, 1 mM DTT, 1 mM protease inhibitors (EDTA-free, Roche) and incubated on ice for 10 min. Cell lysates were flash-frozen in liquid N₂ and stored at −80 °C.

Mass spectrometry

Bands on SDS gels (n = 3 biological replicates) were cut into three pieces each and the corresponding proteins were extracted. The proteins of each band were collected as fractions (three for each sample) and subjected to tryptic digest and post-digest purification.

Approximately 1 µg of tryptic peptides (4.5 µl injection volume) from each fraction (in total three) were separated by an online reversed-phase (RP) HPLC (Dionex Ultimate 3000 RSLCnano LC system, Thermo Scientific) connected to a benchtop Quadrupole Orbitrap (Q-Exactive Plus) mass spectrometer (Thermo Fisher Scientific). Online separation was performed on analytical (nanoViper Acclaim PepMap RSLC C18, 2 μm, 100 Å, 75 μm internal diameter × 50 cm, Thermo Fisher Scientific) and trap (Acclaim PepMap100 C18, 3 μm, 100 Å, 75 μm internal diameter × 2 cm, Thermo Fisher Scientific) columns. The flow rate for the gradient was set to 300 µl min⁻¹, with an applied maximum pressure at 750 mbar. The liquid chromatography method was a 175-min run and the exponential gradient was set at 5–32% buffer B (v/v%; 80% acetonitrile, 0.1% formic acid, 19.9% ultra-high purity LC-MS water) over ~118 min (7 curves). This was followed by a 30-min gradient of 50% buffer B (6 curves) and then increased to 90% of buffer B for another 5 min (5 curves). The liquid chromatography eluent was introduced into the mass spectrometer through an integrated electrospray metal emitter (Thermo Electron). The emitter was operated at 2.1 kV and coupled with a nano-ESI source. Mass spectra were measured in positive ion mode applying top ten data-dependent acquisition (DDA). A full mass spectrum was set to 70,000 resolution at m/z 200 (Automatic Gain Control (AGC) target at 3 × 10⁶, maximum injection time of 30 ms and a scan range of 350–1,800 (m/z)). The MS scan was followed by a MS/MS scan at 17,500 resolution at m/z 200 (AGC target at 1 × 10⁵, 1.8 m/z isolation window and maximum injection time of 70 ms). For MS/MS fragmentation, normalized collision energy for higher energy collisional dissociation was set to 30%. Dynamic exclusion was at 30 s. Unassigned and +1, +8 and > +8 charged precursors were excluded. The minimum AGC target was set to 1.00e³ with an intensity threshold of 1.4e⁴. Isotopes were excluded. Targets were accepted if more than two peptide fragments covered each and listed in Extended Data Table 1.

CSF extraction and VEGF ELISA

Wistar rats of ~P60 of age (all male, n = 3 for 25 °C and n = 4 for 40 °C) were allowed to habituate to the experimental setting in an incubator (Tecniplast, Aria BIO-C36 EVO) at 25 °C with a reverse 12 h 12 h light:dark cycle for 3 days. Next, rats were acutely exposed to either 25 °C or 40 °C for 1 h, anaesthetized intramuscularly with a mixture of ketamine (50 mg kg⁻¹) and xylazine (4 mg kg⁻¹), and their heads were mounted in a stereotaxic frame (RWD). For CSF sampling, the fourth ventricle was approached. For this, the skin was incised, nuchal muscles were retracted to the sides, and partially removed. The dorsal wall of the ventricle formed by the lamina epithelialis was identified as a silvery membrane caudal to the cerebellum between the rim of the foramen magnum and first cervical vertebra. The membrane was pierced with a 26G syringe and 15 µl CSF was removed from the fourth ventricle using a standard 20-μl laboratory pipette (Eppendorf). Samples were flash-frozen in liquid N₂ and stored at −80 °C. To test the VEGF content of the CSF, we used a rat VEGF ELISA Kit (Sigma Aldrich; RAB0511) as per the manufacturer’s instructions. An ELISA plate reader set at 450 nm (Glomax Multi⁺, Promega) was used to read out VEGF levels in 20-μl sample volumes. VEGF concentrations were expressed in pg ml⁻¹.

Electrophysiology, Ca²⁺ imaging, optogenetics and analysis

Acute coronal slices comprising, in the rostrocaudal axis, the medial-caudal portion of the third ventricle were obtained from P60-P90 male C57Bl6/J, Rax^{tm1.1(cre/ERT2)Sbls}/J::B6;129S6-Polr2a^{Tn(pb-CAG-GCaMP5g,-tdTomato)Tvrd}/J and B6;129S-Slc17a6^{tm1.1(flpo)Hze/J} mice. Mice were anaesthetized with isoflurane (5%, 1 l min⁻¹ flow rate) prior to decapitation, and their brains were rapidly dissected out. Two hundred fifty-µm-thick coronal slices were cut on a vibratome (VT1200S, Leica) in ice-cold cutting solution (pH 7.3) containing (in mM): 135 N-methyl-d-glucamine, 1 KCl, 1.2 KH₂PO₄, 10 glucose, 20 choline bicarbonate, 1.5 MgCl₂, and 0.5 CaCl₂ and continuously oxygenated with 95% O₂/5% CO₂. Acute slices of the caudal portion of the hypothalamic third ventricle/ARC were incubated at 32 °C for 1 h and allowed to cool to 25 °C in oxygenated ACSF (pH 7.3) containing (in mM): 124 NaCl, 3 KCl, 1.25 KH₂PO₄, 2 MgCl₂, 2 CaCl₂, 26 NaHCO₃, and 10 mM glucose. For recordings, brain slices were transferred to a recording chamber (Examiner.D1, Zeiss) and superfused with ACSF (25 °C) at a rate of 3 ml min⁻¹ with a peristaltic pump (PPS5, Multichannel Systems). Tanycytes and neurons were recorded through patch pipettes (3–5 MΩ) made from borosilicate glass capillaries pulled on a P100 glass puller (Sutter Instruments). Patch pipettes were filled with an intracellular solution containing (pH 7.3, 300 mOsm; in mM): 125 K-gluconate, 20 KCl, 0.1 EGTA, 2 MgCl₂, 10 HEPES, 2 Na-ATP, 0.4 Na-GTP, 10 phosphocreatine and 0.5% biocytin (Tocris, 3349).

Electrophysiology

To record glutamatergic inputs onto tanycytes, both sEPSCs and tonic currents were recorded at −70 mV using a Multiclamp 700B amplifier (Molecular Devices), sampled at 10 KHz, and filtered at 2 KHz. EPSCs were analysed using the Mini Analysis Program (Synaptosoft). Both the amplitude and frequency of sEPSCs were statistically tested in both α- and β-tanycytes. s-AMPA (100 µM; Tocris, 0254) was superfused to test for tonic currents. To define voltage responses to currents ramps, tanycytes were recorded in current-clamp mode with the holding current set at 0 pA. Current injections were applied for 1 s with consecutive steps of current of 5 pA for 20 sweeps. To determine the effect of the threshold for neuronal spiking on VEGFA release, acute slices were either superfused with ACSF (control) or with axitinib (40 µM; LC Laboratories A-1107), a selective inhibitor of VEGF receptors. To define their action potential thresholds, patch-clamped neurons were recorded in current-clamp mode with the holding current set at 0 pA. Patch-clamped neurons in the ARC and apposing α-tanycytes were recorded in repeated measures first at 25 °C and after increasing the temperature of the recording chamber to 38 °C by using a temperature controller (Warner Instruments, TC-324C). The voltage value corresponding to the exponential rise of the action potential was used for statistical analysis (Clampfit, Molecular Devices).

Ca²⁺ imaging

We recorded neuronal input-dependent Ca²⁺ transients in tanycytes from acute slices from Rax^{tm1.1(cre/ERT2)Sbls}/J crossed with B6;129S6-Polr2a^{Tn(pb-CAG-GCaMP5g,-tdTomato)Tvrd}/J mice (n = 8, males). We used an AxioExaminer.D1 microscope (Zeiss) and visualized Ca²⁺ transients with a water-immersion W40×/1.0 DIC VIS-IR Plan-Apochromat objective (Zeiss) and a CoolSnap HQ² camera (Photometrics). We first proceeded to patch-clamp neurons proximal to the wall of the third ventricle. To induce action potentials in patch-clamped neurons, we injected steps of currents ranging between 10 pA and 30 pA for 500 ms. Simultaneously, a VisiChrome monochromator (Visitron Systems) was used to visualize GCaMP5g in tanycytes. To demonstrate the AMPA receptor (AMPAR) dependence of Ca²⁺ transients, tanycytes were imaged while ACSF was supplemented with 2,3-dioxo-6-nitro-7-sulfamoyl-benzo[f]quinoxaline (NBQX, 20 µM, Tocris, 1044). In recordings where neuronal activity was pharmacologically manipulated, acute slices from Rax^{tm1.1(cre/ERT2)Sbls}/J crossed with B6;129S6-Polr2a^{Tn(pb-CAG-GCaMP5g,-tdTomato)Tvrd}/J mice were placed on µ-Dish 35 mm high chamber for cell culture imaging (Ibidi) mounted on an inverted LSM880 confocal microscope (Zeiss), and visualized with a Plan-Apochromat 20×/0.8 M27 objective (Zeiss). ACSF, 100 µM picrotoxin (Tocris, 1128), 5 µM TTX (Tocris, 1069), 100 µM s-AMPA (Tocris, 0254), 20 µM NBQX (Tocris, 1044) and KCl 50 mM were superfused at a rate of 1.5 ml min⁻¹ with a peristaltic pump (PPS5, Multichannel Systems). Single-plane images of the GCaMP5g signal were captured upon excitation with a 488-nm laser at 5.5% of total efficient power output to avoid phototoxicity. A frame dimension of 512 × 512 pixels at 8 bit with a rate of 600 ms was used with the pinhole set at 447 µm. To analyse Ca²⁺ transients, image series were loaded in Fiji and the intensity of GCaMP5g transients was calculated from manually drawn regions of interest over tanycyte somata and basal processes proximal to the third ventricle. The GCaMP5g signal was normalized to the difference between the signal intensity in tanycytes during their period of inactivity and background.

ChR2-assisted circuit mapping

Ex vivo coronal brain slices (300 μm) encompassing the medial-caudal portion of the third ventricle were cut from B6;129S-Slc17a6^{tm1.1(flpo)Hze/J} mice bilaterally injected with AAV1-CAG-FLEXFRT-ChR2(H134R)-mCherry in the PBN to test possible monosynaptic inputs onto tanycytes. Brain slices were superfused with oxygenated ACSF containing 1 µM TTX (Tocris, 1069) and 100 µM 4-aminopyridine (Sigma Aldrich, 275875) with a peristaltic pump (Multichannel systems, PPS2) at a flow rate of 3 ml min⁻¹ at 25 °C throughout. A BX51WI microscope (Olympus) equipped with a DIC prism (Olympus, WI-DICHTRA2), and LUMPlanFI/IR 60X/0.90W and Plan N4×/0.10 objectives (Olympus) was used. channelrhodopsin-2(ChR2)-mCherry⁺ axons in close apposition to the third ventricle were excited with a CoolLED (pE-100) light source at 535 nm and imaged on an ORCA-Fusion digital camera (Hamamatsu, C14440). Tanycytes were clamped at a holding potential of −70 mV, and data acquired on an EPC10 USB Quadro patch-clamp amplifier (HEKA) were sampled at 20 KHz, and filtered at 2 KHz. ChR2–mCherry⁺ terminals were excited with 50-ms light pulses at 470 nm (CoolLED, pE-100) synchronized to the recording of possible optically induced EPSCs in tanycytes. The time response (in ms) and amplitude (in pA) of EPSCs were analysed in PatchMaster Next (HEKA).

Effects of TRPV2 inhibition and 38 °C on food intake

We injected tranilast (20 mg kg⁻¹, intraperitoneally T0318-10MG; Sigma Aldrich) in C57Bl6/N mice (n = 4) and compared its effect with naive controls (n = 4) and mice injected with DMSO used as a vehicle (D2650; Sigma Aldrich). Mice were injected with either tranilast or DMSO 10 min before being exposed to 25 °C and then to 38 °C for 1 h on consecutive days. The tranilast concentration was chosen based on dose conversion from human to mouse (considering the body surface area according to US Food and Drug Administration guidelines: http://www.fda.gov/downloads/Drugs/Guidances/UCM078932.pdf). An equivalent mg kg⁻¹ dose for tranilast in mice was calculated by multiplying its human dose (100 mg per 60 kg, equivalent to 1.6 mg kg⁻¹ for human) by the body surface area conversion factor in mice (12.3), resulting in a dose of 19.68 mg kg⁻¹ in mouse.

Stereotaxic surgery for viral injections

All mice undergoing stereotaxic delivery of AAV viral particles were processed 21 days after virus delivery. Anaesthesia was induced with isoflurane (5%; 0.6 l min⁻¹ flow rate). The mice were then mounted in a stereotaxic frame (RWD) with anaesthesia maintained with isoflurane (1.5%; 0.6 l min⁻¹ flow rate) through a snout mask. Viral particles were delivered with a micropipette (Drummond) mounted on either a Quintessential Stereotaxic Injector (Stoelting) or an R-480 nanolitre microinjection pump (RWD) at a speed of 100 nl min⁻¹. The pipette was slowly withdrawn 10 min after AAV delivery.

B6.Cg-Gt(ROSA)26Sor^{tm14(CAG-tdTomato)Hze/J} and B6;129P2-Mapt^tm2Arbr/J mice used for the transsynaptic mapping of neuronal afferents to tanycytes were unilaterally injected (lateral ventricle) with rAAV8-EF1a-mCherry-IRES-WGA-Cre particles (UNC Vector Core; 1.0 µl) at the following coordinates (all relative to bregma): anterior–posterior (AP): −0.1 mm, lateral (L): 0.9 mm, dorsoventral (DV): −2.3 mm.

To perform long-range axonal tracing to the third ventricle, C57Bl6/J mice were unilaterally injected (in the ARC) with AAVrg-CAG-GFP particles (70 nl, Addgene, 37825) as above at the following coordinates (all relative to bregma): AP: −1.94 mm; L: 0.25 mm; DV: −5.86 mm.

For ChR2-assisted-circuit mapping to assess monosynaptic inputs from the PBN to tanycytes, B6;129S-Slc17a6^{tm1.1(flpo)Hze/J} mice were bilaterally injected with AAV1-CAG-FLEXFRT-ChR2(H134R)-mCherry particles (250 nl, Addgene, 75470-AAV1) as above at the following coordinates (all relative to bregma): AP: −5.2 mm; L: ±1.25 mm; DV: −2.8 mm.

To test tanycyte activation following chemogenetic manipulation of PBN projections and also in behavioural tests, B6;129S-Slc17a6^{tm1.1(flpo)Hze/J} and Rax^{tm1.1(cre/ERT2)Sbls/J} mice were crossed to obtain Slc17a6-FlpO::Rax-CreER^T2 mice that were bilaterally injected with either AAV2/1-Syn-FRT-hM3D(G_q)-mCherry particles (Viral Vector Core Facility, Canadian Neurophotonics Platform; RRID:SCR_016477) or AAV-EF1a-FRT-hM3D(G_q)-mCherry particles (Molecular Biology Services, Institute of Science and Technology Austria) at volumes of 250 nl each at the following coordinates (all relative to bregma): AP: −5.2 mm; L: ±1.25 mm; DV: −2.8 mm.

To block tanycyte-dependent VAMP2-mediated exocytosis in behavioural experiments, Rax-CreER^T2 mice or Slc17a6-FlpO::Rax-CreER^T2 mice were medially injected in the third ventricle with AAV-TeLC-FLEX-GFP⁵⁶ or AAV2-FLEX-GFP (control) viruses (1.0 µl; coordinates relative to bregma: AP: −1.70 mm; L: ±0.0 mm; DV: −5.85 mm).

To block VAMP2-mediated exocytosis in PBN neurons, Flp-dependent AAV2-FlpON-TeLC-GFP or AAV2-FlpON-GFP (control) viruses were injected in the PBN of Slc17a6-IRES2-FlpO-D-mice (250 nl) at the coordinates: AP: −5.2 mm; L: ±1.25 mm; DV: −2.8 mm (all relative to bregma).

Tamoxifen injection

Rax^{tm1.1(cre/ERT2)Sbls} mice used for histochemical analysis, as well as Rax^{tm1.1(cre/ERT2)Sbls}/J mice crossed with B6;129S6-Polr2a^{Tn(pb-CAG-GCaMP5g,-tdTomato)Tvrd}/J mice for Ca²⁺ imaging were injected intraperitoneally for 3 consecutive days with 150 mg kg⁻¹ tamoxifen (Sigma, T5648), and processed 3 days following the last injection. For behavioural tests, Rax^{tm1.1(cre/ERT2)Sbls} mice crossed with B6;129S-Slc17a6^{tm1.1(flpo)Hze/J} mice were injected intraperitoneally for 3 consecutive days with 50 mg kg⁻¹ 4-hydroxytamoxifen (Sigma, H6278) to ensure maximal recombination of the AAV-TeLC-FLEX-GFP construct in tanycytes.

