Cryoelectron microscopy – Page 4

Structural insights into the cross-exon to cross-intron spliceosome switch

[ad_1]

MS2 affinity selection of CE complexes

HeLa S3 cells were obtained from the Helmholtz Zentrum für Infektionsforschung, Braunschweig and tested negative for mycoplasma. Cells were not authenticated. HeLa nuclear extracts were prepared according to a previously published method²⁷ and were dialysed twice for 2.5 h against 50 volumes of Roeder D buffer (20 mM HEPES-KOH, pH 7.9, 0.2 mM EDTA, pH 8.0, 1.5 mM MgCl₂, 100 mM KCl, 10% (v/v) glycerol, 0.5 mM DTT and 0.5 mM PMSF). For both pre-B and B-like complexes, 10 nM m⁷G(5′)ppp(5′)G-capped MINX exon RNA containing 3 MS2 aptamers at its 3′ end⁷ was pre-incubated with 100 nM MS2–MBP fusion protein for 40 min on ice before addition to the splicing reaction. Splicing reactions were carried out at 30 °C with 50% (v/v) nuclear extract in splicing buffer (1.5 mM MgCl₂, 65 mM KCl, 20 mM HEPES-KOH pH 7.9, 2 mM ATP and 20 mM creatine phosphate). For pre-B complexes, splicing was performed for 20 min. To obtain B-like complexes, a 100-fold molar excess of a 5′ss oligo (5′-AAG/GUAAGUAU-3′, where / indicates the exon–intron boundary) was added after allowing pre-B complex formation, and the reaction was incubated for an additional 10 min at 30 °C. Splicing reactions were then chilled on ice for 10 min, centrifuged 15 min at 18,000g to remove aggregates and loaded onto a MBP Trap HP column (GE Healthcare). The column was washed with G-75 buffer (20 mM HEPES-KOH pH 7.9, 1.5 mM MgCl₂ and 75 mM NaCl) and complexes were eluted with G-75 buffer containing 15 mM maltose. Eluted complexes were loaded onto a linear 10–30% (v/v) glycerol gradient prepared in G-75 buffer, centrifuged at 17,500 r.p.m. for 18 h at 4 °C in a TST41.14 rotor (Thermo Fisher Scientific), and fractions were collected from the bottom of the gradient. RNA from complexes in peak gradient fractions was separated on a denaturing 4–12% NuPAGE gel (Life Technologies) and visualized by staining with SYBR Gold (Thermo Fisher Scientific). For cryo-EM analysis, eluted complexes were subjected to gradient fixation (GRAFIX)²⁸ and further processed as described below.

Add-back experiments using purified pre-B

CE pre-B complexes were MS2 affinity-purified as described above. To obtain pre-B^5′ss complexes, affinity-purified complexes were subsequently incubated for 10 min at 0 °C or 30 °C with a 100-fold molar excess of the 5′ss oligo alone. To generate pre-B^{5′ss+ATP/ATPγS} complexes, after incubation with the 5′ss oligo at 0 °C, complexes were subsequently incubated for 30 min at 30 °C after addition of 2 mM ATP or ATPγS. To generate pre-B^{5′ssLNG+ATPγS} complexes, purified pre-B complexes were incubated with a 100-fold molar excess of an elongated 5′ss oligo (5′-AAG/GUAAGUAUCGUUCCAA-3′) for 10 min at 0 °C, followed by the addition of 2 mM ATPγS and incubation for an additional 30 min at 30 °C. To obtain pre-B^ATP or pre-B^AMPPNP complexes, affinity-purified pre-B complexes were incubated with 2 mM ATP or AMPPNP, respectively, for 30 min at 30 °C. All complexes were then loaded onto a linear 10–30% (v/v) glycerol gradient prepared in G-75 buffer, and centrifuged and analysed as described above. For cryo-EM analyses, eluted complexes were subjected to gradient fixation (GRAFIX) and further processed as described below.

Western blotting

For western blot analysis of purified pre-B, pre-B^5′ss, pre-B^5′ss+ATP and pre-B^ATP complexes, 200 fmoles of each complex was separated on 4–12% NuPAGE gels and transferred to a Hybond P membrane. Membranes were first blocked with 5% milk in 1× TBS-T buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl and 0.1% Tween 20) and then incubated with rabbit antibodies against human phospho-PRP6 (1:1,000 dilution) and phospho-PRP31 (1:500 dilution), followed by antibodies against human SF3B1 (1:700 dilution), PRP31 (1:500 dilution) and PRP6 (1:1,000 dilution; AB99292, Abcam). Subsequent to incubation with the primary antibodies, membranes were washed with TBS-T buffer and incubated with HRP-conjugated goat anti-rabbit IgG (1:30,000 dilution; 111-035-144, Jackson Immunoresearch). After washing, membranes were immunostained using an enhanced chemiluminescence detection kit (GE Healthcare) and the signal was visualized using an Amersham Imager 680.

Protein–protein crosslinking

CE pre-B complexes were MS2 affinity-purified as described above with the following modifications: after affinity purification, eluted complexes were crosslinked with 400 μM BS3 for 45 min at 18 °C in a total volume of 1.4 ml. Crosslinked complexes were loaded onto a linear 10–30% (v/v) glycerol gradient and subjected to centrifugation at 17,500 r.p.m. for 18 h at 2 °C in a TST41.14 rotor. Four peak fractions containing dimeric pre-B complexes were pooled and ultracentrifuged in a S100-AT4 rotor (Thermo Fisher Scientific). The pelleted, crosslinked dimeric CE pre-B complexes (approximately 20 pmol) were dissolved in 50 mM ammonium bicarbonate buffer containing 4 M urea, reduced with dithiothreitol, alkylated with iodoacetamide and, after diluting the urea to 1 M, in-solution digested with trypsin. Peptides were reverse-phase extracted using Sep-Pak Vac tC18 1cc cartridges (Waters), lyophilized and subsequently dissolved in 40 µl 2% acetonitrile (ACN) and 20 mM ammonium hydroxide. Peptides were separated on an xBridge C18 3.5 µm 1 × 150 mm reverse-phase column (Waters) using a 4–48% gradient of ACN in 10 mM ammonium hydroxide over 45 min at a flow rate of 60 µl min^–1. One-minute fractions of 60 µl were collected, pooled in a step of 12 min (resulting in 12 pooled fractions in total), vacuum dried and dissolved in 5% ACN and 0.1% trifluoroacetic acid (TFA) for subsequent uHPLC-ESI–MS/MS analysis that was performed in triplicate on an Orbitrap Exploris 480 (Thermo Scientific). The mass spectrometer was coupled to a Dionex UltiMate 3000 uHPLC system (Thermo Scientific) with a custom 35 cm C18 column (75 µm inner diameter packed with ReproSil-Pur 120 C18-AQ beads, 3 µm pore size (Dr. Maisch)). The MS1 and MS2 resolutions were set to 120,000 and 30,000, respectively. Only precursors with a charge state of 3–8 were selected for MS2. MS data were acquired using Thermo Scientific Xcalibur (v.4.4.16.14) software.

B-like complexes were MS2 affinity-purified as described above with the following modifications: after affinity purification, eluted spliceosomal complexes were crosslinked with 350 μM BS3 for 30 min at 18 °C in a total volume of 2 ml. Crosslinked complexes were loaded onto a linear 10–30% (v/v) glycerol gradient and subjected to centrifugation at 21,000 r.p.m. for 12 h at 2 °C in a TST41.14 rotor. Peak fractions containing dimeric B-like complexes (about 12 pmol) were pooled, pelleted, digested and the peptides were reverse-extracted as described above for the pre-B complexes. Peptides were fractionated by gel filtration using a Superdex Peptide PC3.2/30 column (GE Healthcare) in 30% ACN and 0.1% TFA. Fifty-microlitre fractions corresponding to an elution volume of 1.2–1.8 ml were analysed in duplicate on a Thermo Scientific Orbitrap Fusion Lumos Tribrid mass spectrometer coupled to Ultimate 3000 uHPLC (Thermo Scientific). MS data acquisition was performed using Thermo Scientific Xcalibur (v.4.5.445.18) software.

The protein composition of the spliceosomal complexes was determined in a search with MaxQuant (v.2.4.2.0) against a UniProt human reference proteome using the same samples but before pre-fractionation by either offline reverse phase (pre-B) or size exclusion (B-like) chromatography. Based on the MaxQuant results, restricted protein databases were compiled and used for protein–protein crosslink identification by searching the Thermo raw files with pLink (v.2.3.11) for pre-B and pLink (v.2.3.9) for B-like complexes²⁹. For model building, a maximum distance of 30 Å between the Cα atoms of the crosslinked lysine residues was allowed.

EM sample preparation and imaging

For cryo-EM samples, spliceosomal complexes were loaded onto a linear 10–30% (v/v) glycerol gradient prepared in G-75 buffer containing 0–0.1% glutaraldehyde (GRAFIX) and centrifuged at 17,500 r.p.m. for 18 h at 4 °C in a TST41.14 rotor. Fractions were collected from the bottom of the gradient and were quenched with 120 mM Tris-HCl pH 7.5 on ice. Complexes in the peak gradient fractions were pooled, buffer-exchanged and concentrated in an Amicon 50 kDa cut-off unit. Complexes were then adsorbed for 20 min to a thin layer carbon film that was subsequently attached to R2/2 UltrAuFoil grids (Quantifoil). A volume of 3.8 μl of double-distilled water was applied to the grids and excess water was blotted away using a FEI Vitrobot loaded with pre-wet filter paper, with the following settings: blotting force of 11 and blotting time of 7.5 s at 4 °C and 100% humidity. Samples were subsequently vitrified by plunging into liquid ethane cooled to liquid nitrogen temperature. Cryo-EM grids of the pre-B, pre-B^5′ss, pre-B^{5′ss+ATPγS}, pre-B^{5′ssLNG+ATPγS} and pre-B^ATP were imaged in a Titan Krios 1 (Thermo Fisher Scientific), equipped with a Cs corrector, operated at 300 kV, on a Falcon III detector in linear mode at a calibrated pixel size of 1.16 Å at the specimen level (see Extended Data Table 1 for a summary of EM statistics). Cryo-EM grids of B-like and pre-B^AMPPNP were imaged in a Titan Krios 3 (Thermo Fisher Scientific), operated at 300 kV, on a Falcon III detector in linear mode at a calibrated pixel size of 1.35 Å at the specimen level. Krios1 and Krios3 cryo-EM images were acquired using Thermo Fisher EPU2.1 with an exposure time of 1.02 s (40 movie frames), with a total dose of 60 e^– Å^–2 and 48 e^– Å^–2, respectively.

EM data processing

For all of the cryo-EM datasets, frames were aligned, dose-weighted and summed using MotionCor (v.2.0)³⁰. Defocus values were estimated using Gctf³¹. Particle picking was performed using crYOLO³². For each sample, approximately 800–1,000 particles were manually picked from 30–50 micrographs and used to train a neural network model, which was then used to automatically pick particles for the corresponding dataset. All subsequent processing was performed using RELION 3.1 (http://www2.mrc-lmb.cam.ac.uk/relion/index.php/Main_Page) unless otherwise specified. Cryo-EM data were split randomly into two halves for gold-standard FSC determination in RELION 3.1.

For the pre-B complex, 777,350 particles were picked from 25,904 micrographs, extracted and binned to 200 × 200 pixels (3× binned, pixel size of 3.48 Å). After reference-free two-dimensional (2D) classification, 586,198 particles were retained for further processing, from which 100,000 particles were used for ab initio reconstruction in cryoSPARC³³. The ab initio model showed a 3D structure resembling that of a CI pre-B complex but with additional fuzzy densities (which later turned out to be the second protomer). The fuzzy density, as well as the unstable U2 density, was erased using Chimera³⁴, and the resulting 3D structure was low-pass filtered to 40 Å resolution to prevent model bias, which was then used for 3D classification in RELION 3.1. The 586,198 particles were 3D classified into 5 classes that contained 2 major types of particles. In class 1, both protomers were well-defined, whereas in class 2, only one well-defined pre-B protomer was observed. To improve the resolution of the pre-B protomer, the two protomers were separately re-extracted, re-centred in a box of 160 × 160 pixels (3× binned, pixel size of 3.48 Å) using the alignment parameters from the first round of 3D classification. The resulting particles were then 3D classified separately, and the good particles were combined and subjected to a masked 3D classification, focusing on the tri-snRNP density. The 279,781 particles showing a well-defined tri-snRNP density were then re-extracted in the original pixel size in a 480 × 480 box. 3D refinement, CTF refinement and Bayesian polishing were performed in two rounds. In the final round of 3D refinement, soft masks around the tri-snRNP core—encompassing PRP8^NTD, the PRP8 Large domain (PRP8^Large), U4/U6 stem I and stem III, U5 snRNA, SNU114, SAD1, DIM1, the PRP6 N-terminal domain (PRP6^NTD), SF3A1 C-terminal region (SF3A1^CT), the PRP28 N-terminal domain (PRP28^NTD) and the BRR2 N-terminal domain (BRR2^NTD)—and the BRR2 region (encompassing the BRR2 helicase domain and PRP8^Jab1) were applied, producing two 3D reconstructions at nominal resolution of 3.5 Å and 4.2 Å, respectively. Focused classification without alignment was applied to improve the U4 core region (encompassing the U4 Sm domain, SNU66, U4/U6 stem I and stem III, RBM42, PRP8^RH and PRP8^En) and the U2 region (encompassing the U2 5′ domain comprising SF3b proteins, U2/U6 helix II and U6 Lsm proteins). After masked refinement, the U4 core and the U2 region were resolved to nominal resolutions of 6.1 Å and 12 Å, respectively.

For the B-like complex, 488,598 particles from 14,665 micrographs were picked, extracted and binned to 200 × 200 pixels (3× binned, pixel size of 4.05 Å). A total of 389,830 particles were retained after reference-free 2D classification, from which 100,000 particles were used for ab initio reconstruction in cryoSPARC³³. The ab initio model showed a dimeric structure. The less well-defined protomer was erased using Chimera³⁴, and the better-defined protomer was low-pass filtered to 40 Å and used as the starting model for 3D classification of the entire dataset. For the first round of 3D classification, a soft mask around one protomer was applied, so that all the particles were forced to align to only one protomer. This separated particles that had at least one well-defined protomer from the bad particles. To investigate whether the good particles contain monomeric B-like complexes, after the first round of 3D classification the particles were further 3D classified into four classes without a mask. All of the 3D classes showed well-defined dimeric complexes, which suggested that all of the good particles are dimeric B-like complexes. To improve the resolution of the B-like protomers, particles were re-centred and re-extracted in the original pixel size in a 480 × 480 pixels box. Two rounds of 3D refinement, CTF refinement and Bayesian polishing were performed. In the final round of 3D refinement, soft masks around the tri-snRNP core (encompassing PRP8, the 5′ss oligo, U4/U6 stem I and stem II, U5 snRNA, PRP3, SNU114, SAD1, DIM1, PRP6^NTD, SF3A1^CT, PRP28^NTD, SNU13, FBP21, SNU23, MFAP1 and PRP38A), the BRR2 region (encompassing the BRR2 helicase domain and PRP8^Jab1) and the U4/U6 region (encompassing U4/U6 stem I and stem II, SNU13, PRP3, PRP4, PRP31, PPIH, PRP6^HAT and PRP8^RH) were applied, producing three 3D reconstructions with nominal resolutions of 3.1 Å, 4.3 Å, and 3.3 Å, respectively. Focused classification without alignment was applied to improve the U2 region (encompassing the U2 5′ region, U2/U6 helix II and SMU1). After masked refinement, the U2 region was improved to about 12 Å resolution.

For the pre-B^5′ss complex, 1,283,541 particles from 23,372 micrographs were picked, extracted and binned to 200 × 200 pixels (3× binned, pixel size of 3.48 Å). Overall, 944,381 particles were retained after reference-free 2D classification and subjected to 3D classification using the low-pass filtered tri-snRNP part of the pre-B complex or the tri-snRNP core of the B-like complex (excluding the BRR2 region) as the starting model. Both starting models generated the same result, with one 3D class containing a well-defined protomer. No class resembling the B-like complex was found even when the tri-snRNP core of the B-like complex was used as the starting model. To separate the class 1 and class 2 dimers, the good 3D class was further classified into nine classes. To improve the resolution of the pre-B^5′ss protomer, particles were re-centred and re-extracted in the original pixel size in a 480 × 480 pixels box, and another round of 3D classification was performed with a soft mask around the tri-snRNP region. The good class was selected and 3D refined, followed by one round of CTF refinement and Bayesian polishing. The final 176,879 particles were 3D refined with a soft mask around the tri-snRNP core (encompassing 5′ss oligo, PRP8^NTD, PRP8^Large, U4/U6 stem I and stem III, U5 snRNA, SNU114, SAD1, DIM1, PRP6^NTD, SF3A1^CT, PRP28^NTD and BRR2^NTD), resulting in a 3D reconstruction at a nominal resolution of 4.2 Å.

For the pre-B^{5′ss+ATPγS} complex, 791,079 particles were picked, extracted and binned to 200 × 200 pixels (3× binned, pixel size of 3.48 Å). As the ab initio reconstruction from cryoSPARC largely resembles the B-like complex, the tri-snRNP core (excluding BRR2) of the B-like complex was low-pass filtered to 40 Å and used as the starting model for 3D classification. The good classes were combined, re-centred and re-extracted in the original pixel size in a 480 × 480 pixels box. Two rounds of 3D refinement, CTF refinement and Bayesian polishing were performed, and the final 411,185 particles were refined with a soft mask around the tri-snRNP core (encompassing PRP8, 5′ss oligo, U4/U6 stem I and stem II, U5 snRNA, PRP3, SNU114, SAD1, DIM1, PRP6^NTD, SF3A1^CT, PRP28^NTD and SNU13), producing a 3D reconstruction at a nominal resolution of 3.1 Å. Focused classification without alignment followed by a masked refinement was applied to improve the BRR2 region (encompassing the BRR2 helicase domain, PRP8^En and PRP8^Jab1) to a nominal resolution of 4.0 Å.

For the pre-B^{5′ssLNG+ATPγS} complex, 541,230 particles from 13,740 micrographs were picked, extracted and binned to 200 × 200 pixels (3× binned, pixel size of 3.48 Å). Using the low-pass filtered tri-snRNP core of the pre-B^{5′ss+ATPγS} complex as a starting model, the particles were 3D classified, and particles from the best class were re-centred and re-extracted in the original pixel size in a 480 × 480 pixels box. After two rounds of 3D refinement, CTF refinement and Bayesian polishing, the final 136,333 particles were refined with a soft mask around the tri-snRNP core (encompassing PRP8, the long 5′ss oligo, U4/U6 stem I and stem II, U5 snRNA, PRP3, SNU114, SAD1, DIM1, PRP6^NTD, SF3A1^CT, PRP28^NTD and SNU13), producing a 3D reconstruction at a nominal resolution of 3.7 Å.

For the pre-B^ATP complex, 757,260 particles from 11,752 micrographs were picked, extracted and binned to 200 × 200 pixels (3× binned, pixel size of 3.48 Å). A total of 499,792 particles were retained after 2D classification. Various starting models were tested for 3D classification, including the tri-snRNP core from the pre-B, pre-B^5′ss and pre-B^{5′ss+ATPγS} complexes. The density of BRR2 was erased from all of the starting models to prevent model bias, and the low-pass filtered tri-snRNP core from the pre-B^{5′ss+ATPγS} complex worked best for 3D classification. No class resembling pre-B or pre-B^5′ss was detected even when the two complexes were used as the starting model. The particles from the best 3D class (94,460 particles) were further 3D classified with a resolution limit of 30 Å, which showed that 25.4% of the particles contain a well-resolved second protomer. The rest (74.6%) of the particles showed a poorly resolved second protomer, which was due to either the flexibility of the second protomer or the lack of stable tri-snRNP integration in the second protomer (that is, it consists of a CE A-like complex). Given that all of the 94,460 particles contained at least one good protomer, for 3D reconstruction of the high-resolution core, all of these particles were re-centred and re-extracted in the original pixel size in a 480 × 480 pixels box. After two rounds of 3D refinement, CTF refinement and Bayesian polishing, the final 3D refinement was performed with a soft mask around the tri-snRNP core (encompassing PRP8, the 5′ss region of the MINX exon RNA, U4/U6 stem I and stem II, U5 snRNA, PRP3, SNU114, SAD1, DIM1, PRP6^NTD, SF3A1^CT, PRP28^NTD and SNU13), producing a 3D reconstruction at a nominal resolution of 3.7 Å. Subsequent local 3D classification around the tri-snRNP core did not reveal further structural heterogeneity, which suggested that the tri-snRNP core remains identical regardless of the presence or absence of a stable second protomer.