Behavioural tests and controls

To test the effect of acute heat exposure on food intake, P60 C57Bl6/J mice were habituated to the experimental room set to 25 °C for 24 h. Next, mice were transferred to thermo-controlled cabinets (Sanyo Incubator, MIR-254) preset to either 25 °C (control) or 40 °C for 1 h. Following heat exposure, mice were single housed in PhenoTypers (Noldus) placed into incubators (Memmert, MEMM-OT3007S and Tecniplast, Aria BIO-C36 EVO) set to 25 °C with a reversed 12 h:12 h light:dark cycle for another 24 h. Food and fluid intake, as well as mobility were monitored over 24 h after acute thermal manipulation by weighing the food pellet, measuring the volume of water consumed, or scoring the frequency of eating bouts and general mobility (both in EthoVision XT15; Noldus). Behavioural tests were designed such that each mouse served as its own control (baseline versus post-heat exposure data), allowing statistical analysis through repeated-measures analysis of variance (ANOVA).

To test if neuronal activity-induced VEGFA release from tanycytes affected food intake, P60–P70 male C57Bl6/J mice were intracerebroventricularly infused with 1 nmol/1.5 µl of either Accell mouse Vegfa siRNA (Vegfa-RNAi; Dharmacon, E-040812-00-0020) or Accell non-targeting siRNA (control; Dharmacon, D-001950-01-20) in the third ventricle (AP: −1.70 mm; L: ±0.0 mm; DV: −5.85 mm relative to bregma). First, we tested the knockdown efficiency of Vegfa-RNAi by infusing P60–P70 male C57Bl6/J mice (n = 4 per group) with either scrambled RNAi or Vegfa-RNAi (stereotaxic surgery was identical as described above). Eight days after RNAi infusion, mice were perfused with ice-cold 4% PFA and the brains processed for FISH. Next, to test the impact of reduced VEGFA release on food intake upon heat exposure, P60–P70 male C57Bl6/J mice were intracerebroventricularly infused with either scrambled RNAi (control) or Vegfa-RNAi (n = 8 per group). Mice were single housed in PhenoTypers (Noldus) placed into incubators (Tecniplast, Aria BIO-C36 EVO) at 25 °C with a reversed 12 h:12 h light:dark cycle, and allowed to recover for 8 days. From day 3 to 8 post-surgery, we monitored both food intake and body mass by weighting the food pellets and mice, respectively. On days 9 and 10, mice were subjected to thermal challenge (40 °C, 1 h) in incubators (Sanyo, MIR-254). This was followed by measuring foor intake and body mass for 24 h as above (PhenoTypers, Noldus).

To test the effect of the chemogenetic activation of PBN projections onto tanycytes, male Rax^{tm1.1(cre/ERT2)Sbls}::B6;129S-Slc17a6^{tm1.1(flpo)Hze}/J mice were stereotaxically injected with AAV-TeLC-FLEX-GFP (third ventricle) and AAV-FRT-hM3D(G_q)-mCherry (PBN, bilaterally) to simultaneously manipulate tanycytes and glutamatergic output form the PBN. All tests were performed in a self-controlled design to use the same mice before and after blocking VAMP2-mediated exocytosis from tanycytes, by the temporally controlled recombination of the AAV-TeLC-FLeX-GFP construct that encodes TeLC (Fig. 5g). Twenty-one days after virus delivery, mice were placed individually in PhenoTypers (Noldus) mounted in ventilated and temperature-controlled (29 °C) cabinets (Memmert, MEMM-OT3007S) with a reversed 12 h:12 h light:dark cycle. Food intake, locomotion, and drinking were monitored with EthoVision XT15 (Noldus). Mice were allowed to habituate for 2 days to the experimental setup (days 21,22). Next, baseline activity was recorded for 24 h (day 23). On day 24, mice were treated with 3 mg kg⁻¹ CNO (Tocris, 6329) by both intraperitoneal delivery and in the drinking water, together with 5 mM saccharine (Sigma), to test the effect of chemogenetically activating PBN projections on feeding, drinking, and locomotor activity, whilst leaving VAMP2-mediated exocytosis from tanycytes unaffected. Thereafter, mice were placed individually in home cages for Cre-dependent recombination of the TeLC construct to take place into Rax-expressing tanycytes by injecting 50 mg kg⁻¹ 4-hydroxytamoxifen (Sigma) for 3 days (days 25–27). Mice were then allowed to recover for another 3 days (days 28–30). On day 31, we returned the mice to the PhenoTypers and allowed them to habituate for another 48 h (days 31 and 32). Thereafter, we recorded (for 24 h, day 33) their baseline activity following the TeLC-dependent block of VAMP2 in tanycytes. The next day (day 34), we triggered neuronal activity in the PBN by injecting CNO (3 mg kg⁻¹) and using it as an additive to the drinking water together with saccharine (5 mM), and tested feeding, drinking, and locomotor activity again. On the last day (day 35), mice were transcardially perfused with ice-cold 4% PFA. Their brains were routinely processed to verify the accuracy of virus delivery. No mouse was excluded from the analysis.

To test if blocking VAMP2-mediated exocytosis in PBN neurons projecting to tanycytes affected food intake following acute heat exposure, Slc17a6^{tm1.1(flpo)Hze}/J mice were bilaterally injected in the PBN with either AAV2-FlpON-GFP (control) or AAV2-FlpON-TeLC-GFP. Twenty-one days after virus delivery, mice were sequentially exposed to either 25 °C (control) or 40 °C for 1 h (on consecutive days). Food intake was determined by measuring the weight of food pellets. To test if blocking VAMP2-mediated exocytosis in tanycytes could modify food intake following acute heat exposure, Rax^{tm1.1(cre/ERT2)Sbls}/J mice were medially injected in the third ventricle with either AAV2-FLeX-GFP (control) or AAV2-FLeX-TeLC-GFP. To induce Cre-dependent recombination, mice were injected with tamoxifen (150 mg kg⁻¹) for 3 consecutive days, starting 2 days after surgery. Twenty-one days after virus delivery, mice were sequentially exposed to either 25 °C (control) or 40 °C for 1 h (on consecutive days). In both experiments, food intake was determined by measuring the weight of food pellets.

Statistics and reproducibility

Data were analysed using GraphPad Prism 8.0.2 (GraphPad). Two sets of independent samples were compared using two-tailed Student’s t-test. Repeated measures of pair-wise comparisons were analysed by paired two-tailed Student’s t-test. Multiple sets of measurements involving one independent variable were analysed by one-way ANOVA and further justified by Bonferroni’s post hoc comparison. Repeated-measures two-way ANOVA and three-way ANOVA were used to evaluate between and within factors, with Bonferroni’s post hoc test applied throughout. The Kolmogorov–Smirnov test was used to analyse cumulative distribution. Data were expressed as means ± s.e.m. throughout, except in box-and-whisker plots that show median ± interquartile ranges, and minimum and maximum values. Statistical significance was indicated as *P < 0.05, **P < 0.01 or ***P < 0.001. For neuroanatomy, a minimal desired cohort size of n = 3 mice was chosen, with higher mouse numbers specified in the relevant figure legends.

Statistical output for main figures

Figure 1b: two-way repeated-measures ANOVA: interaction (sex versus temperature): F = 0.005, P = 0.942; sex: F = 7.969, P = 0.013; temperature: F = 32.240, P < 0.001. Bonferroni’s multiple comparison: t = 4.067, **P = 0.002 (males at 25 °C versus 40 °C); t = 3.963, **P = 0.003 (females at 25 °C versus 40 °C).

Figure 1c: repeated-measures ANOVA: F = 18.030, p < 0.001.

Figure 1f: two-way ANOVA: interaction (sex versus temperature): F = 1.497, P = 0.249; sex: F = 3.589, P = 0.087; temperature: F = 81.700, P < 0.0001. Bonferroni’s multiple comparison: t = 6.788, ***P < 0.001 (males 25 °C versus 40 °C); t = 5.969; ***P < 0.001 (females 25 °C versus 40 °C).

Figure 3b, middle: frequency: Student’s t-test (two-sided), t = 0.476, P = 0.639; α- versus β-tanycytes.

Figure 3b, right: amplitude: Student’s t-test (two-sided), t = 3.006, **P = 0.007; α- versus β-tanycytes.

Figure 4b: Student’s t-test (two-sided), t = 7.120, ***P < 0.001.

Figure 4e: repeated-measures ANOVA: interaction: F = 3.974, P = 0.066; treatment (ACSF versus axitinib): F = 1.947, P = 0.185; temperature: F = 23.880, P < 0.001; subject, F = 6.723; P < 0.001. Bonferroni’s multiple comparison: ACSF (25 °C versus 38 °C), t = 4.865; ***P < 0.001; axitinib (25 °C versus 38 °C) t = 2.046; P = 0.1201.

Figure 4g: Student’s t-test (two-sided), t = 3.143, *P = 0.020.

Figure 4h: repeated-measures ANOVA: interaction (treatment versus temperature), F = 1.081, P = 0.316; temperature: F = 17.310, P = 0.001; treatment: F = 3.089, P = 0.094. Bonferroni’s multiple comparison: temperature: control, t = 3.677, **p = 0.005; Vegfa-RNAi, t = 2.207, P = 0.089 (not significant).

Figure 4k: Student’s t-test (two-sided), **P < 0.01.

Figure 5b, right: Student’s t-test (two-sided), **P < 0.01; n = 3 mice per group.

Figure 5c: two-way ANOVA: interaction (TeLC versus temperature): F = 8.682, P = 0.042; GFP versus TeLC: F = 0.683, P = 0.455; temperature: F = 16.34, P = 0.0156. Bonferroni’s multiple comparison: P = 0.016 (GFP; 25 °C versus 40 °C); P = 0.964 (TeLC; 25 °C versus 40 °C).

Figure 5i: two-way repeated-measures ANOVA: time: F = 6.202, P = 0.026; treatment: F = 6.839, P = 0.048; interaction (time versus treatment): F = 1.944, P = 0.208.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

[ad_2]

Source link

March 27, 2024
Formation of memory assemblies through the DNA-sensing TLR9 pathway

[ad_1]

Animal husbandry

Eight-week-old male and female C57BL/6 N mice were obtained from Envigo. Tlr9^fl/fl (C57BL/6J-Tlr9^em1Ldm/J) mice with loxP sites flanking exon 1 of the Tlr9, Ifnar1^fl/fl (B6(Cg)-Ifnar1^tm1.1Ees/J) mice with loxP sites flanking exon 3 of the type-1 interferon α/β receptor gene, Rela^fl/fl (B6.129S1-Rela^tm1Ukl/J) mice with loxP sites flanking exon 1 of the Rela gene, and Sting1-knockout mice C57BL/6J-Sting1gt/J; Goldenticket (Tmem173gt) mice were obtained from Jackson Laboratory and bred in institutional facilities. All mice were eight weeks of age at the beginning of experiments, unless otherwise specified. All mice were group housed (12 h:12 h light:dark cycle with lights on at 07:00, temperature 20–22 °C, humidity 30–60%) with ad libitum access to food and water (mice were switched to single housing one week before experiments). All experimental groups were mixed sex, consisting of approximately equal numbers of males and females. All procedures were approved by Northwestern University’s Animal Care and Use Committee (protocols IS00002463 and IS00003359) and Albert Einstein’s Animal Care and Use Committee (protocols 00001289 and 00001268) in compliance with US National Institutes of Health standards, and at Aarhus University in compliance with the Danish National Animal Experiment Committee (protocol 2021-15-0201-00801).

Tissue collection

For all analyses, mice were euthanized by cervical dislocation, dorsal hippocampi immediately dissected and frozen in liquid nitrogen. Frozen tissue was stored at −80 °C until protein or RNA extractions were performed.

Bulk RNA-seq

Read quality was assessed using FastQC⁴⁶ (v0.10.1) to identify sequencing cycles with low average quality, adapter contamination, or repetitive sequences from PCR amplification. Alignment quality was analysed using SAMtools flagstat with default parameters. Data quality was visually inspected as described previously⁵⁵. Furthermore, we assessed whether samples were sequenced deep enough by analysing the average per base coverage and the saturation correlation for all samples using the MEDIPS R package⁵⁶. The saturation function splits each library in fractions of the initial number of reads (ten subsets of equal size) and plots the convergence. The correlation between biological replicates was evaluated using Pearson correlation (function MEDIPS.correlation). Only data passing all quality standards were used for further analyses. Data were aligned to the genome using gapped alignment as RNA transcripts are subject to splicing and reads might therefore span two distant exons. Reads were aligned to the whole Mus musculus mm10 genome using STAR aligner58 (2.3.0e_r291) with default options, generating mapping files (BAM format). Reads were aligned to mouse genome M. musculus mm10 and counted using FeaturesCount as described previously⁵⁵. Genes with significantly different fold change (false discovery rate-corrected P < 0.05) were classified as up-regulated or down-regulated.

Isolation of nuclei and FACS

Fresh dorsal hippocampal tissue was collected from mice 96 h after CFC. Nuclei were isolated following an established protocol⁵⁷. RNase inhibitor was added to the 6× homogenization buffer stable master mix at a final concentration of 1.2 U μl⁻¹. Tissue was homogenized using a Polytron homogenizer for 1.5 min. Samples were resuspended with the 50% iodixanol solution (50% iodixanol in 1× homogenization buffer) via gentle pipetting to make a final concentration of 25% iodixanol. Three millilitres of a 35% iodixanol solution (35% iodixanol in 1× homogenization containing 480 mM sucrose) was added to a new 15 ml Falcon tube. Three millilitres of a 29% iodixanol solution (29% iodixanol in 1× homogenization buffer containing 480 mM sucrose) was layered above the 35% iodixanol mixture. A 4 ml 25% iodixanol solution was layered on the 29% solution. In a swinging-bucket centrifuge, nuclei were centrifuged for 20 min at 3,000g. After centrifugation, the nuclei were present at the interface of the 29% and 35% iodixanol solutions. This band with the nuclei was collected in a 300 μl volume and transferred to a pre-chilled tube. Following isolation, nuclei were counted and resuspended in fluorescence-activated cell sorting (FACS) buffer (1% BSA, 1 mM EDTA, and 0.2 U μl⁻¹ RNase inhibitor in PBS) at 2 × 10⁶ nuclei per ml. A subset of nuclei was sorted by GFP expression on a high-speed cell sorter flow cytometer (Beckman Coulter MoFlowXDP cell sorter). See Supplementary Fig. 1 for the detailed gating strategy.

snRNA-seq

snRNA-seq libraries were generated from up to 10,000 individual cells captured in an oil emulsion on a Chromium Controller (10x Genomics). cDNA was generated in the individual cell–gel bead emulsion micro-reactors while adding barcodes at the cellular and molecular level using the Chromium Next GEM Single Cell 3′ Kit v3.1(10x Genomics kit 1000268). The barcoded cDNAs from the individual cells were combined for the remaining library process. The unique molecular barcodes (UMIs) prevented amplification artefacts from skewing the analysis. The libraries were analysed on a Fragment Analyzer 5200 (Agilent Technologies) to ensure a normal size distribution with an average size of 450 bp and sequenced on an llumina Sequencer with the following read lengths: 28 bp for read 1, 10 bp for i7 index, 10 bp for i5 index and 90 bp for read 2 at a read depth of 20,000 reads per cell. Five libraries were generated and analysed (Supplementary Table 6).

snRNA-seq analysis

The sequencing files in FASTQ format of each sample were aligned against mouse mm10 genome v4.0.0 and converted to gene count matrices using Cellranger software v7.0.1. Quality control and downstream analysis was performed using Seurat R package v4.3.0. Doublets were detected and removed using R package scDblFinder v1.13.13. Ambient RNA was detected and corrected using R package SoupX v1.6.2. Cells with less than 1000 detected genes, more than 4,000 detected genes, or more than 5% mitochondrial genes were excluded from further analysis. Samples were normalized using Seurat SCTransform function and then integrated and clustered using Seurat functions. Differential gene expression analysis was performed to compare cells from different samples in each cluster. Genes with more than 1.5-fold change and an adjusted P value of less than 0.01 were defined as significant. Co-expression of two genes was assessed by comparing the cosine similarity of the target two genes and random chosen pair of genes. Gene set enrichment analysis was run on each cluster comparing samples with different condition against the Gene Ontology database using R package fgsea v1.20.0. Pathways with less than 0.05 adjusted P value are considered significantly enriched. The pathway analysis was performed using the Reactome Patway database (version 86)⁵⁸. Well-established markers for brain and blood-derived cell populations were used to define individual clusters^59,60.

Gene ontology and interaction network analyses of bulk RNA-seq data

Functional protein association network analysis was performed using Search Tool for the Retrieval of Interacting Genes/Proteins (STRING) database (version 11.0)⁶¹ for up-regulated genes. The network was processed applying kmeans clustering, setting cluster number to 4. Inflammatory response-associated genes were identified using Mouse Genome Database (MGI) Batch Query Genome Analysis Tool (v6.23). Selection criteria was classification within the GO term ‘Inflammatory response’ (ID: GO:0006954) using IMP (Inferred from mutant phenotype), IEA (Inferred from electronic annotation) and IBA (Inferred from biological aspect of ancestor) evidence codes. Functional classification of up-regulated genes was performed using PANTHER Classification System engine, version 17.0. Genes were analysed through PANTHER Overrepresentation (test type: Fisher; correction: FDR; functional classification: PANTHER GO-Slim Biological Process, Mus musculus – REFLIST (21997)).

RT² array

Differential expression of inflammatory response-associated genes between recent and remote memory was analysed using The Mouse Innate and Adaptive Immune Responses RT² Profiler PCR Array (Qiagen, 330231 PAMM-052ZA), according to manufacturer’s instructions. Total RNA was extracted from dorsal hippocampi using PureLink RNA Mini Kit (ThermoFisher, 12183018 A). Tissue was dissected either 96 h (n = 5, pooled) or 21 days (n = 5, pooled) after CFC, resuspended in lysis buffer, flash frozen in liquid nitrogen and stored at −80 °C. RNA was extracted following manufacturer’s instructions. cDNA was synthetized using the RT² First Strand Kit (Qiagen, 330401). For each experimental group, 500 µg of total RNA was used for the cDNA synthesis. Genomic DNA elimination reaction was prepared by mixing RNA with 2 µl of buffer GE in 10 µl total reaction volume. Real-time PCR reaction was performed using RT² SYBR Green qPCR Mastermix in duplicates for each sample (recent, remote). The PCR reaction was performed in an Applied Biosystems 7300 Real-Time PCR System with the following cycling conditions: 95 °C, 10 min; then 40 cycles of 95 °C, 15 s; 60 °C, 1 min. ΔC_t values for each gene were calculated by subtracting the average C_t value of 6 housekeeping genes from the C_t value of each target gene. Differential expression between recent and remote memory was calculated from ΔΔC_t value.

Quantitative PCR analysis

Total RNA was extracted using RNeasy Plus Mini Kit (Qiagen, 74136). Reverse transcription was performed on 100 ng of total RNA PrimeScript RT Reagent Kit (Takara RR037A). Real-time PCR analysis was performed on a QuantStudio 6 Flex instrument (ThermoFisher) using SYBR green detection system (Applied Biosystems, 4367659) and primers specific for Tlr9 (330001/PPM04221A-200), Tlr7 (330001/PPM04208A-200) and Tlr13 (330001/PPM41490A-200) (all from Qiagen). Housekeeping genes Gapdh and Hprt were used for normalization. ΔC_t for target genes was calculated using average C_t of the two housekeeping genes. mRNA amount for each experimental group was expressed relative to naive group and calculated as \({2}^{\Delta {C}_{{\rm{t}}}-\Delta {C}_{{{\rm{t}}}_{naive}}}\).

Cytosolic DNA extraction and analysis

Cytosolic DNA extraction was performed as previously described⁶². DNA was extracted using Mitochondria/Cytosol Fractionation Kit (Abcam, ab65320) from fresh tissue (dorsal hippocampus) and cleared extracts were treated with 1 mg ml⁻¹ proteinase K for 1 h at 55 °C, extracted with phenol:chloroform, treated with RNase A (1 mg ml⁻¹) for 1.5 h at 37 °C, and sequentially extracted with phenol:chloroform and chloroform. Purified cytosolic DNA was tested for nuclear DNA contamination by performing a 40-cycle PCR reaction using primers for vGlut1 (also known as Slc17a7) (forward: GTGGAAGTCCTGGAAACTGC, reverse: ATGAGCGAGGAGAATGTGG). For cloning of dsDNA, samples were treated with DNA polymerase I, large (Klenow) fragment (1 U µg⁻¹ DNA; NEB), supplemented with 33 µM of each dNTP, for 15 min. DNA was precipitated with sodium acetate/ethanol as described above, and dissolved in water. DNA samples were treated with Taq polymerase (NEB) for 20 min, and immediately cloned into pCR4-TOPO vector (Invitrogen), according to manufacturer’s instructions. One Shot competent cells were transformed by adding 2 μl of the TOPO Cloning reaction into a vial of One Shot chemically competent Escherichia coli. Cells were incubated on ice for 30 min, heat-shocked for 30 s at 42 °C without shaking, and immediately transferred to ice. After 5 min, 250 μl of room temperature SOC medium was added, and tubes were placed horizontally in a shaker (200 rpm) at 37 °C for 1 h. Cells were pelleted at 6,000 rpm for 10 min, resuspended in 50 µl of SOC medium, and spread on a pre-warmed selective plate. Plates were incubated at 37 °C overnight. All colonies from each plate were picked and placed into individual wells of a 96-well plate containing 50 µl of PBS. The sequence of cloned DNA fragments was determined by direct colony sequencing (ACGT).

Primary cultures, treatment and live imaging

The hippocampi from post-natal day 0 (P1) C57BL/6 N male and female mice were isolated, and dissociated, as described previously⁶³. Cells were plated in a 14-mm-diameter glass dish (MatTek, P35G-1.5-14-C) coated with poly-d-lysine (Sigma-Aldrich) at a density of 50,000 cells per cm² and grown in neuronal medium (Neurobasal Medium containing 1 mM GlutaMax, and 2% B27, all from ThermoFisher). Neurons were cultured for 14 days in vitro before treatments. Cells were treated with 25 μM N-methyl-d-aspartate (NMDA) for 10 min in fresh neuronal medium, washed twice, and incubated for 1 h with PicoGreen (dsDNA dye, 1:20,000), CellMAsk (cell membrane dye, 1:1,000), and MitoTracker (mitochondria dye, 1:20,000) diluted in neuronal medium. Cells were imaged on Nikon W1 spinning disc confocal microscope (Center for Advanced Microscopy, Northwestern University), 1 frame per 10 s at 100× magnification.

Immunohistochemistry

Mice were anaesthetized with an intraperitoneal injection of 240 mg kg⁻¹ Avertin and transcardially perfused with ice-cold 4% paraformaldehyde in phosphate buffer (pH 7.4, 150 ml per mouse). Brains were removed and post-fixed for 24 h in the same fixative and then immersed for 24 h each in 20% and 30% sucrose in phosphate buffer. Brains were frozen and 50-μm sections were cut for use in free-floating immunohistochemistry¹⁷ with the primary and secondary antibodies listed in Supplementary Tables 7 and 8, respectively. In addition to manufacturers’ validation, all primary antibodies were validated by comparison to no primary control samples.

PNN imaging

PNNs were visualized using Wisteria floribunda lectin (WFA) staining, a widely used approach for PNN visualization⁴⁰. WFA staining was performed according to the manufacturer’s instructions. In brief, endogenous peroxidase was inactivated with hydrogen peroxide. Following streptavidin/biotin and Carbo-Free blocking, sections were incubated with biotinylated WFA (Vector Biolaboratories), Vectastain ABC system, and fluorescein, coumarin or rhodamine isothiocyanate (Akoya Biosciences). Sections were mounted using FluorSave (Millipore-Sigma).

Microscopy, image analysis and quantification

Low-magnification images (up to 60× magnification) were captured with a Leica microscope with a Leica DFC450 C digital camera whereas high-magnification images and z-stacks (60–100× magnification) were captured using a confocal laser-scanning microscope (Olympus Fluoview FV10i). All quantifications were performed with ImageJ. Clusters of γH2AX-positive neurons were first identified, and analyses were performed in the surrounding (~100 µm × 100 µm) area. Thus, the numbers are representative of regions of interest rather than average of the CA1 subfield. For time-course analyses, we counted γH2AX neurons in 180 neurons per mouse (3 consecutive slices of 60 neurons). With 6 mice per group, this amounted to 1,000 neurons per time point. In most of the other molecular targets we counted 60 neurons per mouse using a 60–100× objective. All images were converted to binary format, and for each cell showing γH2AX we determined the background and applied a threshold twice above the background signal. We thus obtained similar results across different antibodies and conditions. All analyses were performed with Fiji/ImageJ. The JACoP Plugin for object-based co-localization was used to determine co-localization by comparing the position of the centroids of the nuclei of the colour channels. Their respective coordinates were then used to define structures separated by distances equal to or below the optical resolution⁴⁵. Volume and 3D viewer Plugins were used for 3D reconstruction of z-stacks, whereas plot profile and surface plot functions were used for analyses of clusters at lower (40×) magnification. Coloc2 was used to determine correlation of expression levels of different fluorophore signals. The analyse particles, plot profile and measure functions were used to determine the number, size, distribution and distance between indicated signals.

Fluorescent multiplex v2 RNAscope

Naive mice (n = 4) or mice subjected to CFC (n = 4) were perfused 96 h later with ice-cold 0.1 M PBS and 4% paraformaldehyde in PBS and processed as described above. RNAscope was performed according to the manufacturer instructions. To visualize Hsp90b1 and Dcx mRNA and NeuN protein RNAscope Multiplex Fluorescent Reagent Kit v2 (ACD Biotechne, 323100) and RNA–Protein Co-Detection Ancillary kit (ACD Biotechne, 323180) were used. In brief, slides were dried at 60 °C in an oven for 30 min, dehydrated in ethanol, treated with hydrogen peroxide for 10 min at room temperature, washed in water and boiled in co-detection target retrieval reagent (around 98 °C) for 5 min. The sections were incubated with anti-Neun antibody (1:500, Sigma, ABN78), fixed with 10% Neutral Buffered Formalin (VWR, GEN0786-1056), protease plus, and rinsed with sterile water. The hybridization step was performed by incubating the sections with the following probes: Mm-Hsp90b1-C1 (ACD Biotechne, 556051), Mm-DCX-C2 (ACD Biotechne, 478671-C2), Mm-PPIB (positive control probe, ACD Biotechne, 320881) and dabB (negative control probe, ACD Biotechne, 320871) for 2 h at 40 °C and stored overnight in 5× saline sodium citrate. The hybridization was amplified with AMP 1 and AMP 2. All amplification and development were performed at 40 °C, and 2 × 2 min of washes in ACD wash buffer was performed after each step. For C1 probe TSA Vivid Fluorophore Kit 520 (Biotechne, 7523) was used, for C2 and C3, positive and negative probes TSA Vivid Fluorophore Kit 650 (7527) was used. Sections were incubated with goat anti-rabbit Alexa-568 secondary antibody (1:300, Invitrogen, A11036) and DAPI solution (ACD bio), and mounted with Prolong Gold Antifade Mountant (ThermoFisher Scientific, 33342). Images were acquired with an Andor BC43 spinning disk confocal microscope (Oxford Instruments) controlled by the Fusion software from Andor, using a 10× air 0.45 NA objective, a 60× oil immersion 1.42 NA objective, a CMOS camera (6.5 μm pixel; 2,048 × 2,000 pixels generating 16-bit, monochrome images) with no binning. Samples were illuminated with 4 fixed wavelengths of 405 nm, 488 nm, 561 nm and 638 nm. Dorsal hippocampus overview was obtained with 3 × 3 stitching (10% overlap) using the 10× objective and the region of interest (CA1 pyramidal layer, closest to the midline) was afterward imaged at higher magnification using the 60× objective. Image analysis was performed after thresholding using the analyse particle function in ImageJ using four slices per mouse. The number of particles was analysed per 60 neurons per slice (240 neurons per mouse).

Fear conditioning

CFC was performed in an automated system (TSE Systems) as previously described²⁹. In brief, mice were exposed for 3 min to a novel context, followed by a foot shock (2 s, 0.7 mA, constant current). TFC was performed by exposing the mice to for 3 min to a novel context, followed by a 30 s tone (75 dB SPL, 10 kHz, 200 ms pulse), a 15 s trace, and a foot shock (2 s, 0.7 mA, constant current)⁶³. DFC was performed as described for TFC, except that trace was omitted so that shock immediately followed the end of the tone. At indicated time points, mice were tested for memory retrieval by re-exposing them to the same context (context test), or to a tone presented over 30 s in a different context (tone test after TFC or DFC). Testing consisted of 3 min in the conditioning context, during which freezing was measured every 10 s. Freezing was expressed as a percentage of the total number of observations during which the mice were motionless. Activity was recorded automatically by an infrared beam system and expressed in cm s⁻¹. The individual experiments with wild-type mice were not performed on littermates, so we did not apply randomization procedures, but with all genetic lines bred in our facility, littermates were randomly assigned to different experimental groups to minimize litter effects. The behavioural tests were performed blindly, either by experimentalists who were unaware of the treatments because the solutions were coded or by experimenters unaware of the experimental design. The experimenter performing the tests was not aware of the numbering code.

Surgery and cannulation

Double-guided cannulas (Plastic One) were implanted in the dorsal hippocampus as described previously¹⁷. Mice were anesthetized with 1.2% tribromoethanol (vol/vol, Avertin) and implanted with bilateral 26-gauge cannulas using a stereotaxic apparatus (Kopf, model 1900). Stereotaxic coordinates for the dorsal hippocampus were 1.8 mm posterior, ±1.0 mm lateral and 2.0 mm ventral to bregma.

Pharmacological treatments

All oligonucleotides and drugs were injected into the dorsal hippocampus at a volume of 0.25 μl per side, at a rate of 0.15 μl min⁻¹ using microinfusion pumps (Model UMP3T-1 UltraMicroPump 3 with SMARTouch Controller). ODN2088 was injected at doses of 125 and 300 ng per mouse corresponding to 4 and 8 nmol, respectively. Based on pilot experiments, the cGAS and STING antagonists were injected at doses of 10 and 50 ng in 250 nl per mouse.

DNase I (Sigma-Aldrich D4513, lot SLCQ3662, diluted in water) was injected intraperitoneally with 50 U DNase I in 200 µl saline, 24 h and 12 h before and 1 h after CFC, or intrahippocampally with 50 U DNase I per mouse at volume of 0.5 μl per side, at a rate of 1 μl min⁻¹ 24 h before and 1 h after test. DNase I and S1 nuclease (Thermo Scientific, EN0321) treatment were injected into the dorsal hippocampus at dosage 5 U DNase I + 10U S1 in 20% glycerol/artificial cerebrospinal fluid, vehicle: 20% glycerol/artificial cerebrospinal fluid 4 h before the memory test. Treatment schedules and doses were designed based on published data⁶⁴ and including both high and low doses as well as pre-CFC and pre-test injections.

For depletion of microglia, Pexidartinib (PLX-3397, HY-16749 lot: 212013 MedChemExpress) was formulated into 5053 PicoLab Rodent Diet 20 at the concentration of 290 ppm (W.F. Fisher and Son). The mice were fed for four weeks before the test. LabDiet 5053 served as a control diet. At the end of experiments, all brains were collected for histological determination of cannula placements or immunohistochemistry.

Virus injections

All viruses (listed in Supplementary Table 9) were injected at a volume of 0.5 μl per side, 1.8 mm posterior, ±1.0 mm lateral and 2.0 mm ventral to bregma, at a rate of 0.15 μl min⁻¹. At the time of virus infusion, mice were eight weeks old. CFC and memory tests were performed from weeks 13 to 17. One day after the completion of behavioural testing, mice were intracardially perfused, and all brains were collected, and virus spread was confirmed by immunohistochemical analysis of GFP or mCherry.

Labelling CFC-activated CA1 neurons using robust activity marking

We labelled the CA1 neurons in the dorsal hippocampus activated during CFC using doxycycline-off (off-Dox) activity-dependent cell tagging with the Robust Activity RAM system³¹ coupled to the human Fos minimal promoter with four tandem repeats of an enhancer module (PRAM) as recently described in detail¹¹. In brief, we put two groups of wild-type mice on a doxycycline diet one day before injecting AAV2/9-PRAM:d2tTA-TRE:NLS-mKate2 and took them off the diet after 9 days, followed by CFC the day after. Mice were left undisturbed in our testing facility without doxycycline for additional two days. Following two days, mice were put back on the doxycycline diet and 96 h after CFC, one group was subjected to memory reactivation (context test) and euthanized 1 h later. An additional, non-reactivated group served as control. This later group was only used internally to ensure that there was no Fos response without memory reactivation.

Statistics and reproducibility

Statistical power to detect anticipated effect sizes was determined using power analysis (calculator at http://www.stat.ubc.ca/~rollin/stats/ssize/n2.html) conducted on representative samples of previous work and pilot experiments. For all proposed experiments, minimum power is set at 0.90 to detect an α = 0.05 (two-sided test) for a difference in means from 20% to 40%, with a 15% common standard deviation. To prevent litter effects, mice from the same litter were assigned to different experimental groups. Viruses were injected by experimenters aware of the construct but the mice were then assigned coded numbers by the laboratory technician. The code was available after quantification and before analyses. Statistical analyses were performed using GraphPad Prism. Mice with misplaced virus infusion or cannulas, and mice with less than 70% viral expression in the CA1 were excluded. One-way ANOVA followed by Tukey’s test was used for post hoc comparisons of three or more experimental groups (only when ANOVA was significant) whereas Student’s t-test was used for comparison of two experimental groups. Homogeneity of variance was confirmed with Levene’s test for equality of variances. On indicated data, we performed correlation analyses and report Pearson’s r coefficients. Significant changes of co-localization or activation (%) were determined using the Chi-square test. A priori determined post hoc analyses following Chi-square tests were performed using Bonferroni-corrected alpha levels as the original overall alpha level (α = 0.05) was divided by the number of tests being conducted. These adjusted alpha levels were used as the new significance threshold for each individual test. All comparisons were conducted using two-tailed tests and the P value for all cases was set to <0.05 for significant differences. Data are expressed as mean ± s.e.m. Statistically significant differences are indicated as *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 and *****P < 0.00001. All cellular and molecular effects were shown in a minimum of six biological replicates (Figs. 1e and 2e and Extended Data Figs. 3f and 9). Two experimental replicates were performed for all time-course, Tlr9-KO, Rela-KO, Ifnar1-KO and WT–cre experiments (Figs. 1c,d, 2a–d and 5a,c and Extended Data Figs. 2–4, 11 and 12). All significant behavioural effects were replicated at least three times using wild-type, virus-specific and cell-specific control groups. All main gene expression effects were replicated with four different approaches (bulk RNA-seq, quantitative PCR arrays, quantitative PCR and snRNA-seq). Replicates produced similar results relative to initial or representative experiments.