For the pre-B^AMPPNP complex, 619,945 particles from 20,337 micrographs were picked, extracted and binned to 200 × 200 pixels (3× binned, pixel size of 4.05 Å). In total, 371,919 particles were retained after 2D classification. The same set of starting models prepared for the pre-B^ATP complex was used for 3D classification of the pre-B^AMPPNP complex, with the low-pass filtered tri-snRNP core from the pre-B complex working best. No class resembling pre-B^{5′ss+ATPγS} was detected even when it was used as the starting model. The particles from the best 3D class were re-centred and re-extracted in the original pixel size in a 480 × 480 pixels box. After one round of 3D refinement, CTF refinement and Bayesian polishing, the final 53,422 particles were refined with a soft mask around the tri-snRNP core (encompassing PRP8^NTD, PRP8^Large, U4/U6 stem I and stem III, U5 snRNA, SNU114, SAD1, DIM1, PRP6^NTD, SF3A1^CT, PRP28^NTD and BRR2^NTD), producing a 3D reconstruction at a nominal resolution of 4.1 Å. Focused classification without alignment followed by a masked refinement was applied to improve the PRP28/U1 snRNP region (encompassing PRP8, U5 snRNA, PRP28 and U1 snRNP) to a nominal resolution of 6.1 Å.

Model building and refinement

Model building was carried out by docking cryo-EM, crystal and AlphaFold2 structures into EM density and adjusting in COOT³⁵. A list of modelled protein and RNA components, as well as their corresponding model templates, is provided in Supplementary Table 3. In brief, the CE pre-B complex was modelled by fitting the tri-snRNP and U2 snRNP parts of the CI pre-B complex (Protein Data Bank (PDB) identifier 6QX9) into the EM density as rigid bodies. The U2 part (including the SF3B core complex, the SF3A core complex, U2 Sm, U2-A′ and U2-B″) was truncated to a polyalanine chain without further adjustment. The SF3B6 protein was modelled based on its position relative to the SF3B1 C-terminal HEAT domain in the A-like complex (PDB 7Q4O) without further adjustment, consistent with crosslinks (Supplementary Table 2 and Extended Data Fig. 2). For the high-resolution tri-snRNP part, each individual component and its side chains were adjusted manually in COOT. The B-like complex was modelled by fitting the B complex model (PDB 8Q7N) into the EM density, and the parts that are absent in B-like (that is, UBL5, an extended U6/5′ss helix, TCERG1 and BUD31) were deleted from the model. Two copies of the 5′ss oligo were modelled de novo, and the high-resolution tri-snRNP part was manually adjusted in COOT. The pre-B^5′ss complex was modelled by fitting individual components of the CE pre-B complex into the EM density as rigid bodies. PRP8, along with 5′ss oligo 1, was taken from the B-like complex and fit into the EM density as a rigid body. The side chains were initially truncated to a polyalanine chain owing to the relatively lower resolution, and the carbon backbones were manually adjusted in COOT. The side chains were then added back manually at the positions where the local resolution allows. The pre-B^{5′ss+ATPγS}) complex was modelled by fitting individual components of the B-like complex into the EM density. The high-resolution tri-snRNP part was adjusted in COOT. The crystal structure of the BRR2 helicase (PDB 4F91) was truncated into a polyalanine chain and docked into the density as a rigid body. The BRR2^CC was not further adjusted, and the N-terminal cassette was manually adjusted into the density in COOT. The C-terminal part of SF3A1 (amino acids 496–521) was predicted by AlphaFold2 and docked into the density and adjusted in COOT. U6 nucleotides between the U6/5′ss helix and U4/U6 stem III (nucleotides 35–39), and U4 nucleotides between U4/U6 stem I and stem III (nucleotides 63–74) were de novo modelled in COOT. The pre-B^{5′ssLNG+ATPγS} complex was modelled by fitting the pre-B^{5′ss+ATPγS} complex into the EM density, and the flexible U4 snRNA strand (nucleotides 62–85) was deleted. The U4 Sm core was fit into the density as a rigid body. The extended U6/5′ss helix was modelled as a A-form helix and fit into the density. The pre-B^ATP complex was modelled by fitting the pre-B^{5′ss+ATPγS} complex into the EM density, and changing the 5′ss oligo sequence into the MINX exon sequence. A⁻⁴ and C⁻⁵ of the MINX exon were de novo modelled into the EM density in COOT. The PRP28 RecA domains were deleted owing to the absence of EM density at the corresponding position. The pre-B^AMPPNP complex was modelled by fitting the CE pre-B complex into the EM density. The U1 Sm core, U1 snRNA and U1-70K were taken from the CI pre-B complex (PDB 6QX9) and docked into the EM density as a rigid body. The closed RecA domains of PRP28, together with the unknown single-stranded RNA, were modelled based on the crystal structure of the closed Mss116p DEAD-box helicase bound to AMP-PNP and a single-stranded RNA (PDB 3I5X). Coordinates of the tri-snRNP parts of the various complexes were refined in real space using PHENIX³⁶.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

[ad_2]

Source link

May 22, 2024
Physiological temperature drives TRPM4 ligand recognition and gating

[ad_1]
Clapham, D. E. & Miller, C. A thermodynamic framework for understanding temperature sensing by transient receptor potential (TRP) channels. Proc. Natl Acad. Sci. USA 108, 19492–19497 (2011).

Article
ADS
CAS
PubMed
PubMed Central

Google Scholar
Yeh, F., Jara-Oseguera, A. & Aldrich, R. W. Implications of a temperature-dependent heat capacity for temperature-gated ion channels. Proc. Natl Acad. Sci. USA 120, e2301528120 (2023).

Article
CAS
PubMed
PubMed Central

Google Scholar
Guinamard, R., Demion, M. & Launay, P. Physiological roles of the TRPM4 channel extracted from background currents. Physiology 25, 155–164 (2010).

Article
CAS
PubMed

Google Scholar
Launay, P. et al. TRPM4 is a Ca²⁺-activated nonselective cation channel mediating cell membrane depolarization. Cell 109, 397–407 (2002).

Article
CAS
PubMed

Google Scholar
Nilius, B. et al. Voltage dependence of the Ca²⁺-activated cation channel TRPM4. J. Biol. Chem. 278, 30813–30820 (2003).

Article
CAS
PubMed

Google Scholar
Talavera, K. et al. Heat activation of TRPM5 underlies thermal sensitivity of sweet taste. Nature 438, 1022–1025 (2005).

Article
ADS
CAS
PubMed

Google Scholar
Ullrich, N. D. et al. Comparison of functional properties of the Ca²⁺-activated cation channels TRPM4 and TRPM5 from mice. Cell Calcium 37, 267–278 (2005).

Article
CAS
PubMed

Google Scholar
Nilius, B., Prenen, J., Janssens, A., Voets, T. & Droogmans, G. Decavanadate modulates gating of TRPM4 cation channels. J. Physiol. 560, 753–765 (2004).

Article
CAS
PubMed
PubMed Central

Google Scholar
Nilius, B., Prenen, J., Voets, T. & Droogmans, G. Intracellular nucleotides and polyamines inhibit the Ca²⁺-activated cation channel TRPM4b. Pflugers Arch. 448, 70–75 (2004).

Article
CAS
PubMed

Google Scholar
Winkler, P. A., Huang, Y., Sun, W., Du, J. & Lu, W. Electron cryo-microscopy structure of a human TRPM4 channel. Nature 552, 200–204 (2017).

Article
ADS
CAS
PubMed

Google Scholar
Guo, J. et al. Structures of the calcium-activated, non-selective cation channel TRPM4. Nature 552, 205–209 (2017).

Article
ADS
CAS
PubMed
PubMed Central

Google Scholar
Vriens, J., Nilius, B. & Voets, T. Peripheral thermosensation in mammals. Nat. Rev. Neurosci. 15, 573–589 (2014).

Article
CAS
PubMed

Google Scholar
Cruz, A. & Green, B. G. Thermal stimulation of taste. Nature 403, 889–892 (2000).

Article
ADS
CAS
PubMed

Google Scholar
Hensel, H. Thermoreception and temperature regulation. Monogr. Physiol. Soc. 38, 1–321 (1981).

ADS
CAS
PubMed

Google Scholar
Julius, D. TRP channels and pain. Annu. Rev. Cell Dev. Biol. 29, 355–384 (2013).

Article
CAS
PubMed

Google Scholar
Gallio, M., Ofstad, T. A., Macpherson, L. J., Wang, J. W. & Zuker, C. S. The coding of temperature in the Drosophila brain. Cell 144, 614–624 (2011).

Article
CAS
PubMed
PubMed Central

Google Scholar
Bandell, M., Macpherson, L. J. & Patapoutian, A. From chills to chilis: mechanisms for thermosensation and chemesthesis via thermoTRPs. Curr. Opin. Neurobiol. 17, 490–497 (2007).

Article
CAS
PubMed
PubMed Central

Google Scholar
Jordt, S. E., McKemy, D. D. & Julius, D. Lessons from peppers and peppermint: the molecular logic of thermosensation. Curr. Opin. Neurobiol. 13, 487–492 (2003).

Article
CAS
PubMed

Google Scholar
Dhaka, A., Viswanath, V. & Patapoutian, A. Trp ion channels and temperature sensation. Annu. Rev. Neurosci. 29, 135–161 (2006).

Article
CAS
PubMed

Google Scholar
Patapoutian, A., Peier, A. M., Story, G. M. & Viswanath, V. ThermoTRP channels and beyond: mechanisms of temperature sensation. Nat. Rev. Neurosci. 4, 529–539 (2003).

Article
CAS
PubMed

Google Scholar
Kashio, M. & Tominaga, M. TRP channels in thermosensation. Curr. Opin. Neurobiol. 75, 102591 (2022).

Article
CAS
PubMed

Google Scholar
Voets, T. TRP channels and thermosensation. Handb. Exp. Pharmacol. 223, 729–741 (2014).

Article
CAS
PubMed

Google Scholar
Ramsey, I. S., Delling, M. & Clapham, D. E. An introduction to TRP channels. Annu. Rev. Physiol. 68, 619–647 (2006).

Article
CAS
PubMed

Google Scholar
Venkatachalam, K. & Montell, C. TRP channels. Annu. Rev. Biochem. 76, 387–417 (2007).