Figures

Figures were created and edited using Adobe Illustrator CS6 (Adobe, v27.5, RRID: SCR_010279). Figs. 1a, 1b, 2a, 2e, 3a, 3c, 3d, 4a, and 5a, as well as Extended Data Figs. 4c, 4d, 5a, 5b, 5c, 5d and Supplementary Fig. 1 were created using BioRender.com.

Ethics declaration

All animal procedures used in this study were approved by the Northwestern University IACUC, Albert Einstein Medical College IACUC and Danish National Animal Experiment Committee, and complied with federal regulations set forth by the National Institutes of Health.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

[ad_2]

Source link

March 27, 2024
Crym-positive striatal astrocytes gate perseverative behaviour

[ad_1]

Mouse models

All animal experiments were conducted in accordance with the National Institutes of Health (NIH) Guide for the Care and Use of Laboratory Animals and were approved by the Chancellor’s Animal Research Committee at the University of California, Los Angeles (UCLA). All mice were housed with food and water available ad libitum in a 12-hour light–dark environment at temperatures of 20–22 °C with 40–60% humidity. All mice were healthy with no obvious behavioural phenotype, were not involved in previous studies and were euthanized during the light cycle. Data for most experiments were collected from adult mice aged 9–15 weeks old, but to characterize µ-crystallin expression during development and ageing, mice were used between P0 and 22 months old. For experiments, both male and female mice were used. C57Bl/6NTac mice were maintained as an in-house breeding colony or purchased from Taconic Biosciences. CAG-Cas9 transgenic mice (B6J.129(Cg)-Gt(ROSA)26Sortm1.1(CAG-cas9*,-EGFP)Fezh/J, JAX stock 026179) and SAPAP3^−/− mice (B6.129-Dlgap3tm1Gfng/J, JAX stock 008733) were purchased from the Jackson Laboratory and maintained as breeding colonies at UCLA. SAPAP3^−/− mice were used at six months of age. Tg(Crym-EGFP)GF82Gsat (strain 012003-UCD) reporter mice were obtained from MMRRC and maintained at UCLA.

sgRNA design and molecular cloning

To design sgRNAs for CRISPR–Cas9 knockout with minimal off-target effects, six target sequences (crRNAs) for the Crym gene were designed using the web tool CHOPCHOP (https://chopchop.cbu.uib.no/). Control target sequences for EGFP were designed using the same method. To select the three most efficient crRNA sequences for Crym and the most efficient crRNA sequence for EGFP, in vitro knockout efficiency was assessed using the Guide-it Complete sgRNA Screening System (Takara Bio 632636) by following the manufacturer’s instructions. The genomic sequence of Crym was obtained from the NCBI GenBank database (gene ID: 12971) and the genomic template was obtained by PCR amplification using the following primers: forward 5′-AGGTGGAACCAGAAAGTCCTCT-3′ and reverse 5′- GCACTTGGTGTATCTGAGCGTG-3′. An original vector containing a U6 promotor followed by two Bbs1 restrictions sites and by the tracrRNA sequence for SpCas9 (pZac2.1-U6-Bbs1-Bbs1-tracrRNA-GfaABC₁D-mCherry-SV40) was created. To insert the three crRNAs for Crym, each sequence was separately inserted in chaperone vectors to form three constructs with an sgRNA controlled by the U6 promotor. The three U6-sgRNAs were then combined in the same vector using a BglII restriction site and the In-Fusion cloning kit (Takara Bio 638943). The three crRNA sequences for Crym were: 5′-AAGTTAGTCACCTTCTATGA-3′, 5′-GCACCGATGCCTGATGGGAG-3′ and 5′-GGCAGGCGGCGAGATGAAGC-3′. The crRNA sequence for EGFP was 5′-CACCGGGGCGAGGAGCTGTTCACCGGTT-3′. The U6 sgRNA plasmids for Crym and the EGFP control have been deposited at Addgene in the Khakh laboratory repository (Addgene 200067 and 200068). The fully sequenced plasmids were sent to the UPenn Vector Core or Vigene Biosciences to generate AAV2/5 serotype for each construct, yielding a concentration higher than 1.0 × 10¹³ genome copies per ml (gc ml⁻¹). The cloning and sequencing strategies were designed with SnapGene software (v.7.0.3, Insightful Science).

Stereotaxic microinjections of AAVs

All surgical procedures were conducted under general anaesthesia using continuous isoflurane (induction at 5%, maintenance at 1–2% v/v). The depth of anaesthesia was monitored continuously and adjusted when necessary. After the induction of anaesthesia, the mice were fitted into a stereotaxic frame with their heads secured by blunt ear bars and their noses placed into a veterinary grade anaesthesia and ventilation system (VetEquip). Mice were administered with 0.1 mg per kg of buprenorphine (Buprenex, 0.1 mg ml⁻¹) subcutaneously before surgery. The surgical incision site was then cleaned three times with 10% povidone iodine and 70% ethanol (v/v). Skin incisions were made, followed by craniotomies of 2–3 mm in diameter above the left frontal or parietal cortex using a small steel burr (Fine Science Tools) powered by a high-speed drill (K.1070, Foredom). Saline (0.9%) was applied onto the skull to reduce heating caused by drilling. Bilateral viral injections were performed by using a stereotaxic apparatus (David Kopf Instruments) to guide the placement of beveled glass pipettes (1B100-4, World Precision Instruments). For the central striatum, the coordinates were 0.8 mm anterior to bregma, 1.85 mm lateral to midline and 2.9 mm from the pial surface. For the lOFC, the coordinates were 2.8 mm anterior to bregma, 1.5 mm lateral to midline and 1.6 mm from the pial surface. For M1, the coordinates were 1.8 mm anterior to bregma, 1.8 mm lateral to midline and 0.6 mm from the pial surface. AAVs were injected by using a syringe pump (Pump11 PicoPlus Elite, Harvard Apparatus). After AAV microinjections, glass pipettes were left in place for at least 10 min before being slowly withdrawn. Surgical wounds were closed with external 5-0 nylon sutures. After surgery, mice were allowed to recover overnight in cages placed partially on a low-voltage heating pad. Buprenorphine was administered twice a day for up to two days after surgery. In addition, trimethoprim sulfamethoxazole was provided in food to the mice for one week to prevent infection.

AAV-injected mice were used for experiments three weeks after surgery. The viruses used were: 0.5 μl or 0.3 μl of AAV2/5 U6-sgRNA-Crym(×3)-GfaABC₁D-mCherry virus (3 × 10¹³ gc ml⁻¹) (Addgene 200067), 0.5 μl or 0.3 μl of AAV2/5 U6-sgRNA-GFP-GfaABC₁D-mCherry virus (3.8 × 10¹³ gc ml⁻¹) (Addgene 200068), 0.3 μl of AAV9-CaMK11a-hChR2(H134R)-mCherry (2.1 × 10¹³ gc ml⁻¹) (Addgene 26975), 0.3 μl of AAV1-hSyn-Chronos-GFP (1.4 × 10¹³ gc ml⁻¹) (Addgene 59170), 0.3 μl of retrograde AAV-hSyn-hM4D(Gi)-mCherry (2.4 × 10¹³ gc ml⁻¹) (Addgene 50475), 0.3 μl of retrograde AAV-hSyn-mCherry (2.4 × 10¹³ gc ml⁻¹) (Addgene 114472), 0.3 μl AAV2/5-GfaABC₁D-Rpl22-HA (2.1 × 10¹³ gc ml⁻¹) (Addgene 111811), 0.5 μl AAV2/5 GfaABC₁D-Crym-EGFP (2.5 × 10¹³ gc ml⁻¹) (Addgene 200080), 0.5 μl AAV2/5 GfaABC₁D-Crym-BioID2-HA (3.1 × 10¹³ gc ml⁻¹) (Addgene 200070), 0.5 μl AAV2/5 GfaABC₁D-jGCaMP8m (Addgene 213010), 0.5 μl AAV2/5 GfaABC₁D-tdTomato (Addgene 44332). All AAVs are listed in Supplementary Table 1.

IHC

Frozen sections

For transcardial perfusion, mice were euthanized with isoflurane and perfused with 0.1 M phosphate-buffered saline (PBS) followed by 10% buffered formalin (Fisher SF100-20). Heparin (50 units) was injected into the heart to prevent blood clotting. After gentle removal from the skull, the brain was post-fixed in 10% buffered formalin overnight at 4 °C. For the characterization of striatal µ-crystallin expression during development, P0 and P7 brains were directly post-fixed in 10% buffered formalin without transcardial perfusion. The tissue was cryoprotected in 30% sucrose PBS solution for at least 48 h at 4 °C until use. Forty-micrometre coronal sections were prepared using a cryostat microtome (Leica) at −20 °C and processed for immunohistochemistry. Sections were washed three times in 0.1 M PBS for 10 min each, and then incubated in a blocking solution containing 10% NGS in 0.1 M PBS with 0.2% Triton-X 100 for one hour at room temperature with agitation. Sections were then incubated with agitation in primary antibodies diluted in blocking solution overnight at 4 °C. The following primary antibodies were used: mouse anti-µ-crystallin (1:250, Santa Cruz, sc-376687), chicken anti-GFP (1:1,000; Abcam ab13970), mouse anti-NeuN (1:500; Millipore MAB377), guinea pig anti-NeuN (1:500; Synaptic Systems, 266004), rabbit anti-DARPP-32 (1:1,000, Abcam, ab40801), rabbit anti-S100β (1:1,000; Abcam ab41548), rabbit anti-cFOS (1:1,000; Synaptic Systems 226008), rabbit anti-RFP (1:1,000; Rockland 600–401-379), rabbit anti-mCherry (1:1,000; Abcam, ab167453), rabbit anti-opioid receptor, µ, pain (MOR1) (1:200, Millipore Sigma, AB5511), chicken anti-calbindin D-28K (1:200, Novus Biologicals, NBP2-50028), chicken anti-GFAP (1:1,000; Abcam, ab4674) and rabbit anti-HA tag (1:1,000; Abcam, ab9110), guinea pig anti-RFP (1:1,000, Synaptic Systems, 390004), rabbit anti-SOX9 (1:500, EMD Millipore, AB5535), rabbit anti-OLIG2 (1:500, EMD Millipore AB9610), rabbit anti-KIR4.1 (1:500, Alomone Labs, APC-035), rabbit anti-ATP1a2 (1:300, Proteintech, 16836-1-AP), rabbit anti-GLT1 (1:500, Synaptic Systems, 250203), mouse anti-GABA (1:500, Abcam, ab86163), rabbit anti-MAOB (1:500, Thermo Fisher Scientific PA5-28338), rabbit anti-GAT3 (1:250, gift from the N. Brecha laboratory at UCLA), rabbit anti-CAPZB (1:250, Thermo Fisher Scientific PA5-83196). The next day, the sections were washed three times in 0.1 M PBS for 10 min each before incubation at room temperature for two hours with secondary antibodies diluted in 0.1 M PBS. Alexa-conjugated (Molecular Probes) secondary antibodies were used at a 1:1,000 dilution (Alexa Fluor 405 goat anti-mouse (A31553), Alexa Fluor 488 goat anti-chicken (A11039), Alexa Fluor 488 goat anti-rabbit (A11008), Alexa Fluor 488 goat anti-mouse (A11010), Alexa Fluor 546 goat anti-mouse (A11030), Alexa Fluor 546 goat anti-rabbit (A11001), Alexa Fluor 647 goat anti-rabbit (A21244), streptavidin and Alexa Fluor 488 conjugate (S11223)). The sections were rinsed three times in 0.1 M PBS for 10 min each before being mounted on microscope slides and sealed in fluoromount-G. Fluorescence images were taken using UPlanSApo 10× 0.4 NA, UPlanFLN 40× 1.30 NA oil immersion or PlanApo N 60× 1.45 NA oil immersion objective lenses on a confocal laser-scanning microscope (Fluoview FV3000; Olympus). Laser settings were kept the same within each experiment. Images represent maximum intensity projections of optical sections with a step size of 1 μm or 5 µm for the entire brain or striatum images. Images were processed with Image J (NIH v.2.1). Cell counting was done on maximum intensity projections using the Cell Counter plug-in; only cells with soma completely within the region of interest (ROI) were counted.

Acute sections

Acute sections were used for biocytin staining to assess MSN morphology, spine density and spine head width. Fresh brain slices (300 μm) were placed into 10% buffered formalin overnight at 4 °C and processed as for IHC. Sections were washed three times in 0.1 M PBS with 2% Triton-X 100 for 5 min each, and then incubated in a blocking solution containing 10% NGS in 0.1 M PBS with 1% Triton-X 100 for one hour at room temperature with agitation. Sections were then incubated at room temperature with streptavidin-conjugated Alexa 647 (1:250, S11223) diluted in 0.1 M PBS with 0.4% Triton-X 100 for 3 h. The sections were rinsed three times in 0.1 M PBS for 10 min each before being mounted on microscope slides in fluoromount-G. Images were obtained in the same way as for the IHC for frozen sections, except with a step size of 0.33 μm. For the quantification of spine density, we analysed only spines on dendritic shafts that were parallel to the imaging plane to minimize the possibility of rotational artefacts. Spine density was calculated by dividing the number of spines by the length of the dendritic segment. For quantification of spine head width, a line ROI across the maximum diameter of the spine was made and a profile that has a single peak was obtained. The MSN morphology was determined using a Sholl analysis plug-in with ImageJ (NIH v.2.1).

TUNEL assay

To assess apoptosis, a TUNEL assay was performed on frozen sections in control and Crym KO mice using the TUNEL Andy Fluor 647 Apoptosis Detection Kit (ABP Biosciences, A052). In brief, DNA strand breaks with 3’-hydroxyl ends are labelled with biotin-11-dUTP in the presence of terminal deoxynucleotidyl transferase (TdT). Once incorporated into the DNA, biotin is detected using HRP- or fluorophore-labelled streptavidin. The experiment was performed following the manufacturer’s instructions.

Retrograde tracing and afferent projections

For retrograde tracing experiments, 300 nl of cholera toxin subunit B, Alexa Fluor 647-conjugated (CTB-647) (Thermo Fisher Scientific C34778) was injected in the central striatum of CAG-Cas9-GFP mice. Ten days after injection, frozen sections were prepared as described above. The number of CTB-647⁺ cell bodies per mm² were manually counted in regions of the prefrontal cortex and motor cortex delineated by the Paxinos Brain Atlas. To visualize the projections from the lOFC and M1, 0.3 µl of AAV9-CaMKIIa-hChR2(H134R)-mCherry and 0.3 µl of AAV1-Syn-Chronos-GFP were injected in the lOFC and M1 respectively. Four weeks after injection, mCherry and GFP fluorescence in the striatum were delineated with a threshold method and the intensity of µ-crystallin was quantified in each ROI.

Astrocyte morphology

Astrocyte morphology was assessed using Lucifer Yellow iontophoresis. In brief, control or Crym KO mice were transcardially perfused with 10 ml of 35 °C Ringer’s solution (135 mM NaCl, 14.7 mM NaHCO₃, 5 mM KCl, 1.25 mM Na₂HPO₄, 2 mM CaCl₂, 1 mM MgCl₂ and 11 mM d-glucose, bubbled with 95% O₂ and 5% CO₂) with 0.02% lidocaine followed by 50 ml of 10% buffered formalin (Thermo Fisher Scientific SF100-20). Brains were lightly post-fixed at room temperature for 1.5 h and then washed three times in ice-cold 0.1 M PBS for 10 min. Coronal sections (100 μm) were cut using a Pelco Vibrotome 3000 and then placed in ice-cold PBS for the duration of the experiment. Ten milligrams of Lucifer yellow CH di-Lithium salt (Sigma L0259) was dissolved in 1 ml 5 mM KCl solution and filtered before use. Sharp (around 200 MOhm) glass electrodes were pulled from borosilicate glass capillaries with filament (outer diameter 1.0 mm; inner diameter 0.58 mm). Electrodes were gravity filled with Lucifer yellow solution. Sections were transferred to a PBS solution at room temperature for filling. Astrocytes were identified using mCherry expression and then impaled with the sharp electrode. Lucifer yellow was injected into the cell by applying around 1 V for 10 min. After the astrocyte was filled, the electrode was removed completely. The sections were fixed with 4% paraformaldehyde and the filled astrocyte was imaged with UPlanFLN 40× 1.30 NA oil immersion or PlanApo N 60× 1.45 NA oil immersion objective lenses on a confocal laser-scanning microscope (Fluoview FV3000; Olympus) at a digital zoom of two to three and a 0.3-µm confocal z-step. Territory area and soma area were generated using threshold reconstruction with Image J (NIH v.2.1).

Dual in situ hybridization with RNAscope and IHC

Fixed-frozen tissue was processed as described above. Serial coronal sections (14 μm) containing striatum were prepared using a cryostat microtome (Leica) at −20 °C and mounted immediately onto glass slides. In situ hybridization was performed using Multiplex RNAscope (ACDBio 320851). Sections were washed for at least 15 min with 0.1 M PBS, and then incubated in 1× Target Retrieval Reagents (ACDBio 322000) for 5 min at 95–100 °C. After washing with ddH₂O twice for 1 min each, they were dehydrated with 100% ethanol for 2 min and dried at room temperature. Then, the sections were incubated with Protease Pretreat solution (ACDBio 322340) for 30 min at 40 °C. The slides were washed with ddH₂O twice for 1 min each and then incubated with probe(s) for 2 h at 40 °C. The following probes were used: Mm-Crym-C3 (ACDBio 466131-C3), Mm-Drd1-C3 (ACDBio 461901-C3) and Mm-Drd2-C3 (ACDBio 406501-C3). The sections were incubated in AMP 1-FL for 30 min, AMP2-FL for 15 min, AMP3-FL for 30 min and AMP4-FL for 15 min at 40 °C with washing in 1× wash buffer (ACDBio 310091) twice for 2 min each before the first incubation and in between incubations. All the incubations at 40 °C were performed in the HybEZ Hybridization System (ACDBio 310010). Slices were washed in 0.1 M PBS three times for 10 min each, followed by IHC that was performed as described above except with antibody dilutions. The following primary antibodies were used: mouse anti-µ-crystallin (1:100, Santa Cruz, sc-376687), rabbit anti-DARPP-32 (1:500, Abcam, ab40801) and rabbit anti-S100β (1:500; Abcam ab41548). Images were obtained in the same way as for the IHC described above, and were processed with Image J (NIH v.2.1). Astrocyte area was demarcated by drawing an 80-µm-diameter circle around the soma (the average size of striatal astrocytes based on our previous experiments). Then, the percentage of D1 and D2 positive neurons was quantified within this area.

Pharmacological treatments

To reduce stress, mice were handled and habituated three days before beginning the treatments. For fluoxetine experiments, six-month-old SAPAP3^−/− mice were treated with an intraperitoneal (i.p.) injection of fluoxetine (Tocris 0927) at 10 mg per kg (dissolved in 0.9% sodium chloride) for seven consecutive days. Three weeks after AAV microinjection, striatal Crym KO mice were treated with an i.p. injection of fluoxetine at 10 mg per kg for 21 consecutive days. For Gi activation, mice were treated with a single i.p. injection of deschloroclozapine (DCZ, Tocris 7193) at 1 µg kg⁻¹ for one day (grooming test), two days (open-field test), three days (marble-burying test), seven days (novel object recognition test) or eight days (IHC). For both experiments, untreated mice received the same amount of 0.9% sodium chloride (vehicle). Behavioural tests or euthanasia were performed one to two hours after treatments.

Behavioural tests

Behavioural tests were performed during the light cycle between 09:00 and 18:00, three to five weeks after AAV injection. Both male and female mice were used in behavioural tests. The mice were randomly allocated to a group as they became available and of age in the breeding colony. All of the experimental mice were transferred to the behaviour testing room at least 30 min before the tests to allow them to acclimatize to the environment and to reduce stress. The temperature and humidity of the experimental rooms were kept at 23 ± 2 °C and 55 ± 5%, respectively. Background noise (65 ± 2 dB) was generated by a white noise generator (San Diego Instruments). The brightness of the experimental room was kept at less than 20 lux.

Open-field test

The open-field chamber consisted of a square arena (28.5 × 30 cm) enclosed by walls made of translucent polyethylene (15 cm tall). The locomotor activity of mice was recorded for 10 or 30 min using a camera located above the open-field chamber. The open-field behaviours were analysed with an automated video tracking software ANY-maze (v.6.3, Stoelting).

Rotarod test

Mice were held by the tails and placed on the rod (3 cm diameter) of a single lane rotarod apparatus (ENV-577 M, Med Associates), facing away from the direction of rotation. The rotarod was set with a start speed of 4 rpm. Acceleration started 10 s later and was set to 20 rpm with a maximum speed 40 rpm per min. Each mouse received five trials 30 min apart for five consecutive days and the latency to fall was recorded for each trial. The average latency to fall was used as a measurement for motor coordination.

Footprint test

A 1-m-long runway (8 cm wide) was lined with paper. Each mouse had its hind paws painted with non-toxic ink and was placed at an open end of the runway. The mice were allowed to walk to the other end with a darkened box. For the gait analysis, stride length and width were measured and averaged for both left and right hindlimbs over five steps.

Self-grooming behaviour

Mice were placed individually into plastic cylinders (15 cm in diameter and 35 cm tall), and allowed to habituate for 20 min. Self-grooming behaviour was recorded for 10 min. A timer was used to assess the cumulative time spent in self-grooming behaviour, which included paw licking; unilateral and bilateral strokes around the nose, mouth and face; paw movement over the head and behind the ears; body fur licking; body scratching with hind paws; tail licking; and genital cleaning. The number of self-grooming bouts and rearing bouts was also counted. Separate grooming bouts were considered when the pause was more than 5 s or if behaviours other than self-grooming occurred. The self-grooming microstructure was not assessed.

Spray test

A standard spray bottle was filled with distilled water and the nozzle was adjusted to the ‘misting’ mode. Mice were held by the tails on the bench and sprayed four times from 30 cm away to be adequately covered with mist. Mice were placed individually into the plastic cylinders and grooming behaviour was recorded for 10 min after the spray and then analysed as described in the preceding section.

Marble-burying and digging test

Fresh, unscented soft wood chip bedding was added to polycarbonate cages (21 × 43 × 20.5 cm) to a depth of 5 cm. Fifteen sanitized glass marbles were gently placed on the surface of the bedding in five rows of three marbles. Mice were allowed to remain in the cage undisturbed for 30 min. A marble was scored as buried if two-thirds of its surface area was covered by bedding. For the digging test, the same experiment without the marbles was performed. The latency to start digging, the total digging duration and the duration of digging bouts were also counted.

Novel object recognition

On day 1 and day 2, mice were placed in an empty open chamber (28.5 × 30 cm) for 10 min for habituation. On day 3 (training day), mice were placed in the same open chamber containing two identical objects evenly spaced apart; the trial was video recorded for 10 min. For the novel object recognition test, at day 4 (testing day), 24 h after training, mice were placed in the same open chamber, with one of the two objects replaced with a novel object. The trial was video recorded for 10 min. Time exploring around the objects was manually measured. The recognition index was calculated as follows: (time exploring the novel object – time exploring the familiar object)/(time exploring both objects) – 50.

Lickometer test

Mice were placed in a lickometer system (Stoelting) to measure licking behaviour (20 × 20 cm). In brief, an electrical signal was generated from the tongue touching the sipper tube, with each lick recorded as an event using the ANY-maze software (v.6.3, Stoelting). Mice were placed in the chamber for 30 min during four consecutive days and placed back to their home cage at the end of each session. Before the fourth day, mice were water deprived for 12–16 h before the session. The total number of licks, the total duration of drinking and the latency to start drinking were measured by the software.

Elevated plus maze

The elevated plus maze consisted of arms that were 30 × 7 cm with closed-arm walls with a height of 20 cm. The maze was elevated 65 cm above floor level and was placed in the centre of the room away from other stimuli. Mice were placed in the centre of the maze facing an open arm. Mice were recorded for 10 min using a camera (Logitech) located above the maze. ANY-maze video analysis software was used to quantify the time spent in open arms and time spent in close arms.

Food consumption

Three weeks after AAV injections, 200 g of food was placed in the home cage for 72 h. The remaining food was weighed and divided by the number of days and the number of mice to calculate the consumption in gram per day per mouse.

Weight

Mice were weighed the day before the AAVs injection and every week for four weeks after injection.

Brain-slice preparation and electrophysiological recordings in the striatal slices

Coronal or sagittal striatal slices were prepared from 6–12-week-old Crym KO mice, control or Crym-GFP mice. In brief, mice were deeply anaesthetized with isoflurane and decapitated with sharp shears. The brains were placed and sliced in ice-cold modified artificial CSF (aCSF) containing the following: 194 mM sucrose, 30 mM NaCl, 4.5 mM KCl, 1 mM MgCl₂, 26 mM NaHCO₃, 1.2 mM NaH₂PO₄ and 10 mM d-glucose, and saturated with 95% O₂ and 5% CO₂. A vibratome (DSK Microslicer; Ted Pella) was used to cut 300-µm brain sections. The slices were allowed to equilibrate for 30 min at 33 °C in normal aCSF containing: 124 mM NaCl, 4.5 mM KCl, 2 mM CaCl₂, 1 mM MgCl₂, 26 mM NaHCO₃, 1.2 mM NaH₂PO₄ and 10 mM d-glucose, continuously bubbled with 95% O₂ and 5% CO₂. Slices were then stored at 21–23 °C in the same buffer until use. All slices were used within 6 h of slicing. The brain-slice recordings were performed at room temperature (21–23 °C). Whole-cell patch-clamp recordings were made from astrocytes or MSNs in the central striatum using patch pipettes with a typical resistance of 4–6 MΩ. MSNs were morphologically and electrophysiologically identified. Astrocytes were identified by mCherry or EGFP expression. The intracellular solution for MSN membrane properties, EPSCs, evoked EPSCs and astrocyte recordings comprised the following: 135 mM potassium gluconate, 3 mM KCl, 10 mM HEPES, 1 mM EGTA, 0.3 mM Na-ATP, 4 mM Mg-ATP, 0.1 mM CaCl₂ and 8 mM Na₂-phosphocreatine, with the pH adjusted to 7.3. The intracellular solution for IPSC recordings comprised the following: 138 mM KCl, 10 mM HEPES, 1 mM EGTA, 0.3 mM Na-ATP, 4 mM Mg-ATP, 0.1 mM CaCl₂, 8 mM Na₂-phosphocreatine and 3 mM QX314, with the pH adjusted to 7.3. To evoke EPSCs specifically from the M1 or lOFC projections, Channelrhodopsin 2 was injected bilaterally in one of these two areas and afferents in the central striatum were stimulated with an LED light source (Lambda TLED+, Sutter Instrument). To assess input–output function, test stimuli were applied at increasing intensities ranging from 0 to 3 mW. Stimulation intensities were set to evoke responses at 50–60% maximal amplitude to induce paired-pulse responses. Paired pulses were delivered at five different interpulse intervals: 40, 60, 80, 100 and 160 ms apart. To isolate mEPSCs, MSNs were voltage-clamped at −70 mV and pre-incubated with 0.3 µM tetrodotoxin (TTX) before recording. To isolate sIPSCs, MSNs were voltage-clamped at −60 mV and pre-incubated in the presence of 10 µM 6-Cyano-7-nitroquinoxaline-2,3-dione (CNQX) for 10 min before recording. mIPSCs were recorded after incubation with 10 µM CNQX and 0.3 µM TTX for 10 min. To access tonic GABA currents, 25 µM bicuculline was bath-applied in the presence of 10 µM CNQX, 0.3 µM TTX. In some cases, 1 mg ml⁻¹ biocytin (Tocris, 3349) was added to the intracellular solution to subsequently visualize patched neuron. All recordings were performed at room temperature, using pCLAMP11.2 (Axon Instruments, Molecular Devices) and a MultiClamp 700B amplifier (Axon Instruments, Molecular Devices). Cells with Ra that exceeded 25 MΩ were excluded from analysis. Analysis was performed using ClampFit 10.7 software.

Calcium imaging of astrocytes in brain slices

Slice preparation was performed as above. Cells for all of the experiments were imaged using a confocal microscope (Fluoview 1000; Olympus) with a 40× water-immersion objective lens with 0.8 NA and a digital zoom of two to three. We used the 488-nm line of an Argon laser, with the intensity adjusted to 5–10% of the maximum output of 10 mW. The emitted light pathway consisted of an emission high-pass filter (505–525 nm) before the photomultiplier tube. Astrocytes were typically around 25 μm below the slice surface and were scanned at one frame per second for imaging sessions. For pharmacological activation of endogenous G-protein-coupled receptors, agonists were dissolved in water. Stock solutions were diluted in aCSF immediately before use. Analyses of time-lapse image series were performed using Image J v.2.1 (NIH). The XY drift was corrected using Image J; cells with Z drift were excluded from analyses. Time traces of fluorescence intensity were extracted from the ROIs and converted to ΔF/F values. For microdomains, GECIquant software (v.1.0) was used. Events were identified on the basis of amplitudes that were at least twofold above the baseline noise of the ΔF/F trace. Extracted calcium signals were analysed using OriginPro 2017 (OriginLab, v.9.4.2).

Striatal scRNA-seq

scRNA-seq was performed to profile the whole striatum of four adult mice using a protocol that preferentially captures non-neuronal cells²³. Male mice at 7–8 weeks old were anaesthetized and decapitated. The brain was immediately dissected out and was sectioned on a vibratome (Microslicer DTK-Zero 1; Ted Pella) into 400-μm slices in ice-cold aCSF + trehalose (ACSF-T) (124 mM NaCl, 2.5 mM KCl, 1.2 mM NaH₂PO₄, 24 mM NaHCO₃, 5 mM HEPES, 13 mM glucose, 2 mM MgSO₄, 2 mM CaCl₂ and 14.6 mM trehalose, pH adjusted to 7.3–7.4) oxygenated with 95% O₂/5% CO₂. The slices containing the striatum were immediately transferred to an oxygenated recovery solution (93 mM N-methyl-d-glucamine, 2.5 mM KCl, 1.2 mM NaH₂PO₄, 30 mM NaHCO₃, 20 mM HEPES, 25 mM glucose, 10 mM MgSO₄, 0.5 mM CaCl₂, 5 mM sodium ascorbate, 2 mM thiourea, 3 mM sodium pyruvate and 45 μM actinomycin D, with a pH of 7.3–7.4) for 15 min on ice. The striatum was dissected out under a dissecting microscope in ice-cold ACSF-T and cut into small pieces (less than 1 mm in all dimensions). Tissue was then transferred to a Petri dish for digestion with ACSF-T containing 1 mg ml⁻¹ pronase (Sigma-Aldrich, P6911) and 45 μM actinomycin D (Sigma-Aldrich, A1410) and incubated at 34 °C for 20 min with aerated carbogen. The digested tissue was transferred to ice-cold oxygenated ACSF-T containing 1% fetal bovine serum and 3 μM actinomycin D. The tissue was dissociated sequentially by gentle trituration through glass Pasteur pipettes with polished tip openings of 500 μm, 300 μm and 150 μm diameter. Actinomycin D was added to the recovery solution at 45 μM, the pronase solution at 45 μM and trituration solution at 3 μM to prevent stress-induced transcriptional alterations. To increase the yield of glial cells²³, filters with various pore sizes (70 μm, 40 μm and 20 μm) were tested, and a 20-μm filter gave the highest yield and therefore was chosen. The dissociated cells were filtered through a 20-μm filter and washed with ice-cold ACSF-T. To remove myelin, the cell pellet was resuspended in PBS and processed with a debris removal kit (Miltenyi Biotec, 130-109-398). The cell density was calculated and isolated cells were diluted to 1,000 cells per microlitre and processed with the 10X Genomics platform within 10 min. Single-cell libraries were generated and sequenced on the Illumina NextSeq500 sequencer.

scRNA-seq analysis

Sequence reads were processed and aligned to the mouse genome (mm10) using CellRanger 3.0. Striatal cells with fewer than 300 genes and genes expressed in more than 3 cells were used for the subsequent analysis in R. Basic processing and visualization of the scRNA-seq data were performed with the Seurat package (v.4.0.5) in R (v.4.0.3). Scrublet was embedded in the Seurat pipeline to remove doublets. Our initial dataset contained 64,836 cells. Data across batches were integrated with canonical correlation analysis (CCA), and annotated with mouse ID and age with a metadata column. The transcript expression was normalized for each cell by the total expression, and multiplied by a scale factor of 10,000, and log-transformed. Next, principal component analysis (PCA) was performed, and the top 30 principal components (PCs) were stored. Clusters were identified with the FindClusters() function by use of the shared nearest neighbour modularity optimization with a clustering resolution set to 0.08. Cell-class clusters were then annotated on the basis of the expression of cell lineage marker genes. Astrocyte cell class was further analysed. Astrocytes were subset, CCA integrated, scaled and normalized; this was followed by PCA analysis, and shared nearest neighbour modularity optimization with a clustering resolution of 0.08 was performed. Six molecular subclusters were identified. Astrocyte cells that were Crym⁺ were defined if the Crym transcript expression level was greater than 0.25 (2,126 cells), and Crym⁻ cells were defined if the Crym transcript expression level was less than 0.25 (2,093 cells). MAST (model-based analysis of single-cell transcripts) comparison identified differentially expressed genes (FDR < 0.05) in Crym⁺ and Crym⁻ cells with a threshold criteria of 0.1 (that is, 10% of cells). Genes were considered commonly expressed if they were expressed in all astrocyte cells, but were not differentially expressed in Crym⁺ astrocytes. QIAGEN ingenuity pathway analysis (IPA) was performed to identify canonical pathways associated with these genes (made available by QIAGEN Digital Insights).