Article
CAS
PubMed
PubMed Central

Google Scholar
Clapham, D. E. TRP channels as cellular sensors. Nature 426, 517–524 (2003).

Article
ADS
CAS
PubMed

Google Scholar
Caterina, M. J., Rosen, T. A., Tominaga, M., Brake, A. J. & Julius, D. A capsaicin-receptor homologue with a high threshold for noxious heat. Nature 398, 436–441 (1999).

Article
ADS
CAS
PubMed

Google Scholar
Vandewauw, I. et al. A TRP channel trio mediates acute noxious heat sensing. Nature 555, 662–666 (2018).

Article
ADS
CAS
PubMed

Google Scholar
Fleig, A. & Penner, R. The TRPM ion channel subfamily: molecular, biophysical and functional features. Trends Pharmacol. Sci. 25, 633–639 (2004).

Article
CAS
PubMed

Google Scholar
Launay, P. et al. TRPM4 regulates calcium oscillations after T cell activation. Science 306, 1374–1377 (2004).

Article
ADS
CAS
PubMed

Google Scholar
Demion, M., Bois, P., Launay, P. & Guinamard, R. TRPM4, a Ca²⁺-activated nonselective cation channel in mouse sino-atrial node cells. Cardiovasc. Res. 73, 531–538 (2007).

Article
CAS
PubMed

Google Scholar
Earley, S., Waldron, B. J. & Brayden, J. E. Critical role for transient receptor potential channel TRPM4 in myogenic constriction of cerebral arteries. Circ. Res. 95, 922–929 (2004).

Article
CAS
PubMed

Google Scholar
Guinamard, R. et al. Functional characterization of a Ca²⁺-activated non-selective cation channel in human atrial cardiomyocytes. J. Physiol. 558, 75–83 (2004).

Article
CAS
PubMed
PubMed Central

Google Scholar
Nilius, B. et al. Regulation of the Ca²⁺ sensitivity of the nonselective cation channel TRPM4. J. Biol. Chem. 280, 6423–6433 (2005).

Article
CAS
PubMed

Google Scholar
Prawitt, D. et al. TRPM5 is a transient Ca²⁺-activated cation channel responding to rapid changes in [Ca²⁺]_i. Proc Natl Acad Sci USA 100, 15166–15171 (2003).

Article
ADS
CAS
PubMed
PubMed Central

Google Scholar
Nilius, B. et al. The Ca²⁺-activated cation channel TRPM4 is regulated by phosphatidylinositol 4,5-biphosphate. EMBO J. 25, 467–478 (2006).

Article
CAS
PubMed
PubMed Central

Google Scholar
Liu, D. & Liman, E. R. Intracellular Ca²⁺ and the phospholipid PIP2 regulate the taste transduction ion channel TRPM5. Proc. Natl Acad. Sci. USA 100, 15160–15165 (2003).

Article
ADS
CAS
PubMed
PubMed Central

Google Scholar
Voets, T. et al. The principle of temperature-dependent gating in cold- and heat-sensitive TRP channels. Nature 430, 748–754 (2004).

Article
ADS
CAS
PubMed

Google Scholar
Autzen, H. E. et al. Structure of the human TRPM4 ion channel in a lipid nanodisc. Science 359, 228–232 (2018).

Article
ADS
CAS
PubMed

Google Scholar
Huang, Y., Fliegert, R., Guse, A. H., Lu, W. & Du, J. A structural overview of the ion channels of the TRPM family. Cell Calcium 85, 102111 (2020).

Article
CAS
PubMed

Google Scholar
Duan, J. et al. Structure of full-length human TRPM4. Proc. Natl Acad. Sci. USA 115, 2377–2382 (2018).

Article
ADS
CAS
PubMed
PubMed Central

Google Scholar
Kwon, D. H. et al. Heat-dependent opening of TRPV1 in the presence of capsaicin. Nat. Struct. Mol. Biol. 28, 554–563 (2021).

Article
CAS
PubMed
PubMed Central

Google Scholar
Nadezhdin, K. D. et al. Structural mechanism of heat-induced opening of a temperature-sensitive TRP channel. Nat. Struct. Mol. Biol. 28, 564–572 (2021).

Article
CAS
PubMed
PubMed Central

Google Scholar
Ruan, Z. et al. Structures of the TRPM5 channel elucidate mechanisms of activation and inhibition. Nat. Struct. Mol. Biol. 28, 604–613 (2021).

Article
CAS
PubMed
PubMed Central

Google Scholar
Guinamard, R. et al. TRPM4 in cardiac electrical activity. Cardiovasc. Res. 108, 21–30 (2015).

Article
CAS
PubMed

Google Scholar
Gout, E., Rebeille, F., Douce, R. & Bligny, R. Interplay of Mg²⁺, ADP, and ATP in the cytosol and mitochondria: unravelling the role of Mg2+ in cell respiration. Proc. Natl Acad. Sci. USA 111, E4560–E4567 (2014).

Article
ADS
CAS
PubMed
PubMed Central

Google Scholar
Baldwin, R. L. Temperature dependence of the hydrophobic interaction in protein folding. Proc. Natl Acad. Sci. USA 83, 8069–8072 (1986).

Article
ADS
CAS
PubMed
PubMed Central

Google Scholar
Petrauskas, V., Maximowitsch, E. & Matulis, D. Thermodynamics of ion pair formations between charged poly(amino acid)s. J. Phys. Chem. B 119, 12164–12171 (2015).

Article
CAS
PubMed

Google Scholar
McKemy, D. D., Neuhausser, W. M. & Julius, D. Identification of a cold receptor reveals a general role for TRP channels in thermosensation. Nature 416, 52–58 (2002).

Article
ADS
CAS
PubMed

Google Scholar
Peier, A. M. et al. A TRP channel that senses cold stimuli and menthol. Cell 108, 705–715 (2002).

Article
CAS
PubMed

Google Scholar
Vriens, J. et al. TRPM3 is a nociceptor channel involved in the detection of noxious heat. Neuron 70, 482–494 (2011).

Article
CAS
PubMed

Google Scholar
Goehring, A. et al. Screening and large-scale expression of membrane proteins in mammalian cells for structural studies. Nat. Protoc. 9, 2574–2585 (2014).

Article
CAS
PubMed
PubMed Central

Google Scholar
Mastronarde, D. N. Automated electron microscope tomography using robust prediction of specimen movements. J. Struct. Biol. 152, 36–51 (2005).

Article
PubMed

Google Scholar
Zheng, S. Q. et al. MotionCor2: anisotropic correction of beam-induced motion for improved cryo-electron microscopy. Nat. Methods 14, 331–332 (2017).

Article
CAS
PubMed
PubMed Central

Google Scholar
Rohou, A. & Grigorieff, N. CTFFIND4: Fast and accurate defocus estimation from electron micrographs. J. Struct. Biol. 192, 216–221 (2015).

Article
PubMed
PubMed Central

Google Scholar
Bepler, T., Kelley, K., Noble, A. J. & Berger, B. Topaz-Denoise: general deep denoising models for cryoEM and cryoET. Nat. Commun. 11, 5208 (2020).

Article
ADS
CAS
PubMed
PubMed Central

Google Scholar
Scheres, S. H. RELION: implementation of a Bayesian approach to cryo-EM structure determination. J. Struct. Biol. 180, 519–530 (2012).

Article
CAS
PubMed
PubMed Central

Google Scholar
Punjani, A., Rubinstein, J. L., Fleet, D. J. & Brubaker, M. A. cryoSPARC: algorithms for rapid unsupervised cryo-EM structure determination. Nat. Methods 14, 290–296 (2017).

Article
CAS
PubMed

Google Scholar
Afonine, P. V. et al. Real-space refinement in PHENIX for cryo-EM and crystallography. Acta Crystallogr. D 74, 531–544 (2018).

Article
ADS
CAS

Google Scholar
Emsley, P., Lohkamp, B., Scott, W. G. & Cowtan, K. Features and development of Coot. Acta Crystallogr. D 66, 486–501 (2010).

Article
ADS
CAS
PubMed
PubMed Central

Google Scholar
Moriarty, N. W., Grosse-Kunstleve, R. W. & Adams, P. D. electronic Ligand Builder and Optimization Workbench (eLBOW): a tool for ligand coordinate and restraint generation. Acta Crystallogr. D 65, 1074–1080 (2009).

Article
ADS
CAS
PubMed
PubMed Central

Google Scholar
Chen, V. B. et al. MolProbity: all-atom structure validation for macromolecular crystallography. Acta Crystallogr. D 66, 12–21 (2010).

Article
ADS
CAS
PubMed

Google Scholar
Pettersen, E. F. et al. UCSF Chimera—a visualization system for exploratory research and analysis. J. Comput. Chem. 25, 1605–1612 (2004).

Article
CAS
PubMed

Google Scholar
Smart, O. S., Neduvelil, J. G., Wang, X., Wallace, B. A. & Sansom, M. S. HOLE: a program for the analysis of the pore dimensions of ion channel structural models. J. Mol. Graph. 14, 354–360 (1996).

Article
CAS
PubMed

Google Scholar
Nilius, B. & Vennekens, R. From cardiac cation channels to the molecular dissection of the transient receptor potential channel TRPM4. Pflugers Arch. 453, 313–321 (2006).