RNA-seq experiments using the RiboTag method

CAG-Cas9-GFP mice (6–8 weeks old) were bilaterally injected in the central striatum with astrocytic RiboTag (AAV2/5-GfaABC₁D-Rpl22-HA) in conjunction with AAVs expressing sgRNAs for Crym (AAV2/5 U6-sgRNA-Crym(×3)-GfaABC₁D-mCherry) or for EGFP (AAV2/5 U6-sgRNA-GFP-GfaABC₁D-mCherry). RNA was immunoprecipitated from astrocytes or neurons at 10–12 weeks old as previously described³³. In brief, freshly dissected striatum tissues were collected and individually homogenized in 1 ml homogenization buffer (50 mM Tris pH 7.4, 100 mM KCl, 12 mM MgCl₂, 1% NP-40, 1 mM dithiothreitol (DTT), 1× protease inhibitors, 200 U ml⁻¹ RNAsin, 100 µg ml⁻¹ cyclohexamide and 1 mg ml⁻¹ heparin). RNA was extracted from 20% of cleared lysate as Input (200 µl). The remaining lysate (800 µl) was incubated with 5 µl of mouse anti-HA antibody (Biolegend 901514) with rocking for 4 h at 4 °C, followed by the addition of 200 µl of magnetic beads (Pierce 88803) and overnight incubation with rocking at 4 °C. The beads were washed three times in high-salt solution (50 mM Tris pH 7.4, 300 mM KCl, 12 mM MgCl₂, 1% NP-40, 1 mM DTT and 100 µg ml⁻¹ cyclohexamide). RNA was purified from the immunoprecipitated and corresponding input samples (RNeasy Plus Micro, QIAGEN 74034). RNA concentration and quality were assessed with Agilent 2100 Bioanalyzer. RNA samples with an RNA integrity number greater than seven were processed with the Ribo-Zero Gold kit (Epicentre) to remove ribosomal RNA. Sequencing libraries were prepared using the Illumina TruSeq RNA sample preparation kit following the manufacturer’s protocol. After library preparation, amplified double-stranded cDNA was fragmented into 125-bp (Covaris-S2) DNA fragments, which were (200 ng) end-repaired to generate blunt ends with 5’-phosphates and 3’-hydroxyls and adapters ligated. The purified cDNA library products were evaluated using the Agilent Bioanalyzer and diluted to 10 nM for cluster generation in situ on the HiSeq paired-end flow cell using the CBot automated cluster generation system. Samples in each experiment were multiplexed into a single pool to avoid batch effects and 69-bp paired-end sequencing was performed using an Illumina HiSeq 4000 sequencer (Illumina). A yield of between 51 and 108 million reads was obtained per sample. Quality control was performed on base qualities and the nucleotide composition of sequences. Alignment to the Mus musculus (mm10) refSeq (refFlat) reference gene annotation was performed using the STAR spliced read aligner (v.2.7.5c) with default parameters. Further quality control was performed after the alignment to examine: the degree of mismatch rate, mapping rate to the whole genome, repeats, chromosomes, key transcriptomic regions (exons, introns, UTRs and genes), insert sizes, AT/GC dropout, transcript coverage and GC bias. Between 75% and 94% (average 87.6%) of the reads mapped uniquely to the mouse genome. Total counts of read fragments aligned to candidate gene regions were derived using the HTSeq program (https://htseq.readthedocs.io/en/latest/overview.html#overview) with mouse mm10 refSeq (refFlat table) as a reference and used as a basis for the quantification of gene expression. Only uniquely mapped reads were used for subsequent analyses. Differential expression analysis was conducted with R Project and the Bioconductor package limmaVoom. Weighted gene co-expression network analysis (WGCNA) was performed using an R package. Modules of genes that highly correlated with HD samples were selected. RNA-seq data have been deposited in the Gene Expression Omnibus (GEO) repository (https://www.ncbi.nlm.nih.gov/geo/).

Metabolomics experiments

Four to six weeks after AAV injection, mice were decapitated and striata were dissected and flash-frozen. Five to eight milligrams of each tissue sample was extracted using a Folch-like method (water, methanol and chloroform) and a bead-based mechanical tissue disruptor. The polar phase was dried and derivatized for GC–MS analysis as previously described⁵⁰. The results were scaled against calibrated standards and normalized to the frozen weight of the starting material to obtain nmol per mg values.

Proteomic experiments

In vivo BioID2 protein biotinylation

A detailed protocol is available in a previous report⁴⁸. In brief, three weeks after AAV microinjection with Crym-BioID2 AAV, mice were treated with a subcutaneous injection of biotin at 24 mg per kg (Millipore Sigma RES1052B-B7) dissolved in sterile 0.1 M PBS once per day for seven consecutive days. The mice were processed 16 h after the last biotin injection.

Western blot of in vivo BioID2 samples

Mice were decapitated and the striata were dissected and homogenized with a dounce and pestle in ice-cold RIPA buffer (150 mM NaCl, 50 mM Tris pH 8.0, 1% Triton-X, 0.5% sodium deoxycholate, 0.1% SDS and Halt protease inhibitor (Thermo Fisher Scientific 78429). The homogenate was incubated at 4 °C while spinning for one hour. The homogenate was sonicated and then centrifuged at 4 °C for 10 min at 15,600g. The clarified lysate was collected and the protein concentration was measured using the BCA protein assay (Thermo Fisher Scientific). The samples were then mixed with 2× Laemmli solution (BioRad) containing β-mercaptoethanol. The samples were boiled at 95 °C for 10 min before being electrophoretically separated by 10% SDS–PAGE (30 μg protein per lane) and transferred onto a nitrocellulose membrane (0.45 μm). The membrane was incubated with agitation in a solution containing 5% BSA, 0.1% Tween-20 and 0.1 M PBS for 1 h. The membrane was probed with streptavidin–HRP (Sigma RABHRP3) at 1:250 for two hours. The membrane was then treated with the Pierce chemiluminescence solution for 1 min and imaged. The blot was incubated overnight at 4 °C with rabbit anti-β-actin (1:1,000; Abcam ab8227). IR-dye 800CW anti-rabbit (1:10,000; Li-Cor) secondary was used and images were acquired on a Li-Cor odyssey infrared imager. Signal intensities at the expected molecular weight were quantified using Image J (v.2.1). The streptavidin signal levels were normalized to β-actin by dividing the streptavidin signal intensity by the β-actin signal intensity. Thirty micrograms of protein was loaded into each gel well.

In vivo pull-down of BioID2 biotinylated proteins

The purification of biotinylated proteins was performed as previously described⁴⁸. Each AAV Crym-BioID2 probe and its counterpart AAV Crym-GFP control were injected into the striatum of six-week-old C57/Bl6NTac mice. Three weeks after AAV microinjection, biotin (Millipore Sigma RES1052B-B7) was subcutaneously injected at 24 mg per kg for seven consecutive days. All mice were processed 16 h after the last biotin injection. Eight mice were used for each biotinylated protein purification and each purification was performed independently five times. Mice were decapitated and striata were microdissected. Striata from four mice were dounce homogenized with 600 μl of lysis buffer 1 (1 mM EDTA, 150 mM NaCl and 50 mM HEPES pH 7.5, supplemented with Halt protease inhibitor (Thermo Fisher Scientific 78429). Immediately after homogenization, 600 μl of lysis buffer 2 (2% sodium deoxycholate, 2% Triton-X, 0.5% SDS, 1 mM EDTA, 150 mM NaCl and 50 mM HEPES pH 7.5) was added. The lysed samples were sonicated for 5 min at 60% power and then centrifuged at 15,000g for 15 min at 4 °C. The resulting supernatant was then ultracentrifuged at 100,000g for 30 min at 4 °C. SDS was added to the supernatant for a final concentration of 1%. The sample was then boiled at 95 °C for 5 min. Sample was cooled on ice and incubated with 35 μl of equilibrated anti-pyruvate carboxylase (5 μg; Abcam 110314) conjugated agarose beads (Pierce 20398) for four hours at 4 °C while rotating. Subsequently, the sample was centrifuged at 2,000 rpm for 5 min at 4 °C and the supernatant was incubated with 80 μl NeutrAvidin agarose at 4 °C overnight while rotating. The NeutrAvidin beads were then washed twice with 0.2% SDS, twice with wash buffer (1% Na deoxycholate, 1% Triton-X and 25 mM LiCl), twice with 1 M NaCl and five times with 50 mM ammonium bicarbonate. Proteins bound to the agarose were then eluted in elution buffer (5 mM biotin, 0.1% RapiGest SF surfactant and 50 mM ammonium bicarbonate) at 60 °C for a minimum of 2 h. The final protein concentration was measured by BCA.

Analysis of biotinylated proteins and bulk mouse tissue using mass spectrometry

Protein samples were subjected to reduction using 5 mM Tris (2-carboxyethyl) phosphine for 30 min, alkylated by 10 mM iodoacetamide for another 30 min and then digested sequentially with Lys-C and trypsin at a 1:100 protease-to-peptide ratio for 4 and 12 h, respectively. The digestion reaction was terminated by the addition of formic acid to 5% (v/v) with centrifugation. Each sample was then desalted with C18 tips (Thermo Fisher Scientific 87784) and dried in a SpeedVac vacuum concentrator. The peptide pellet was reconstituted in 5% formic acid before analysis by liquid chromatography–tandem mass spectrometry (LC–MS/MS).

Tryptic peptide mixtures were loaded onto a 25 cm long, 75 μm inner diameter fused-silica capillary, packed in-house with bulk 1.9 μM ReproSil-Pur beads with 120-Å pores. Peptides were analysed using a 140-min water–acetonitrile gradient delivered by a Dionex Ultimate 3000 UHPLC (Thermo Fisher Scientific), operated initially at a flow rate of 400 nl per min with 1% buffer B (acetonitrile solution with 3% dimethyl sulfoxide (DMSO) and 0.1% formic acid) and 99% buffer A (water solution with 3% DMSO and 0.1% formic acid). Buffer B was increased to 6% over 5 min, at which time the flow rate was reduced to 200 nl per min. A linear gradient from 6–28% B was applied to the column over the course of 123 min. The linear gradient of buffer B was then further increased to 28–35% for 8 min followed by a rapid ramp up to 85% for column washing. Eluted peptides were ionized using a Nimbus electrospray ionization source (Phoenix S&T) by application of a distal voltage of 2.2 kV.

The spectra were collected using data-dependent acquisition on an Orbitrap Fusion Lumos Tribrid mass spectrometer (Thermo Fisher Scientific) with an MS1 resolution of 120,000, followed by sequential MS2 scans at a resolution of 15,000. Data generated by LC–MS/MS were searched using the Andromeda search engine integrated into the MaxQuant bioinformatic pipelines against the Uniprot M. musculus reference proteome (UP000000589 9606) and then filtered using a ‘decoy’ database-estimated FDR < 1%. Label-free quantification (LFQ) was performed by integrating the total extracted ion chromatogram of peptide precursor ions from the MS1 scan. These LFQ intensity values were used for protein quantification across samples. Statistical analysis of differentially expressed proteins was done using the Bioconductor package ArtMS. To generate a list of proteins with high confidence, all mitochondrial proteins including carboxylases and dehydrogenases were manually filtered because they are artefacts of endogenously biotinylated proteins. Proteins with a log₂-transformed fold change (log₂FC) > 1 and FDR < 0.05 versus GFP controls were considered putative hits and used for subsequent comparisons between subcompartments and cell types. To account for variations in pull-down efficiency, all proteins and their LFQ values were normalized to pyruvate carboxylase (Uniprot ID Q05920). Downstream analysis was conducted only on proteins with non-zero LFQ values in three or more experimental replicates. Data analysis for whole bulk tissue analyses was performed identically, except that samples were normalized by median intensity. The gene ontology (GO) enrichment analysis for cellular compartments and biological function was performed using the PANTHER overrepresentation test (GO ontology database released 2020-01-01) with FDR < 0.05 with all M. musculus genes used as a reference, and with STRING (https://string-db.org/) with a confidence score of 0.5 and with all M. musculus genes used as a reference. The GO pathway analysis for the Crym-BioID2 interactome was done with Enrichr (https://maayanlab.cloud/Enrichr/).

Protein networks and protein–protein interaction analysis

Network figures were created using Cytoscape (v.3.8) with nodes corresponding to the gene name for proteins identified in the proteomic analysis. A list of protein–protein interactions from published datasets was assembled using STRING. In all networks, node size is proportional to the fold enrichment over GFP control. To identify interactors of µ-crystallin protein, Significance Analysis of INTeractome (SAINTexpress) was used with an FDR cut-off of 0.05. The Bioconductor artMS package was used to reformat the MaxQuant results to make them compatible with SAINTexpress.

PLA

The PLA detects native interacting proteins within about 40 nm of each other. Fixed-frozen tissue was processed as described in previous sections. Serial coronal sections (20 μm) containing striatum sparsely labelled with astrocyte-specific AAV2/5 GfaABC₁D-tdTomato were prepared using a cryostat microtome (Leica) at −20 °C and mounted immediately onto glass slides. PLAs were performed using the Sigma-Aldrich Duolink PLA fluorescence protocol (Sigma-Aldrich DUO92101 and DUO92013). Sections were baked for 30 min at 60 °C. Sections were washed for at least 15 min in 0.1 M PBS. After washing, sections were incubated in 1× citrate pH 6.0 antigen retrieval buffer (Sigma, C999) for 10 min at 90 °C. After washing three times in 0.2% Triton-X in PBS (PBS-T), the sections were blocked for 45 min at room temperature with 5% donkey serum (Sigma D9663) in PBS-T. Sections were then incubated with the following primary antibodies overnight at 4 °C: rabbit anti-USP9X (1:250, Proteintech 55054-1-AP); rabbit anti-MAPT (1:250, Thermo Fisher Scientific PA-10005); mouse anti-µ-crystallin (1:125, Santa Cruz sc-376687); and guinea pig anti-RFP (1:500; Synaptic Systems 390004). Sections were then incubated with PLA probe cocktail containing the anti-rabbit PLUS primer probe (DUO92002) and the anti-mouse MINUS primer probe (DUO92004) for 1 h at 37 °C. The sections were washed twice in 1× wash buffer A (DUO82049). Sections were then incubated with ligation solution containing ligase for 30 min at 37 °C. Sections were once again washed twice with 1× wash buffer A and then incubated with amplification solution containing DNA polymerase for at least 3 h at 37 °C. Sections were then washed twice in 1× wash buffer B (DUO82049) and then washed in 0.01× wash buffer B. To amplify the tdTomato signal, sections were then incubated with donkey anti-guinea pig Cy3 (1:500; Jackson ImmunoResearch 706-165-148) for 45 min at room temperature. Sections were washed twice with PBS and then coverslips were mounted with DuoLink mounting medium with DAPI (DUO82040). Images were obtained in the same way as for IHC (described above) with a step size of 1 μm. Images were processed using Image J (v.2.1). Astrocyte territories were identified from tdTomato fluorescence, and the number of puncta within each territory was measured. Two negative controls were performed. The first was the same experiment as described above, but for astrocytes located in the dorsolateral striatum that lack μ-crystallin. The second was an independent experiment without the anti-rabbit PLUS primer probe.

Statistical analysis

Statistical tests were run in OriginPro 2017 (OriginLab, v.9.4.2). Summary data are presented as mean ± s.e.m. Sample sizes were not determined in advance and were based on past studies that are cited at the relevant sections of the manuscript and methods. Statistical tests were chosen as described below. All replicates were biological, not technical. Blinding was not done. For each set of data to be compared, we used OriginPro to determine whether the data were normally distributed or not. If they were normally distributed, we used parametric tests. If the data were not normally distributed, we used non-parametric tests. Paired or unpaired Student’s t-test, Wilcoxon signed-rank test, or Mann–Whitney tests were used for statistical analyses with two samples (as appropriate). One-way ANOVA, two-way ANOVA or repeated two-way ANOVA tests followed by Tukey’s post-hoc test were used for statistical analyses with more than three samples. Significant differences were defined as P < 0.05 and are indicated as such throughout.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

[ad_2]

Source link

February 28, 2024
Multisensory gamma stimulation promotes glymphatic clearance of amyloid

[ad_1]

Mice

All animal experiments were conducted in accordance with National Institutes of Health (NIH) guidelines and were overseen by and adherent to the rules set forth by the Massachusetts Institute of Technology Institutional Animal Care and Use Committee. All of the animal holding rooms were maintained within temperature (18–26 °C) and humidity ranges (30–70%) described in the ILAR Guide for the Care and Use of Laboratory Animals (1996). Mice were housed in groups no larger than five on a standard 12 h–12 h light–dark cycle (lights on at 07:00; all experiments were performed during the light cycle). All efforts were made to keep animal usage to a minimum, and male and female mice were used. 5XFAD (Tg 6799) breeding pairs were acquired from the Mutant Mouse Resource and Research Center (MMRRC) (Jax 034848) and crossed with C57BL/6 J mice to generate offspring for this study. For experiments involving genetic manipulations of VIP⁺ interneurons, Vip^tm1(cre)Zjh/J (Jax 010908) were crossed to 5XFAD to generate VIP-Cre 5XFAD heterozygous mice. To determine the specificity and fidelity of the Cre expression in VIP-Cre mice, we used B6.Cg-Gt(ROSA)26Sor^{tm9(CAG-tdTomato)Hze}/J (Jax 007909) to indelibly label VIP interneurons with tdTomato and to generate Ai9/VIP-Cre 5XFAD triple transgenic mice. Since circadian rhythms and brain state are known to regulate glymphatic flux and AQP4 polarization²¹, all experimental groups were evaluated at consistent levels in the circadian cycle (~2–6 h after lights on).

Noninvasive multisensory stimulation

Multisensory stimulation was performed as described previously⁶. In brief, mice were moved from the vivarium and held in a quiet room. Following 1 h of habituation to the room, individual mice were placed in separate chambers. The chamber was illuminated by a light-emitting diode programmed to either 8 Hz (125 ms light on, 125 ms light off), 40 Hz (12.5 ms light on, 12.5 ms light off, 60 W), or 80 Hz. Speakers (AYL, AC-48073) were placed above the chambers and programmed to present a 10 kHz tone that was 1 ms in duration and delivered at 60 decibels tones at 8 Hz or tones at 40 Hz. The LED and speakers were programmed via a microcontroller (Teensy) such that the sensory input was delivered simultaneously (that is, stimulus pulses of each modality were aligned to the onset of each pulse).