Article
CAS
PubMed

Google Scholar

[ad_1]

Purification of recombinant human RAD52

Human RAD52 cDNA was codon optimized for expression in E. coli and cloned into pET100 (GeneArt, Thermo Fisher Scientific). Inverse PCR (primers: RAD52_tag_remove_F and RAD52_tag_remove_R) was performed to remove the 6×His, T7 and Xpress tags. The plasmid was transformed into BL21 Star (DE3) (Thermo Fisher Scientific) cells and a single colony was inoculated into an overnight culture using Luria broth (LB) supplemented with 0.8% glucose and 100 μg ml⁻¹ ampicillin. An aliquot was diluted into 2 l of LB containing glucose and ampicillin, to an optical density at 600 nm (OD₆₀₀) of 0.1, and incubated in an orbital shaker at 37 °C and 180 rpm. When the culture reached an OD₆₀₀ of 0.8, IPTG (0.5 mM; Thermo Fisher Scientific) was added to induce RAD52 expression and incubation continued for a further 3 h. The culture was collected by centrifugation at 3,300g for 15 min, and the cell pellet was resuspended in 1 vol of PBS and centrifuged again. The pellet was then resuspended in lysis buffer (25 mM MES pH 6.5, 0.5 M NaCl, 10% glycerol and 1 mM EDTA) supplemented with Halt protease inhibitor (Thermo Fisher Scientific) and 0.25 mM TCEP, and lysed with Emulsiflex C5 (Avestin) at 4 °C. The lysate was clarified by centrifugation at 60,000g and 4 °C for 10 min. The supernatant was collected and diluted dropwise with the same lysis buffer without NaCl to reach 300 mM NaCl. The lysate was then clarified again by centrifugation at 60,000g and 4 °C for 20 min and loaded onto a HiTrap SP column (Cytiva) connected to an ÄKTA pure system at 4 °C. The column was washed with 3 column volumes (CV) of buffer containing 25 mM MES pH 6.5, 0.3 M NaCl, 1 mM EDTA, 10% glycerol and 0.25 mM TCEP, and eluted with 10 CV of a linear gradient of the same buffer containing 0.3–1 M NaCl. Peak fractions were diluted 3× with buffer containing 100 mM HEPES pH 7.0, 0.25 mM TCEP and Halt protease inhibitor and loaded onto a HiTrap Q column (Cytiva), that was eluted with 10 CV of a linear gradient (0.1–1 M NaCl) of HEPES buffer containing 0.5 mM EDTA and 0.25 mM TCEP. The HiTrap Q flow-through fraction was collected as crude purified RAD52.

To separate the two RAD52 conformations, RAD52 was loaded onto a Resource S column (Cytiva). Chromatography was performed using buffer containing 25 mM HEPES pH 7.0, 0.25 mM TCEP and various concentrations of NaCl. The Resource S column was (1) washed with 3 CV of 150 mM NaCl buffer; (2) eluted with 5 CV of linear gradient of 0.2–0.278 M NaCl buffer (until the conductivity was equivalent to 24.4 mS cm⁻¹); (3) washed with 5 CV of 0.278 M NaCl buffer; and (4) eluted with 10 CV of 0.278–0.6 M NaCl buffer. The peak fractions of the two RAD52 forms were collected separately. RAD52-OR and RAD52-CR were loaded onto a Superose 6 Increase 10/300 GL column (Cytiva) using buffer containing 25 mM HEPES pH 8.0, 200 mM KOAc, 10% glycerol and 0.25 mM TCEP. The peak fractions were collected, aliquoted, snap-frozen in liquid nitrogen and stored at −80 °C. RAD52 concentrations were measured at a wavelength of 280 nm using the Nanodrop (Thermo Fisher Scientific) system and calculated as an 11-subunit ring (RAD52-CR and RAD52 NTD) or 10-subunit ring (RAD52-OR) with the exception that protomer concentration was used for circular dichroism (CD) analyses.

For the RAD52 NTD, inverse PCR (primers: RAD52_NTD_F and RAD52_NTD_R) was used to remove the C terminus (amino acids 210–418). The RAD52 NTD was purified using the same method as the full-length protein except that a linear gradient of 0.2–0.6 M NaCl was used for the Resource S column.

For RAD52(∆RID), RAD52(RQK/AAA) and RAD52(∆C), inverse PCR was used to remove the RPA-interacting domain (primers: RAD52_RID_F and RAD52_RID_R), extreme C terminus (primer: RAD52_NTD_F and RAD52_C_18D_R) and introduce the R260A, Q261A and K262A mutations (primer: RAD52_RQKAAA_F and RAD52_RQKAAA_R). All mutants were purified using the same method as for the full-length protein.

Purification of Flag–RAD52 from Sf9 insect cells

Human RAD52 cDNA was codon optimized for expression in Sf9 insect cells and cloned into pFastBac1 baculovirus expression vector with an N-terminal Flag tag (GeneArt, Thermo Fisher Scientific). The plasmid was transformed into DH10Bac (Thermo Fisher Scientific), and the bacmids were isolated with PureLink HiPure Plasmid Miniprep kit (Thermo Fisher Scientific). Overall, the generation and handling of the baculovirus was performed according to the Invitrogen Bac-to-Bac Baculovirus Expression System user manual with some modifications. In brief, recombinant bacmids were transfected into Sf9 cells with FuGENE HD, and P1 viruses were collected 66–72 h after transfection. The baculovirus titre was determined by isolating the viral DNA with High Pure Viral Nucleic Acid Kit (Roche), and quantitative PCR using Platinum qPCR supermix UDG (Thermo Fisher Scientific) and BaculoQUANT kit (Oxford Expression Technologies). The P2 baculovirus was amplified by infecting Sf9 cells at a multiplicity of infection (MOI) of 0.01 and 2 million cells per ml, and collected at 66–72 h after infection.

P2 baculovirus (MOI = 1) was used for recombinant Flag–RAD52 expression. Sf9 cells were grown in Sf-900 III SFM (Gibco, Thermo Fisher Scientific) at 27 °C in an orbital shaker at 140 rpm. The Sf9 cells were infected for 66–72 h. Cells were collected by centrifugation at 500g for 5 min and washed once with PBS. The cell pellet was resuspended in lysis buffer (25 mM MES pH 6.5, 600 mM NaCl, 10% glycerol and 1 mM EDTA) supplemented with Halt protease inhibitor (Thermo Fisher Scientific) and 0.25 mM TCEP, and sonicated in ice/water slurry at 25 amplitude for 150 s (with 1 s intervals to prevent warming) using a qSonica Q700 sonicator. The lysate was clarified by centrifugation at 60,000g for 30 min at 4 °C.

Pre-equilibrated anti-Flag M2 agarose beads (Merck) were added to the lysate, and the mixture was incubated on a rotator at 4 °C for 1.5 h. The beads were pelleted by centrifugation at 500g for 5 min at 4 °C and transferred to a gravity flow chromatography column. The column was washed extensively with the lysis buffer, and subsequently with buffer containing 25 mM HEPES pH 7.0, 450 mM NaCl, 10% glycerol, 1 mM EDTA, 0.25 mM TCEP and Halt protease inhibitor. The last wash was performed with the same buffer at 300 mM NaCl. Flag–RAD52 was then eluted with the buffer containing 450 mM NaCl and 0.5 mg ml⁻¹ Flag peptide. Elution was performed twice by incubating the beads with an equal volume of elution buffer for 1 h at 4 °C. The eluates were combined, and diluted 4× using the same elution buffer at 100 mM NaCl without Flag peptide to lower the NaCl concentration to 150 mM. Resource S chromatography was performed as described above.

Purification of recombinant human RPA

Human RPA1, RPA2 and 10×His-RPA3 were synthesized and cloned into the pFastBac1 baculovirus expression vector (GeneArt, Thermo Fisher Scientific). RPA1 (2 copies), RPA2 and 10×His-RPA3, together with their polyhedrin promoters, were then assembled into pBIG1a (biGBac multigene baculovirus expression vector)⁴⁹ using Gibson assembly (NEB). Bacmids and baculovirus were generated as described above. P2 baculovirus (MOI = 1) was used for recombinant RPA expression. Sf9 cells were grown in Sf-900 III SFM (Gibco, Thermo Fisher Scientific) at 27 °C in an orbital shaker at 140 rpm, and infected for 66–72 h. Cells were collected by centrifugation at 500g for 5 min and washed once with PBS. The cell pellet was resuspended in buffer containing 25 mM HEPES pH 8.0, 0.5 M NaCl, 10% glycerol, 0.01% Tween-20, 20 mM imidazole, Halt protease inhibitor and 0.25 mM TCEP, and sonicated in ice/water slurry at 25 amplitude for 150 s (with 1 s interval to prevent warming) with a qSonica Q700 sonicator. The lysate was clarified by centrifugation at 60,000g for 30 min at 4 °C.

Pre-equilibrated Ni-NTA beads (Qiagen) were added to the lysate and the mixture was incubated on a rotator at 4 °C for 1 h. The beads were pelleted by centrifugation at 500g for 5 min at 4 °C and transferred to a chromatography column. The column was washed extensively with lysis buffer excluding Tween-20 while gradually decreasing the NaCl concentration from 0.5 to 0.2 M. Recombinant RPA was eluted with buffer containing 25 mM Tris-HCl pH 8.0, 0.2 M NaCl, 10% glycerol, 250 mM imidazole, Halt protease inhibitor and 0.25 mM TCEP. The RPA eluate was diluted 2× with the same elution buffer, without NaCl and imidazole, to lower the NaCl concentration to 100 mM. The diluted eluate was then loaded onto a Resource Q column (Cytiva) and eluted with linear gradient of buffer containing 0.1–0.4 M NaCl, 25 mM HEPES pH 8.0, 10% glycerol and 0.25 mM TCEP. Peak fractions containing RPA were loaded onto a Superdex 200 Increase 10/300 GL column (Cytiva) using buffer containing 25 mM HEPES pH 8.0, 200 mM KOAc, 0.5 mM EDTA, 10% glycerol and 0.25 mM TCEP. The protein was collected, aliquoted, snap-frozen in liquid nitrogen and stored at −80 °C.

For RPA1(∆FAB) and RPA2(∆WHD), inverse PCR was used to remove the DBD-F, DBD-A and DBD-B of RPA1 (amino acids 2–440) (primers: DBDC_F and DBDC_R) and the WHD of RPA2 (amino acids 207–270) (primers: RPA2_WHD_F and RPA2_WHD_R). Both deletion mutants were purified using the same method as described for the full-length protein.

Oligonucleotides

All DNA oligonucleotides were HPLC purified (Merck and Integrated DNA Technologies). The names and sequences of the oligos were as follows where FAM is 6-carboxyfluoroscein: RAD52_tag_remove_F (5′-AGCGGCACCGAAGAAGCAATTTTAGG-3′), RAD52_tag_remove_R (5′-CATATGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAGGGG-3′), RAD52_NTD_F (5′-TAAAAGGGCGAGCTCAACGATCCGGCTG-3′), RAD52_NTD_R (5′-ACGACAGCTATTATAACGTGCTTCTTCAACGCTCGG-3′), RAD52_RID_F (5′-CCTCCGGCACCGCCTGTTAC-3′), RAD52_RID_R (5′-ATCCTGATCTGCCGGAATAACTGCATG-3′), RAD52_RQKAAA_F (5′-CGCACAGCTGCAACAGCAGTTTCGTGAACGTATGG-3′), RAD52_RQKAAA_R (5′-GCAGCCAGTTTACGCTGATGGGTTGCTTCGCTTTCAACTGCG-3′), RAD52_C_18D_R (5′-ATTACCGGTGGTACGCTGATCTGCGCTATAGG-3′), DBDC_F (5′-AACTGGAAAACCTTGTATGAGGTCAAATCCGAGAACCTGGG-3′), DBDC_R (5′-CATGGATCCGCGCCCGATGGTGG-3′), RPA2_WHD_F (5′-GCGGCCGCTTTCGAATCTAGAGCCTG-3′), RPA2_WHD_R (5′-AGTGAGGCCATTTGCTGGCATGAAGCTATTCC-3′), SSA1 (5′-TATCGAATCCGTCTAGTCAACGCTGCCGAATTCTACAGAGTTTGGGCTCCTCAACCTGCAGGTT-3′), SSA2 (5′-AACCTGCAGGTTGAGGAGCCCAAACCTCACTGGTAAATTCGCAGCGTTGACTAGACGGATTCGATA-3′), FAM-SSA4 (40nt) (5′-FAM-TATCGAATCCGTCTAGTCAACGCTGCCGAATTCTACCAGT-3′), SSA5 (5′-ACTGGTAGAATTCGGCAGCGTTGACTAGACGGATTCGATA-3′), SSA6 (5′-TGACCATCTTAAGCCGTCGCAACTGATCTGCCTAAGCTAT-3′), SSA7 (5′-CGGCAGCGTTGACTAGACGGATTCGATA-3′), gap 1-1 (5′-CGTGAAGTCGCCGACTGAATGCCAGCAATCTCTTTTTGAGTCTCATTTTGCATCTCGGCAATCTCTTTCTGATTGTCCAGTTGCATTTTAGTAAGCTCTTTTTGATTCTCAAATCCGGCG-3′), gap 1-2 (5′-CGCCGGATTTGAGAATCAAAAAGAGCTTAC-3′) and gap 1-3 (5′-GATTGCTGGCATTCAGTCGGCGACTTCACG-3′). Cy3- and Cy5-labelled and biotinylated oligonucleotides were purchased (Merck). To generate FAM-SSA1/SSA2 dsDNA, equimolar concentrations of FAM-SSA1 and SSA2 were mixed in 10 mM Tris-HCl pH 7.5, 100 mM NaCl and 1 mM EDTA, heated to 90 °C and gradually cooled to room temperature. Gapped DNA was annealed as described using gap 1-1, gap 1-2 and gap 1-3. Concentrations were measured using a spectrophotometer using absorbance values at 260 nm. All DNAs were stored at −20 °C.

Fluorescence anisotropy

DNA-binding reactions (20 μl) were performed at 25 °C in buffer containing 25 mM HEPES pH 8.0, 0.2 M KOAc, 10% glycerol, 0.25 mM TCEP, 1 mM Mg(OAc)₂ and 0.01% Brij-35. Proteins were serially diluted and mixed with 10 nM (final concentration) of FAM-labelled DNA in 384-well microplates (Corning). The plates were measured using the CLARIOstar microplate reader (BMG Labtech). Blank-corrected anisotropy measurements were averaged and plotted against protein concentration. RAD52 binding was curve-fitted using the following quadratic equation in GraphPad Prism 9 to determine K_D values:

$$Y={A}_{\min }+\left({A}_{\max }{-A}_{\min }\right)\times \frac{x+L+{K}_{{\rm{D}}}-\sqrt{{\left(x+L+{K}_{{\rm{D}}}\right)}^{2}-4\times x\times L}\,}{2\times L},$$

where Y is the fluorescence anisotropy, A_min and A_max are the minimum and maximum fluorescence anisotropy values, L is the ligand concentration (equal to 0.01 µM), x is the protein concentration and K_D is the dissociation constant. At least three independent triplicates of technical replicates were performed for each binding condition.

Single-stranded DNA annealing

Reactions (15 μl) contained 5′-³²P-labelled SSA1 (68 nucleotides) with its complementary strand SSA2 (68 nucleotides)³⁰ in 25 mM HEPES pH 8.0, 0.2 M KOAc, 1 mM Mg(OAc)₂, 0.01% Brij-35, 0.25 mM TCEP and 5% glycerol. Two separate 7.5 µl reaction mixtures were set up. One contained 5′-³²P-labelled SSA1 (0.33 nM) in buffer, and the second contained SSA2 (0.33 nM). RPA (0.33 nM) was added to both, as indicated. RAD52 (0.33 nM, or as indicated in figure legends) was added to SSA2 and incubated for 10 min at 25 °C. The two tubes were then mixed and incubated for 10 min at 25 °C, before being stopped by deproteinization using 3 µl of proteinase K (20 mg ml⁻¹ proteinase K in 10 mM Tris-HCl pH 7.5 and 1 mM CaCl₂) and incubated at 30 °C for 30 min. The samples were supplemented with Ficoll loading buffer and analysed by PAGE with TBE as the running buffer. Gels were dried and exposed to phosphorimaging plates and images acquired using the Typhoon FLA 9500 biomolecular imager (GE) and quantified using ImageJ^50,51.

For reactions using 40-nucleotide ssDNA (5′-³²P-labelled SSA4 with complimentary SSA5), the reactions were set up as described above except that the concentration of ssDNA was lowered to 0.13 nM to prevent self-annealing of ssDNA, and 0.13 nM of RPA was used. Concentrations of RAD52 are indicated in figure legends.

To determine whether DNA ends were required for RAD52-OR mediated annealing, interactions between 0.33 nM circular φX174 virion ssDNA and 0.33 nM ³²P-labelled gapped duplex DNA (a 60-nucleotide-long ssDNA that had 30-mers annealed to each end) were analysed. For these experiments, RPA (0.33 nM or 19.9 nM) was premixed with the gapped and circular ssDNAs, respectively (to provide similar coverage). RAD52 was then added to the gapped ssDNA and annealing was measured by electrophoresis through a 1% agarose gel using TAE buffer.

To analyse ssDNA annealing using size-exclusion chromatography, RAD52-OR (4 µM) was preloaded on SSA2–Cy5 (4 µM, 12.5 µl) before an equal volume of Cy3–SSA1 (4 µM) was added. After 30 min on ice, the reaction was loaded onto the Superdex 200 Increase 3.2/300 column connected to the ÄKTA pure Micro system. Chromatography was performed at 4 °C with buffer containing 25 mM HEPES pH 8.0, 200 mM KOAc, 0.25 mM TCEP and 1 mM Mg(OAc)₂.

Biolayer interferometry analysis

40-nucleotide (SSA4) ssDNA was biotinylated at either the 5′ or 3′ end (indicated as bio–ssDNA or ssDNA–bio, respectively). 68-nucleotide (SSA1) ssDNA was biotinylated at the 3′ end (indicated as SSA1–bio), and 28 nucleotides of complementary ssDNA was annealed to the 5′ end to protect the 5′ ssDNA end (indicated as ds-ssDNA–bio). The experiments were performed using the Octet R8 system (Sartorius) at 25 °C in buffer containing 25 mM HEPES pH 8.0, 200 mM KOAc, 0.01% Tween-20, 1 mM Mg(OAc)₂ and 0.25 mM TCEP. The biotinylated DNA substrates (5 nM) were immobilized onto Octet SA streptavidin biosensors until a 0.05 threshold, and the sensors were then moved to wells containing a range of RAD52 concentrations (20, 10, 5, 2.5, 1.25, 0.625 and 0.312 nM). The association of RAD52 to DNA was recorded for 60 min and the dissociation for 5 min using the Octet BLI Discovery Software. Equilibrium dissociation constants (K_D) were obtained by plotting association amplitudes at equilibrium versus protein concentration (Octet Analysis Studio Software; Sartorius) and plotted in GraphPad Prism 9. The following 1:1 binding equation was used to determine K_D values: using the following quadratic equation in GraphPad Prism 9 to determine K_D values:

$$Y={B}_{\max }\times X/({K}_{D}+X),$$

where Y is the association amplitude, B_max is the maximum amplitude at saturation, X is the protein concentration and K_D is the dissociation constant. Three independent triplicates were performed for each binding condition.

CD analysis

Far-UV CD measurements were performed on a Jasco J-815 spectropolarimeter fitted with a cell holder temperature-regulated by a CDF-426S Peltier unit. Spectra were recorded at 20 °C at protein concentrations of 3.3 µM (RAD52-OR) and 3.2 µM (RAD52-CR) in 10 mM potassium phosphate buffer pH 8.0, 100 mM NaF and 0.25 mM TCEP. Fused silica cuvettes were used with a 1 mm path length (Hellma). Spectra were recorded at a resolution of 0.2 nm and were baseline corrected by subtraction of the appropriate buffer spectrum. CD intensities are presented as the molar CD extinction coefficient (∆ε_M) calculated as:

$${\Delta \varepsilon }_{{\rm{M}}}=\frac{S}{\mathrm{32,980}\times {c}_{{\rm{M}}}\times L}\left({\rm{units:}}{{\rm{M}}}^{-1}{{\rm{cm}}}^{-1}\right),$$

where S is the signal in millidegrees, c_M is the molar concentration and L is the path length (in cm). Secondary structure content was estimated as described⁵².

Intact protein MS

Proteins were diluted to 1 µM with 0.1% (v/v) formic acid and injected onto a C4 BEH 1.7 µm, 1.0 × 100 mm, UPLC column using the Acquity I class LC (Waters) system. Proteins were eluted with a 15 min gradient of acetonitrile (2% (v/v) to 80% (v/v)) in 0.1% (v/v) formic acid using a flow rate of 50 µl min⁻¹. The analytical column outlet was directly interfaced through an electrospray ionization source, with a time-of-flight (TOF) mass spectrometer (BioAccord, Waters). Data were acquired over a m/z range of 300–8,000, in positive-ion mode with a cone voltage of 40 V. Scans were summed together manually and deconvoluted using MaxEnt1 (Masslynx, Waters). The parameters used were as follows; input m/z range (Da): 600–2,000; output mass range (Da): 30000–60000; TOF resolution: 10000.00; and iterate to convergence.