Tissue collection and processing for immunohistochemistry

Following sensory stimulation or control, mice were given a lethal dose of anaesthetic (isoflurane overdose) then transcardially perfused with PBS (pH 7.4) with heparin (10 U ml⁻¹, Sigma H3149) followed by PBS with 4% paraformaldehyde (PFA) (Electron Microscopy Sciences 15710). Whole mounts of the dural meninges were prepared as described^11,24. Following perfusion, skull caps were removed, then placed in 4% PFA at 4 °C for 12 h. The dural meninges (dura mater and arachnoid) were peeled from the skull cap under a dissecting microscope using Dumont forceps (Fine Science Tools) then placed in a 24-well plate (VWR 10861-558) with PBS for immunohistochemistry. Deep cervical lymph nodes were dissected, fixed in 4% PFA for 16 h, then gently cleaned under a dissecting microscope to gently remove non-lymph node surrounding tissue. Lymph nodes were then dehydrated in 30% sucrose until the lymph nodes sank, embedded in OCT (Tissue-Tek), then frozen at −80 °C, then cut at 40 µm in a cryostat and mounted on SuperFrost slides. Immunohistochemistry was then conducted on slide-mounted tissue sections. Lymph node sections mounted on slides and treated for immunohistochemistry (described below). Brains were kept in 4% PFA for 18–24 h, then washed in PBS, the cut using a vibratome into 40 μm thick sections. Coronal brain sections were kept in PBS at 4 °C until preparation for immunohistochemistry.

Immunohistochemistry

Lymph nodes, coronal brain sections, and meninges were treated for immunohistochemistry using the following protocol. First, tissue was washed with PBS for 10 min, permeabilized with 0.3% Triton X-100 in PBS for 10 min, underwent blocking (5% normal donkey serum and 0.3% Triton X-100 in PBS) for 1 h at room temperature, and immunostained with the primary antibodies in blocking solution overnight. Following three 5-min washes with blocking buffer, we added secondary antibodies in blocking buffer for 2 h at room temperature, then washed with PBS five times for 5 min each. A list of antibodies are provided in Supplementary Table 1 (Supplementary Information). On the penultimate wash we used 1:1,000 Hoechst (Thermo Fisher Scientific, H3570). Tissue was mounted on SuperFrost slides and sealed with Prolong Gold mounting medium (Thermo Fisher Scientific, P36930).

Confocal microscopy

We used a Zeiss confocal 710, 880 or 900 for confocal microscopy. The same microscope was used for each imaging experiment, and identical imaging settings were used for all settings acquired by the blinded investigator. For quantification of amyloid in lymph node, we imaged regions of lymph node in draining regions based on CD31/LYVE1 staining and imaged at 425.10 µm² (1.204 pixels per µm), at 11 µm z-stacks at 2-µm step sizes. For quantification of amyloid in the prefrontal cortex, the region to be imaged was selected based on Hoechst reference and comparison with the mouse brain atlas, then we imaged a region of 319.45 µm² (3.2055 pixels per µm) using a 30 µm z-stack imaged at 1-µm step sizes. To ensure consistency and unbiased imaging by the blinded investigator, we used the Hoechst channel to set the upper and lower boundaries of each z-stack. Zeiss ZEN Blue (v3.3.89) (Carl Zeiss Microscopy) was used for image acquisition. For data analysis, Fiji image processing software (v1.54) (NIH) and Imaris (v9.1) (Oxford Instruments) were used.

Pharmacology

To modulate AQP4 function in mice, we used TGN020 (TargetMol T5102), administered 30 min prior to sensory stimulation (100 mg kg⁻¹, intraperitoneal injection). We used this dose based on prior literature suggesting a modulation of CSF distribution¹³. For experiments involving VIP, we used HSDAVFTDNYTRLRKQMAVKKYLNSILN (19113, Bachem); for VIP receptor agonists, we used acetyl-(d-Phe2,Lys15,Arg16,Leu27)-VIP (1–7)-GRF (8–27) (202463-00-1, Bachem), [Lys15, Arg16, Leu27]-VIP (1–7)-GRF (8–27) (064-24, Phoenix Pharmaceuticals); for VIP receptor antagonists, we used [d–p-Cl-Phe6,Leu17]-VIP (3054, Tocris). Peptides were aliquoted and stored at −20 °C.

Generation of AAV5-GFAP-EGFP-shAqp4 and AAV5-GFAP-EGFP-shLacZ

To selectively reduce AQP4 in astrocytes, we synthesized AAV delivering eGFP followed by miR30-based shRNA²⁶ targeting mouse Aqp4 under the astrocyte-specific GFAP promoter (AAV-EGFP-shAqp4). To broadly reduce AQP4 levels, we designed three target sequences for AQP4 knockdown. As a control, we designed AAV carrying eGFP with lacZ shRNA (AAV-EGFP-shLacZ). Oligonucleotides containing shAqp4 or shLacZ within miR30 backbone were synthesized (IDT), annealed, and cloned into pAAV.GFAP.eGFP.WPRE.hGH (Addgene plasmid #105549) using the NheI site. All constructs were assembled using standard cloning methods and confirmed by DNA sequencing. Plasmids expressing miR30-based shAqp4 or shLacZ was packaged into AAV5 (Janelia Viral Core). The sequence of oligonucleotides can be found in Supplementary Table 4.

Cranial windows

Anaesthesia was induced using isoflurane (induction, 3%; maintenance, 1–2%), ophthalmic ointment (Puralube Vet Ointment, Dechra) was applied to the eyes to prevent corneal drying, and metacam (1 mg kg⁻¹ intraperitoneal injection) and buprenorphine (0.05 mg kg⁻¹, subcutaneous injection) were administered as analgesics. Mice were placed in a stereotactic frame (Kopf Instruments) and a heating pad was used to maintain body temperature. Scalp fur was trimmed and treated with three alternating swabs of betadine and 70% ethanol. A small circular section of skin (~1 cm in diameter) was excised using surgical scissors (Fine Science Tools). The periosteum was bluntly dissected away and bupivacaine (0.05 ml, 5 mg ml⁻¹) was topically applied as a topical analgesic. A circular titanium headplate was attached to the skull using dental cement (C&B Metabond, Parkell), centred around prefrontal cortex (1.7 mm anterior to bregma, centred over the midline). Under a continuous gentle flow of PBS (137 mM NaCl, 27 mM KCl, 10 mM phosphate buffer), a ~ 4-mm circular section of the skull, slightly larger than the window, was removed using a 0.5-mm burr (Fine Science Tools) and a high-speed hand dental drill, taking great care not to compress brain tissue or damage dural tissue. Sugi swabs (John Weiss & Son) were used to absorb trace bleeding. A 3-mm glass coverslip (Warner Instruments) was gently placed over the brain. Veterinary adhesive (Vetbond, Fisher Scientific) was used to form a seal between the coverslip and the skull. A layer of Metabond was then applied for added durability. The mouse was then placed in a cage, half-on and half-off of a 37 °C heating pad, until it regained sternal recumbency. Metacam (1 mg kg⁻¹ intraperitoneal injection) was administered as an analgesic 24 h after surgery, and as needed thereafter. Mice were allowed 3–4 weeks of recovery before imaging.

Intracisterna magna cannulation

We followed previous reports in order to perform intracisterna magna cannulation⁵³. Mice were anaesthetized with isoflurane (3% induction, 1% maintenance), ophthalmic ointment (Puralube Vet Ointment, Dechra) was applied to the eyes, and the head and neck were shaved and sterilized with povidone-iodine (Dynarex) and 70% ethanol. 1 mg ml⁻¹ of bupivacaine was injected subcutaneously at the incision site and buprenorphine (0.05 mg kg⁻¹, subcutaneous injection) was administered for preemptive analgesics. The mouse was fixed in the stereotaxic frame (Knopf) by the zygomatic arch, and the head was titled to form a 120° angle with the body. The occipital crest was identified, the overlying skin (~1 cm) cut, and sterile forceps were used to pull apart the superficial connective tissue and neck muscles in an anterior-to-posterior direction to expose the cisterna magna, where the cerebellum and medulla were visible behind the translucent dural membrane. A cotton swab (Sugi) was used to dry the dural membrane and a 30 G needle prepared prior to surgery fixed with PE10 tubing (Polyethylene Tubing 0.024” OD x 0.011” ID, BD Intramedic) and filled with fresh artificial CSF (ACSF) (126 mM NaCl, 2.5 mM KCl, 1.25 mM NaH₂PO₄, 2 mM MgSO₄, 2 mM CaCl₂, 10 mM glucose, 26 mM NaHCO₃) was carefully inserted through the dural membrane, carefully avoiding damage to the cerebellum and medulla. Trace CSF leak was dried using sterile cotton swabs (Sugi), and cyanoacrylate glue (Loctite) was used to secure the cannula into the dural membrane and glue accelerator was applied to cure the glue. The needle was then secured in place using dental cement (Parkell) and a handheld cauterizer (Fine Science Tools) was used to seal the tubing. The mouse was then placed in a cage, half-on and half-off of a 37° heating pad, until it regained sternal recumbency. Following recovery from cannulation, CSF tracer infusion and awake stimulation was conducted.

Awake in vivo two-photon imaging

Mice were head-fixed to a custom titanium head fork using no. 0-80 screws. The head-fixed mouse was positioned over a 3D printed running wheel covered in waterproof neoprene foam. Mice quickly learned to run or quietly rest (motionlessly) while in a head-fixed position. We habituated mice to gentle handling and this head-fixed position for 3 days prior to imaging experiments to avoid motion artefacts during the experiment. Prior to imaging, and while the mouse was head-fixed, the cranial window was gently cleaned using a cotton-tipped swab and a small ~1 ml dollop of Aquasonic Clear Ultrasound Transmission Gel (Parker) was placed over the cranial window. Two-photon microscopy images were acquired using an Olympus FVMPE-RS microscope. A low magnification image was acquired to facilitate returning to the same imaging site over time, and high-resolution, high numerical aperture imaging was used to acquire experimental data.

Two-photon imaging of CSF tracer

Mice had received a cranial window (3 weeks prior) and intracisterna magna implant (~3 h prior) and habituated to awake head-fixed imaging. We prepared fluorescent CSF tracer (fluorescein-conjugated dextran, 3 kD, Invitrogen D3306), formulated to a 0.5% solution in ACSF (126 mM NaCl, 2.5 mM KCl, 1.25 mM NaH₂PO₄, 2 mM MgSO₄, 2 mM CaCl₂, 10 mM glucose, 26 mM NaHCO₃). We infused 10 µl of tracer via a cisterna cannula into awake mice at a rate of 1 μl min⁻¹ for 10 min with a syringe pump (WPI), a rate we chose based on prior reports^11,22, sealed the tube using a handheld cauterizer (Fine Science Tools, 18010-00), and placed mice in a chamber for 1 h of noninvasive multisensory stimulation or control. Following 1 h of stimulation, mice were head-fixed and positioned under the objective. To visualize tracer movement from the cisternal compartments into the brain parenchyma, we used a Spectra-Physics InsightX3 DeepSee laser tuned to 920 nm to visualize CSF tracer (labelled by fluorescein dextran) and blood vessels (labelled via retroorbital injection of Texas Red–dextran 70 kD injected prior to the experiment). Fluorescence was collected using a 25×, 1.05 numerical aperture water immersion objective with a 2-mm working distance (Olympus), and signal was detected through gallium arsenide phosphide photomultiplier tubes using the Fluoview acquisition software (Olympus). We simultaneously acquired images in the red channel (bandpass filter 575–645 nm) to visualize vascular arbors and in the green channel (bandpass filter 495–540 nm) for CSF tracer. We imaged z-stacks using a galvano scanner (z-stacks were 200 µm from the cortical surface, imaged at 2-µm step sizes; the imaging rate was set to 2.0 µs per pixel for the 512 × 512 pixel region, covering ~509.117 µm²). Three areas were imaged per mouse. Tracer influx was quantified by a blinded investigator using ImageJ and Imaris, and an average fluorescence intensity was calculated between z-stacks and normalized to non-treated mice.

Ex vivo fluorescence imaging of CSF tracer

Fluorescent CSF tracer (OVA-647; 45 kDa; O34784, Invitrogen) was formulated to a 0.5% solution in ACSF (126 mM NaCl, 2.5 mM KCl, 1.25 mM NaH₂PO₄, 2 mM MgSO₄, 2 mM CaCl₂, 10 mM glucose, 26 mM NaHCO₃). We infused 10 µl of tracer via a cisterna cannula into awake mice at a rate of 1 μl min⁻¹ for 10 min with a syringe pump (WPI), a rate we chose based on prior reports suggesting that this method only maintains intracranial pressure following infusion^11,22. To maintain intracranial pressure following infusion, we sealed the tube using a handheld cauterizer (Fine Science Tools, 18010-00). We then placed mice in a chamber for 1 h of noninvasive multisensory stimulation or control and 1 h of recovery. Since death is associated with the collapse of paravascular space and non-physiological influx of CSF²³, we sought to avoid this potential confound entirely, so mice were euthanized within 60 s of the end of the experiment via isoflurane overdose, decapitated, and brain was fixed overnight by immersion in 4% paraformaldehyde in PBS at 4 °C with gentle rotation. To visualize tracer movement from the cisternal compartments into the brain parenchyma, we sliced brain sections at 100 µm using a vibratome (Leica) and imaged fluorescence on a Zeiss 880 confocal microscope (425.1 µm² imaging region; 1.2044 pixels per µm). Tracer influx was quantified by a blinded investigator using ImageJ. The cerebral cortex in each slice was manually outlined, and the mean fluorescence intensity within the cortical regions of interest was measured. An average of fluorescence intensity was calculated between six slices for a single mouse, resulting in a single biological replicate. Equivalent coronal brain slices were used for all biological replicates.

Two-photon imaging of arteriole pulsation

To image arterial pulsation, we labelled vasculature using Texas Red–dextran 70 kD via retroorbital injection prior to the experiment. Mice previously fixed with a cranial window had been habituated to head fixation under the two-photon imaging apparatus for awake imaging. We used a Spectra-Physics InsightX3 DeepSee laser tuned to 920 nm. Fluorescence was collected using a 25×, 1.05 numerical aperture water immersion objective with a 2-mm working distance (Olympus), and signal was detected through gallium arsenide phosphide photomultiplier tubes using the Fluoview acquisition software (Olympus). We acquired images in the red channel (bandpass filter 575–645 nm) for blood plasma. In a subset of experiments, we also acquired images in the green channel (bandpass filter 495–540 nm) for microglia, and movement in the green channel was used for motion artefact detection and were easily detected. We used a resonance scanner to acquire time series of arterial pulsatility in awake mice. A single recording was 328.90 s and covered an area of 160.7 µm² at a rate of 0.067 ms per pixel and 0.127 ms per line; in total, 5,000 frames were recorded at an imaging rate of 65.779 ms per frame. We validated the absence of motion artefact in our analysis based on the absence of vessel change in venous segments obtained in the same imaging areas as the arterial segments, as well as by using the soma of microglia in CX3CR1 5XFAD mice. To avoid subtle xy changes in motion, we used the phase correlation rigid registration method implemented in suite2p, using the microglia channel to align the vascular channel. To quantify arterial pulsatility, we used a perpendicular segment of the artery binarized using ImageJ, and the diameter segment was quantified using Python: first, a savgol filter (window size 7, polynomial order 5) was applied to the vasomotion trace, and peaks were identified using find_peaks.

Two-photon microscopy interstitial efflux assay by laser ablation

To image ISF efflux by laser ablation, we recorded vascular segments spanning an area of 169.706 µm². For baseline imaging, we imaged at a rate of 65.779 ms per frame, 0.067 ms per pixel, 0.127 ms per line for 5,000 frames at a rate of 65.779 ms per frame. We imaged vascular beds using Spectra-Physics InsightX3 DeepSee laser tuned to 920 nm (IR laser power set at 2.22 W, and imaged using ~3.5–4.5% transmissivity). To induce ablation, we used a second two-photon laser (Mai Tai DeeSee) laser tuned to 800 nm (IR laser power at 2.79 W and transmissivity at 20–30%). Next, we induced an ellipsis region of interest for stimulation, drawn along a vascular segment approximately 3 µm in diameter. We induced stimulation using the following settings: 80 μs per pixel, 3.20 μs per line, for a total of 100 ms. Following successful ablation, a bolus of dextran was removed, and we used the InsightX3 to continue imaging to monitor the efflux and diffusion of the extravasted dextran (imaging for 328.90 s, covering an area of 160.7 µm² at 65.779 ms per frame for 5,000 frames). In pilot experiments to validate the reperfusion of blood vessels following focal ablation, we used line scans of blood vessels perfused and volumetric scans of the surrounding vascular area, using single line scans in the central lumen of along 15 µm for a capillary segment. Space-time scans were acquired using one-way galvano scanning, and the line speed was 1.989 μm per pixel for 5.7 s (5,000 frames). We performed this assay in three areas per mouse following gamma stimulation, and quantified the rate of efflux by quantifying the ratio of the extravasted dextran signal intensity at the peak of the extravasation and the end of the diffusion period, using identical distances between vascular segments between both treatment groups.

EMG and EEG data acquisition and analysis

Electroencephalogram (EEG) and electromyography (EMG) implants were installed in 6-month-old 5XFAD mice under isoflurane anaesthesia as described⁵⁴. For analysis of sleep architecture based on EEG and EMG recordings, all mice were included. All mice implanted for electrophysiological recordings were housed individually in open cages before surgery and in individually ventilated cages during a recovery period of about 1 week after surgery. For sleep recordings, mice were transferred to separate custom-made Plexiglas cages (20.3 × 32 × 35 cm), which were placed in sound-attenuated and light-controlled Faraday chambers (Campden Instruments), with each chamber fitting two cages. Mice were allowed free access to food pellets and water at all times and underwent daily health inspection. After an acclimatization period of at least 3 days, during which mice were habituated to the tethered recording conditions, a period of continuous recording starting at light onset was performed on a designated baseline day. On the subsequent day, all mice received either no stimulation, 40 Hz noninvasive multisensory stimulation, or 8 Hz noninvasive multisensory stimulation conditions (see ‘Noninvasive multisensory stimulation’) and were recorded for the entire 1-h stimulation period and the entire 1 h of post-stimulation. Recordings between groups were conducted at the same time of day because circadian rhythms affect glymphatic clearance²¹. EMG and EEG data were acquired using Synapse (Tucker–Davis Technologies) and continuously recorded, filtered between 0.1 and 100 Hz, and stored at a sampling rate of 305 Hz. EEG and EMG signals were resampled at a sampling rate of 256 Hz using custom code in MATLAB (MathWorks, v2017a). Sirenia Sleep Pro (v2.2.1, Pinacle Technology) was used for sleep scoring. EEG and EMG recordings were partitioned into epochs of 4 s. Vigilance states were assigned manually to each recording epoch based on visual inspection of the frontal and occipital EEG derivations in conjunction with the EMG. Epochs with recording artefacts due to gross movements, chewing or external electrostatic noise were assigned to the respective vigilance state but not included in the electrophysiological analysis. Overall, 18.8% ± 3.5% of wake, 0.7% ± 0.4% of NREM and 0.9% ± 0.4% of REM epochs contained artefactual EEG signals across all mice included in the EEG spectral analysis, with no significant difference between stimulation conditions. EEG and LFP power spectra were computed using a fast Fourier transform routine (Hanning window) with a 0.25-Hz resolution.

Behaviour

The novel object recognition task consisted of a habituation phase followed by training and testing, as used in our lab previously⁶. Mice were habituated in an open field testing box for 10 min on 3 consecutive days. On the fourth day, 2 identical wooden blocks (Premium wooden building blocks set, Cubbie Lee) were placed in the chamber, and mice were allowed to explore the objects for 10 min, then the mice were returned to their home cage. Twenty-four hours later in the test phase, one of the wooden blocks was switched to a novel wooden block with a different shape, and the time spent exploring the familiar and new objects was measured for 10 min. Discrimination index was calculated as time spent to explore the new object divided by the sum of time spent to explore both old and new object by a recognition index. EthoVision (XT 14) (Noldus) was used for behaviour tracking.

Expansion microscopy

Forty-micrometre coronal brain sections fixed in 4% PFA were expanded according to protein expansion protocols. In brief, after immunolabelling with anti-AQP4 and anti-eNOS, samples were treated with AcX overnight, gelled for 2 h at 37 °C, and digested with proteinase K overnight. After expansion, samples were imaged using a glass bottom plate (Cellvis, P06-1.5H-N) and imaged using an inverted Zeiss LSM 710 confocal microscope.

Electron microscopy

Perfused brains were in 4% PFA in PBS and post fixed in 4% PFA in PB overnight at 4 °C. Sections were then washed in 0.02 M glycine for 15 min. Brains were cut at 40 µm using a vibratome, then permeabilized in 0.1% Triton X-100, blocked in 1% BSA, and incubated with rabbit-anti-AQP4 overnight at 4 °C. Preparation was completed at the Harvard Electron Microscopy Core. For epon embedding, 0.5% osmium was added for 30 min, washed in water, then dehydrated using ethanol. Propyleneoxide was used and infiltrated in propyleneoxide and TAAB Epon overnight. Sections were flat embedded between two sheets of Aclar in fresh TAAB Epon, then polymerized at 60 °C for 48 h. Ultrathin sections (~60 nm) were cut on a Reichert Ultracut-S microtome, picked up on to copper grids stained with 0.2% lead citrate and examined in a JEOL 1200EX Transmission electron microscope. Images were recorded with an AMT 2k CCD camera.

AQP4 polarization analysis

We used established methods to quantify AQP4 polarization^12,21. We found that AQP4 labelled astrocytic endfeet that ensheathed blood vessels as well as surrounding parenchyma. AQP4 segments were selected on confocal z-stack projections, then marked cross-sectionally using the line plot tool in ImageJ to include AQP4 signal from vascular endfeet and from the surrounding parenchyma. The ratio of AQP4 signal from endfeet to parenchyma fluorescence intensity ratio was used as a measure of AQP4 polarization.

Isolation of single nuclei for snRNA-seq

The protocol for the isolation of nuclei from frozen post-mortem brain tissue was adapted from a previous study⁵⁵. All procedures were carried out on ice. Following 1 h of gamma stimulation or control and 1 h of rest, cortices were dissected and snap frozen in liquid nitrogen and stored at −80 °C. Then, 3 mouse cortices were pooled per sample (4 samples per condition) and homogenized in 1 ml homogenization buffer (320 mM sucrose, 5 mM CaCl₂, 3 mM Mg(CH₃COO)₂, 10 mM Tris HCl pH 7.8, 0.1 mM EDTA pH 8.0, 0.1% IGEPAL CA-630, 1 mM β-mercaptoethanol, and 0.4 U µl⁻¹ recombinant RNase inhibitor (Clontech)) using a Wheaton Dounce tissue grinder (15 strokes with the tight pestle). The homogenized tissue was filtered through a 40-μm cell strainer, mixed with an equal volume of working solution (50% OptiPrep density gradient medium (Sigma-Aldrich), 5 mM CaCl₂, 3 mM Mg(CH₃COO)₂, 10 mM Tris HCl pH 7.8, 0.1 mM EDTA pH 8.0, and 1 mM β-mercaptoethanol) and loaded on top of an OptiPrep density gradient (29% OptiPrep solution (29% OptiPrep density gradient medium,134 mM sucrose, 5 mM CaCl₂, 3 mM Mg(CH₃COO)₂, 10 mM Tris HCl pH 7.8, 0.1 mM EDTA pH 8.0, 1 mM β-mercaptoethanol, 0.04% IGEPAL CA-630, and 0.17 U µl⁻¹ recombinant RNase inhibitor)) on top of 35% OptiPrep solution (35% OptiPrep density gradient medium, 96 mM sucrose, 5 mM CaCl₂, 3 mM Mg(CH₃COO)₂, 10 mM Tris HCl pH 7.8, 0.1 mM EDTA pH 8.0, 1 mM β-mercaptoethanol, 0.03% IGEPAL CA-630, and 0.12 U µl⁻¹ recombinant RNase inhibitor). The nuclei were separated by ultracentrifugation using an SW32 rotor (5 min, 10,000g, 4 °C). Nuclei were collected from the 29%–35% interphase, washed with PBS containing 0.04% BSA, centrifuged at 300g for 3 min (4 °C) and washed with 1 ml of PBS containing 1% BSA. The nuclei were counted and diluted to a concentration of 1,000 nuclei per μl in PBS containing 1% BSA. Libraries were prepared using the Chromium Single Cell 3′ Reagent Kits v.3.1 (Dual Index) according to the manufacturer’s protocol (10X Genomics). The generated scRNA-seq libraries were sequenced using NextSeq 500/550 High Output (150 cycles).

Analysis of droplet-based snRNA-seq data

Raw reads were aligned to the mouse genome and the gene counts were estimated by CellRanger software (v3.0) (10X Genomics)⁵⁶. Seurat (v4.0.3) was used for downstream analysis⁵⁷. Cells with more than 500 protein-coding genes with detected unique molecular identifiers from protein-coding genes were selected for further analysis. We also use the ratio of mitochondrial genes to measure the quality of cells (cells with higher than 5% were removed). We used DoubletFinder to remove the potential doublets from snRNA-seq data. The top 2,000 highly variable genes were used for principal component analysis. The first 30 principal components were used for non-linear dimensionality reduction (UMAP) for visualization. FindMarkers function in Seurat was used to identify marker genes for each cluster and each cell type, and DEGs between mice receiving gamma stimulation or no stimulation control. For DEG analysis, the cut-off used in the function FindMarkers in Seurat was: min.pct: 0.25, only test genes that are detected in a minimum fraction of min.pct cells in either of the two populations; logfc.threshold: 0.25. Enrichr was used to perform the Gene Ontology enrichment analysis⁵⁸ with P value < 0.05 as a cut-off. Negative log₁₀-transformed P value was used for visualization by heat map with the selected representative terms based on the diverse functional categories. A list of DEGs are available in Supplementary Table 3 (Supplementary Information)

RNA extraction and qPCR with reverse traancription

Following 1 h of gamma stimulation or control and 1 h of rest, cortices were dissected and snap frozen in liquid nitrogen and stored at −80 °C. Total RNA was extracted using TRIzol (Invitrogen) according to the manufacturer’s instructions. Reverse transcription of total RNA was carried out using RNA to cDNA EcoDry Premix (Clontech) according to the manufacturer’s protocol. qPCR was performed using a Bio-Rad CFX-96 quantitative thermocycler and SsoFast EvaGreen Supermix (Bio-Rad). Relative changes in gene expression were determined using the 2^−ΔΔCt method. Primer sequences used for qPCR can be found in Supplementary Table 2.

RNA in situ hybridization

We used RNAscope for fluorescence in situ hybridization following the manufacturer’s protocol. The probes we used are listed in the appropriate figure legends. Tissue was prepared as in the section above describing tissue preparation with the following deviation. Following overnight fixation at 4 °C in 4% PFA in PBS, brains were cryopreserved using 30% sucrose and cut at 40 µm using a cryostat (Leica). Coronal brain sections were preserved at −80 °C until the RNAscope experiment was conducted.

Peptide sensor design

We used a sequence analogous to another G-protein-coupled-receptor-based sensor⁴¹. We replaced the third intracellular loop of the VPAC1 module with a cpGFP module from the genetically encoded calcium indicator GCaMP6 using linker sequences (LSSLI-cpGFP-NHDQL). The linker sequences to the VIP sensor were designed using SnapGene. To generate AAV, we used Janelia Virus Core. For imaging VIP sensor in HeLa cells and mouse neuronal culture, we used wide-field fluorescence imaging using epifluorescence inverted microscope (Eclipse Ti-E, Nikon) equipped with a Photometrics QuantEM 512SC camera and a 75 W Nikon xenon lamp or a Zyla5.5 sCMOS camera (Andor) and a SPECTRA X light engine (Lumencor). NIS-Elements Advanced Research (Nikon) was used for automated microscope and camera control. Cells were imaged with a 60× NA1.49 oil or 20× NA0.75 air objective lenses (Nikon) at room temperature. For dual-colour imaging with miRFP, NIR (650/60 nm excitation and 720/50 nm emission) and green (490/15 nm excitation and 525/50 nm emission) filter sets were rotated into the emission light path. The GRABVIP1.0 sensor was provided by Y. Li. HEK293T cells (Invitrogen) cultured in Dulbecco’s modified Eagle’s medium (Gibco) with 10% fetal bovine serum (FBS, YEASEN Biotech) were seeded on 15 mm cover glasses (Wuxi NEST Biotech) coated with Matrigel (Millipore) and incubated at 37 °C with 5% CO₂ for 24 h before transfection. Cells were transfected with liposomal methods according to the manufacturer’s protocol (Hieff Trans, YEASEN Biotech). HEK293T cells were imaged 24 h post-transfection by an inverted wide-field Nikon Eclipse Ti2 microscope equipped with a SPECTRA III light engine (Lumencor) and an Orca Flash4.0v3 camera (Hamamatsu), controlled by NIS-Elements AR software and using a 20× 0.75 NA objective lens. Cells were imaged in the Tyrode buffer (150 mM NaCl, 4 mM KCl, 2 mM MgCl₂, 2 mM CaCl₂, 10 mM glucose and 10 mM HEPES at pH 7.35). The stock solutions of neuropeptides including CCK-4s (lot no. ab141328, Abcam), SST-14 (lot no. SP-50401-1, Alpha Diagnostic), SST-28 (lot no. SP-52221-1, Alpha Diagnostic), NPY (lot no. ab120208-500 µg, Abcam), PACAP (lot no. HY-P0176A, MedChemExpress), VIP (lot no. B6079-1, Tocris) were dissolved in water, except for CCK-8s (lot no. ab120208-1 mg, Abcam) dissolving in 0.1% NH₄OH. The working concentration of corresponding neuropeptides was 1 µM in Tyrode buffer. These neuropeptides were administrated to transfected cells via manual addition or replacing the medium with the diluted buffer using custom build perfusion system. Hippocampal neurons were prepared from postnatal day 0–1 C57BL/6 J mouse pups as described. In brief, the hippocampi were dissected in HBSS and digested with 0.25% Trypsin (Yeason) at 37 °C for 12 min. After digestion, the hippocampi were washed three times with plating culture medium (90% advanced MEM + 10% FBS) and then aspirated to dissociate the neurons. The dissociated neurons were plated at a density of 80,000 per 12-mm glass coverslip coated with Matrigel (Corning 356234) in 24-well plate. The next day, the culture medium was half replaced with NeuroBasal Medium supplemented with 1% GlutaMAX and 2% B27. AraC (0.002 mM, Sigma) was added when glia density reached 50–70% confluence. At DIV5-6, neurons were transfected with pAAV-Syn-GRABVIP1.0 or plasmid (1 µg per well) using a commercially available calcium phosphate transfection kit (Life Technologies). At DIV 12–15, fluorescence imaging was performed on an inverted wide-field Nikon Eclipse Ti2 microscope equipped with a SPECTRA III light engine and Orca Flash4.0v3 camera (Hamamatsu), using a 20×, 0.75 NA objective lens. Neurons were incubated in the extracellular solution containing: 150 mM NaCl, 4 mM KCl, 2 mM MgCl₂, 2 mM CaCl₂, 10 mM glucose and 10 mM HEPES at pH 7.35. VIP stock solution were diluted with extracellular solution and applied manually using pipette.

Retroorbital injection for AAV.PHP.EB injections

Mice were anaesthetized by intraperitoneal injection with ketamine-xylazine. The virus was diluted in 100 μl sterile saline and administered in the sinus behind the eye. Following the injection, Puralube was administered and mice were kept at 37 °C until they regained sternal recumbency. Virus was allowed to express for at least 3 weeks.

Slice preparation and electrophysiological recordings

Six-month-old VIP-Cre 5XFAD mice previously injected with PHPeB-AAV-Syn-DIO-hM4Di-mCherry were deeply anaesthetized with sodium pentobarbital (200 mg kg⁻¹, intraperitoneal injection) and then were decapitated. Brains were quickly removed and placed in an oxygenated ice-cold cutting solution containing (in mM): 2.5 KCl, 1.25 NaH₂PO₄•H₂O, 20 HEPES, 2 thiourea, 5 sodium ascorbate, 3 sodium pyruvate, 92 N-methyl-d-glucamine, 30 NaHCO₃, 25 d-glucose, 0.5 CaCl₂•2H₂O and 10 MgSO₄•7H₂O. Brain slices (180 μm, coronal section) were made using a Leica VT1000S vibratome (Leica Biosystems). Brain slices were incubated in oxygenated cutting solution at 34 °C for 20 min to recover. After recovery, slices were transferred into oxygenated ACSF at room temperature (24 °C) for recording. ACSF solution contains (in mM): 125 NaCl, 2.5 KCl, 1.2 NaH₂PO₄, 1.2 MgCl₂.6H₂O, 2.4 CaCl₂•2H₂O, 26 NaHCO₃ and 11 d-glucose. A single slice was transferred into a recording chamber and continually superfused with oxygenated ACSF. Cells were visualized using infrared differential interference contrast (IR-DIC) imaging on an Olympus BX-50WI microscope. Action potentials were recorded at 32 °C using the whole-cell current clamp configuration of a patch-clamp amplifier (Multiclamp 700B; Molecular Devices). Action potentials were obtained by a gap-free acquisition mode using Clampex software (Molecular Devices). Signals were filtered at 1 kHz using the amplifier’s four-pole, low-pass Bessel filter, digitized at 10 kHz with a Digidata 1550B interface (Molecular Devices) and stored on a personal computer. Pipette solution contained (in mM) 121 KCl, 4 MgCl₂•6H₂O, 11 EGTA, 1 CaCl₂•2H₂O, 10 HEPES, 0.2 GTP, and 4 ATP. CNO was applied via bath perfusion.

iBBB culture

The in vitro blood–brain barrier (iBBB) cultures were created and maintained as described⁵⁹. The iBBB consisted of a co-culture of human astrocytes, endothelial cells, and pericytes co-encapsulated in hydrogel and cultured for two weeks prior to analysis (additional details are available in Supplementary Information) Following iBBB differentiation and culture, VIP receptor agonist was added and 24 h later, cultures were fixed using 4% PFA and imaged using immunohistochemistry using antibodies against human CD31 (also known as PECAM-1) (sheep, R&D systems, AF806) and AQP4 (rabbit, Thermo Fisher, PA5-53234).

Software

The following software was used to collect the data in this study: Olympus Fluoview (FV31-S, 2.3.1.163) (Olympus); Zeiss ZEN Blue (v3.3.89) (Carl Zeiss Microscopy); EthoVision (XT 14) (Noldus). The following software was used to analyse the data in this study: Fiji image processing software (v1.54) (NIH); Prism (v9.2) (Graph Pad); Python (v3.9); CellRanger (v3.0) (10X Genomics); Seurat (v4.0.3); Imaris (v9.1) (Oxford Instruments).

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

[ad_2]

Source link

February 28, 2024