GuHCl denaturation and renaturation

RAD52 (purified to the HiTrap Q step) was dialysed into 25 mM HEPES pH 7.0, 6 M GuHCl, 0.5 mM EDTA and 2 mM β-mercaptoethanol overnight at 4 °C. The denatured protein was analysed using a Superose 6 Increase 10/300 GL column, which was run with 6 M GuHCl buffer. Protein was renatured by dialysis in native buffer (25 mM HEPES pH 7.0, 200 mM NaCl, 0.5 mM EDTA and 2 mM mercaptoethanol) for 24 h at 4 °C. The renatured RAD52 was then run on the same column using native buffer. To analyse the percentage of open and closed rings, the renatured RAD52 sample was loaded onto the Resource S column.

Negative-stain EM sample preparation and data acquisition

Samples (4 µl, 25 ng µl⁻¹) were applied for 1 min to glow discharged (25 mA, 30 s) 400-mesh carbon-coated copper grids (C400Cu100, EM Resolutions). The grids were sequentially stained in four separate 30 µl droplets of 2% (v/v) uranyl acetate for 10, 15, 20 and 25 s. Excess uranyl acetate was blotted away from the grid using Whatmann paper, allowed to air dry and stored before imaging.

The grids were imaged on the Tecnai LaB₆ G2 Spirit TEM operating at 120 kV equipped with a 2K Gatan Ultrascan 1000 camera. Micrographs were acquired manually using DigitalMicrograph at a nominal magnification of ×30,000 (3.5 Å per pixel) or ×42,000 (2.4 Å per pixel) with defocus values ranging from −0.7 to −1.5 µm.

Negative-stain EM data analysis

DM3 files were converted to MRC format using e2proc2d.py (EMAN2)⁵³. Micrographs were imported into Relion 3.1 or 4.1^54,55, CTF parameters were calculated using CTFFIND4⁵⁶, and particles were picked using crYOLO⁵⁷ or Topaz⁵⁸. Particles were extracted and iteratively 2D classified (ignore CTF to first peak = yes, limit resolution E-step = 20 Å, additional arguments = –only-flip-phases).

Cryo-EM sample preparation

Recombinant RAD52 and RPA were purified to the Resource S or Resource Q step, and freshly purified on the Superose 6 Increase 10/300 GL or Superdex 200 Increase 10/300 GL column before making the cryo-EM grids. For RAD52-CR, the protein was in a buffer containing 25 mM HEPES pH 7.0, 150 mM NaCl and 0.25 mM TCEP, diluted to 0.3 mg ml⁻¹, and supplemented with 0.00005% Tween-20. A sample (4 μl) was applied to freshly glow-discharged (45 mA, 60 s; Quorum Emitech K100X) Quantifoil R2/1 300 mesh copper grids and vitrified using a Vitrobot Mark IV (Thermo Fisher Scientific) cooled to 4 °C with 95% humidity. Grids were double-side blotted for 0.5 s and plunge frozen in liquid ethane. For RAD52-OR, the grids were prepared as described above except Quantifoil R2/2 200 mesh copper grids were used, and the concentration was 0.25 mg ml⁻¹, the Tween-20 concentration was 0.001%, and blot time was 1.5 s. For RAD52-OR–ssDNA, the protein (0.25 mM) was diluted to 0.5 µM in 25 mM HEPES pH 8.0, 150 mM NaCl, 2 mM Mg(OAc)₂ and supplemented with 0.05% octyl-β-glucoside (OG). SSA4 (1 µM) was added and incubated at 25 °C for 10 min. The concentration was determined by Bradford assay (Bio-Rad) and diluted to 0.15 mg ml⁻¹ with the same buffer. Grids were prepared as above except Quantifoil R1.2/1.3 300 mesh copper grids were used and the blot time was 2.5 s. For RPA–ssDNA, the protein (0.25 mM), in 25 mM HEPES pH 8.0, 150 mM NaCl, 2 mM Mg(OAc)₂, was diluted to 3 µM, and supplemented with 0.1 mM CHAPSO. SSA7 (6 µM) was added and incubated at 25 °C for 10 min. The concentration was determined using the Bradford assay (Bio-Rad) and diluted to 0.15 mg ml⁻¹ with the same buffer. UltrAuFoil R2/2 200 mesh gold grids (Quantifoil) were prepared as described above and the blot time was 2.5 s. The RAD52-OR–ssDNA–RPA ternary complex was assembled as indicated in the ‘Reconstitution of the RAD52–ssDNA–RPA complex’ section below. The concentration was determined using the Bradford assay (Bio-Rad) and diluted to 0.1 mg ml⁻¹ with buffer supplemented with 0.00075% Tween-20 and 0.075 mM CHAPSO. Quantifoil R2/2 200 mesh copper grids were prepared as described above, except the blot time was 3 s.

Cryo-EM data collection, image processing and atomic model building

RAD52-CR and RAD52-OR datasets were collected on a Titan Krios Cryo-TEM equipped with a Falcon III direct electron detector (Thermo Fisher Scientific) at the Francis Crick Institute Structural Biology STP. The RAD52-OR–ssDNA dataset was collected on a Titan Krios G3i (FEI, Thermo Fisher Scientific) equipped with a Gatan K3 direct electron detector at the London consortium for cryo-EM (LonCEM). RPA–ssDNA and RAD52-OR–ssDNA–RPA datasets were collected on a Titan Krios Cryo-TEM (Thermo Fisher Scientific) equipped with a K2 direct electron detector (Gatan) at the Francis Crick Institute Structural Biology STP.

Single-particle analyses were performed within Relion (v.4.0)⁵⁴ and CryoSPARC⁵⁹. The videos were corrected for drift and dose-weighted using RELION’s own implementation of MOTIONCOR2⁶⁰ and subsequent contrast transfer (CTF) parameters were measured using CTFFIND4⁵⁶. Particles were picked automatically using crYOLO⁵⁷ or Topaz⁵⁸. Details of image processing are illustrated in Extended Data Figs. 3, 4, 5, 8 and 9. In brief, several rounds of 2D classification were performed to remove particles that cannot be aligned to yield defined 2D averages. Several rounds of 3D classifications were performed to separate different conformations or particles that cannot be aligned to yield high-resolution 3D volumes. 3D auto-refine, Bayesian polishing (minimum two rounds) and CTF refinement (minimum one round) were performed iteratively to achieve high resolution 3D reconstruction in RELION^61,62. Polished particles were imported to CryoSPARC⁵⁹, and refined using non-uniform refinement⁶³. 3D variability⁶⁴ or 3D classifications were performed to detect heterogeneity within the cryo-EM densities. The cryo-EM maps were sharpened by post-processing in RELION, CryoSPARC or DeepEMhancer⁶⁵ if there was high variability in local resolution. The overall resolution is reported at FSC = 0.143 (ref. ⁶⁶).

All model building was performed using Phenix^67,68, COOT⁶⁹ and ISOLDE⁷⁰ in ChimeraX⁷¹. For RAD52-CR, the crystal structure of the RAD52 NTD (PDB: 1H2I) was placed into a sharpened RAD52-CR cryo-EM map in ChimeraX⁷¹ and initially refined using Namdinator⁷². One RAD52 subunit was removed from RAD52-CR and used for initial refinement in Namdinator for RAD52-OR. ssDNA was built manually in COOT into the RAD52-OR model using RAD52-OR–ssDNA as a starting model. RPA1, RPA2 and RPA3 AlphaFold2 models were used for Dock and rebuild in Phenix^73,74 and the ssDNA model was aligned and extracted from the fungal RPA structure (PDB: 4GOP)³⁹. The RAD52-OR–ssDNA model was used as the initial model for RAD52-OR–ssDNA–RPA.

SEC–MALLS analysis

SEC–MALLS was used to determine the molar mass composition of RAD52. Purified RAD52-OR (2.0, 1.0 or 0.5 mg ml⁻¹) was loaded onto a Superose 6 Increase 10/300 GL column connected to a Jasco chromatography system. Chromatography was performed at 25 °C with buffer containing 25 mM HEPES pH 7.0, 150 mM NaCl, 0.25 mM TCEP and 3 mM NaN₃ at a flow rate of 1.0 ml min⁻¹. RAD52-OR–ssDNA (2 mg ml⁻¹) was analysed in a similar manner using 25 mM Bis-Tris propane pH 8.5, 200 mM NaCl, 5 mM MgCl₂, 0.25 mM TCEP and 3 mM NaN₃ as the running buffer. The scattered light intensity and protein concentrations of the column eluates were recorded using a DAWN-HELEOS laser photometer and an OPTILAB-rEX differential refractometer (dn/dc = 0.186). The weight-averaged molecular mass of material contained in chromatographic peaks was determined using the combined data from both detectors in the ASTRA software v.7.3.2 (Wyatt Technology).

Nuclear/chromatin extraction and analysis

U2OS cells (authenticated and microplasma free, as determined by the Francis Crick Institute) were grown in DMEM (Gibco) supplemented with 10% FBS (Gibco) in humidified incubators at 37 °C and 5% CO₂. Cells were collected from four confluent 500 cm² square dishes and washed once with PBS. The pellet was supplemented with 5× pellet volume of CSK buffer (10 mM PIPES pH 6.8, 100 mM NaCl, 3 mM MgCl₂, 300 mM sucrose, 1 mM EGTA, 0.5% Triton X-100 and 0.25 mM TCEP) supplemented with Halt protease and phosphatase inhibitors, incubated on ice for 10 min and centrifuged at 2,000g for 5 min at 4 °C. The supernatant was collected as the first CSK extract. A 3× pellet volume of CSK buffer (containing 0.1% Triton X-100) was added to the pellet, incubated on ice for 10 min and the sample was centrifuged at 3,000g for 5 min at 4 °C. The supernatant was collected as the second CSK extract. An equal volume of benzonase digestion buffer (20 mM HEPES pH 8.0, 2 mM MgCl₂, 0.5% Triton X-100, 0.25 mM TCEP and 500 units benzonase/100 µl of buffer) supplemented with Halt protease and phosphatase inhibitors was added to the pellet and incubated on ice for 10 min. A 2× sample volume of high-salt buffer (20 mM HEPES pH 8.0, 600 mM NaCl and 0.25 mM TCEP) supplemented with Halt protease and phosphatase inhibitors was then added, incubated on ice for 10 min, and the sample was centrifuged at 21,000g for 10 min at 4 °C. The supernatant was collected as a nuclear/chromatin extract.

Glycerol gradients (5 ml, 10–30%) in 25 mM HEPES pH 8.0, 150 mM NaCl, 10–30% glycerol and 0.25 mM TCEP were cast in thin-wall polypropylene tubes (Beckman Coulter) using a Gradient Master (Biocomp) and kept in the cold room overnight to equilibrate to 4 °C. U2OS nuclear/chromatin extracts (200 µl), 200 ng recombinant RAD52-OR or a gel-filtration calibration marker (Cytiva) was loaded gently onto the top of three gradients, which were then centrifuged at 4 °C and 55,000 rpm (368,000g) using SW 55 Ti rotor (Beckman Coulter) for 4 h. The fractions were collected by manual pipetting from the top of the gradients. The U2OS nuclear/chromatin extract (500 µl), 500 ng recombinant RAD52-OR or a gel-filtration calibration marker (Cytiva) were also loaded onto the pre-equilibrated Superose 6 Increase 10/300 GL column (Cytiva). Chromatography was performed with a buffer containing 25 mM HEPES pH 8.0, 150 mM NaCl, 10% glycerol and 0.25 mM TCEP at 4 °C. Fractions were collected and analysed by SDS–PAGE followed by western blotting using antibodies against RAD52 (rabbit monoclonal, 1:500, Abcam, ab124971). Alexa Fluor Plus 800 anti-rabbit secondary antibodies (1:2,000, Invitrogen, A32735) were used and the membranes were imaged using an Odyssey DLx instrument with ImageStudio software (Licor).

RAD52 Resource S chromatogram peak fitting

Resource S chromatography was performed as described above except a linear gradient of 0.2–0.6 M NaCl was used. The UV₂₈₀ absorbance values were imported into GraphPad Prism 9 and curved fitted using a sum of two Gaussians equation to deconvolute open- and closed-ring peaks:

$$Y={\rm{amplitude}}\times \exp \left(-0.5\times {\left(\frac{X-{\rm{mean}}}{{\rm{s.d.}}}\right)}^{2}\right)+\mathrm{amplitude\; 2}\times \exp \left(-0.5{\left(\frac{X-\mathrm{mean\; 2}}{\mathrm{s.d.\; 2}}\right)}^{2}\right)$$

RAD52–ssDNA–RPA pull downs

The RAD52–ssDNA–RPA ternary complex (400 μl) was reconstituted in buffer containing 25 mM HEPES pH 8.0, 200 mM KOAc, 2 mM Mg(OAc)₂, 0.01% Tween-20 and 0.25 mM TCEP. Biotin-labelled SSA4 (0.1 μM), with photo-cleavable linker (Integrated DNA Technologies), and recombinant RPA (0.15 μM) were mixed and incubated on ice for 10 min. RAD52-OR (0.15 μM) was then added and incubation continued for a further 10 min. Pre-washed Streptavidin Sepharose Mag beads (10 μl, Cytiva) were then added and incubated for 30 min on a head-to-toe rotator at 4 °C. The beads were washed once with reaction buffer and then with reaction buffer Tween-20. The beads were resuspended in 20 μl reaction buffer, and irradiated with 365 nm UVA on ice/water slurry to cleave the photo-cleavable linker.

Reconstitution of the RAD52–ssDNA–RPA complex

RAD52-OR (purified to the Resource S step) and RPA (purified to the Resource Q step) were loaded onto the Superose 6 Increase 10/300 GL (Cytiva) and Superdex 200 Increase 10/300 GL (Cytiva) columns, respectively, and run with buffer containing 25 mM HEPES pH 8.0, 150 mM NaCl, 2 mM Mg(OAc)₂ and 0.25 mM TCEP. The reconstitution mixture for cryo-EM was supplemented with 0.00075% Tween-20 and 0.075 mM CHAPSO, whereas the XL-MS sample was supplemented with 0.05% OG. Reconstitution of the RAD52-OR–ssDNA–RPA ternary complex involved two steps: (1) RPA (1 µM final concentration) was added to SSA1 (0.5 µM final concentration) and incubated at 25 °C for 10 min; and (2) RAD52-OR (0.5 µM final concentration) was added and incubated at 25 °C for 30 min. The sample was centrifugated at 21,000g for 1 min at 4 °C before proceeding with cryo-EM grid preparation and XL-MS.

Protein disorder prediction

The human RAD52 protein sequence (UniProt: P43351) was uploaded to the ODiNPred⁷⁵ webserver (https://st-protein.chem.au.dk/odinpred). The predicted disorder probability of each residue was plotted in GraphPad Prism 9.

Multiple-sequence alignment

RAD52 protein sequences from different organisms were aligned with Clustal Omega using the default settings⁷⁶. The alignment was formatted with ESPript3.0⁷⁷.

XL-MS analysis

RAD52-OR and RAD52-OR–ssDNA–RPA ternary complexes (0.5 µM, reconstituted as above) were supplemented with a 1:100 molar ratio of disuccinimidyl dibutyric urea (DSBU: 50 µM) for 1 h at room temperature, before the mixture was quenched by the addition of NH₄HCO₃ to a final concentration of 20 mM (15 min at room temperature). The cross-linked proteins were reduced with 10 mM dithiothreitol and alkylated with 50 mM iodoacetamide. They were then digested with trypsin at an enzyme-to-substrate ratio of 1:100, for 1 h at room temperature and further digested overnight at 37 °C after addition of trypsin at a ratio of 1:20. The peptide digests were then fractionated batch-wise by high pH reverse-phase chromatography on micro spin TARGA C18 columns (Nest Group) into four fractions (10 mM NH₄HCO₃/10% (v/v) acetonitrile pH 8.0; 10 mM NH₄HCO₃/20% (v/v) acetonitrile pH 8.0; 10 mM NH₄HCO₃/40% (v/v) acetonitrile pH 8.0; and 10 mM NH₄HCO₃/80% (v/v) acetonitrile pH 8.0). The fractions (150 µl) were evaporated to dryness in a CentriVap concentrator (Labconco) before analysis by LC–MS/MS.

Lyophilized peptides were resuspended in 1% (v/v) formic acid and 2% (v/v) acetonitrile and analysed by nano-scale capillary LC-MS/MS using a Vanquish Neo UPLC (Thermo Fisher Scientific, Dionex) to deliver a flow of approximately 300 nl min⁻¹. A PepMap Neo C18 5 μm, 300 μm × 5 mm nanoViper (Thermo Fisher Scientific, Dionex) trapped the peptides before separation on a 25 cm EASY‐Spray column (25 cm × 75 µm inner diameter, PepMap C18, 2 µm particles, 100 Å pore size, Thermo Fisher Scientific). Peptides were eluted with a gradient of acetonitrile. The analytical column outlet was directly interfaced through a nano-flow electrospray ionization source, with a quadrupole Orbitrap mass spectrometer (Orbitrap Exploris 480, Thermo Fisher Scientific). MS data were acquired in data-dependent mode using a top ten method, where ions with a precursor charge state of 1+ and 2+ were excluded. High-resolution full scans (R = 60,000, m/z 380–1,800) were recorded in the Orbitrap followed by higher-energy collision dissociation (HCD) (stepped collision energy 30 and 32% normalized collision energy) of the ten most intense MS peaks. The fragment ion spectra were acquired at a resolution of 30,000 and a dynamic exclusion window of 20 s was applied.

For data analysis, Xcalibur raw files were converted into the MGF format using Proteome Discoverer v.2.3 (Thermo Fisher Scientific) and used directly as input files for MeroX⁷⁸. Searches were performed against an ad hoc protein database containing the sequences of the proteins in the complex and a set of randomized decoy sequences generated by the software. The following parameters were set for the searches: maximum number of missed cleavages: 3; targeted residues K, S, Y and T; minimum peptide length 5 amino acids; variable modifications: carbamidomethylation of cysteine (mass shift 57.02146 Da), methionine oxidation (mass shift 15.99491 Da); DSBU modified fragments: 85.05276 Da and 111.03203 Da (precision: 5 ppm MS and 10 ppm MS/MS); false-discovery-rate cut-off: 5%. Finally, each fragmentation spectrum was manually inspected and validated.

To compare with the peptide array experiments, the number of cross-links detected for each amino acid residue was counted, and summed within an individual 20 amino acid peptide with a 1 amino acid shift, similar to the peptide array. The overlayered result was plotted using GraphPad Prism 9.

Peptide array

Peptides (20 amino acids) with 1-amino-acid shift covering the full sequences of RAD52, RPA1, RPA2 and RPA3 were synthesized on cellulose membranes in 3 mm spots by the Chemical Biology STP at the Francis Crick Institute. The membranes were washed with 50% ethanol and 10% acetic acid for 30 min and equilibrated with 1× TBST (50 mM Tris-HCl pH 7.5, 150 mM NaCl and 0.1% Tween-20) supplemented with 0.25 mM TCEP. The membrane was blocked with 5% non-fat milk in TBST (0.1% Tween-20) supplemented with 0.25 mM TCEP for 1 h at room temperature. To allow protein-peptide interactions, the membranes were incubated with RAD52-OR or RPA (1 µg ml⁻¹) in 1% non-fat milk in TBST (0.1% Tween-20) supplemented with 0.25 mM TCEP overnight at 4 °C. The membranes were washed in 1× TBST (0.1% Tween-20) supplemented with 0.25 mM TCEP on an orbital shaker for 5 min at room temperature three times. The membranes were then incubated in primary antibodies (anti-His 1:1,000, Takara, 631212) in 1% non-fat milk in TBST (0.1% Tween-20) supplemented with 0.25 mM TCEP for 2 h at room temperature. The membranes were washed three times as before and incubated in Alexa-Fluor-Plus-conjugated secondary antibodies (goat anti-mouse 1:2,000, Thermo Fisher Scientific, A32730; goat anti-rabbit, 1:2,000, Thermo Fisher Scientific, A32735) in 1% non-fat milk in TBST (0.1% Tween-20) supplemented with 0.25 mM TCEP for 1 h at room temperature. The membranes were washed three times, imaged on a Li-Cor Odyssey DLx system and quantified using Image Studio Lite (Li-Cor).

Nanoscale differential scanning fluorometry

A Prometheus NT-48 (Nanotemper) instrument was used to monitor changes in tryptophan fluorescence following thermal denaturation. Proteins were diluted to 10 µM in 25 mM HEPES pH 8.0, 200 mM KOAc, 0.5 mM EDTA, 10% glycerol and 0.25 mM TCEP. The samples were loaded into high-sensitivity glass capillaries and the tryptophan fluorescence was monitored at 330 and 350 nm after excitation at 285 nm. Measurements were made from 25 to 95 °C with a temperature gradient of 1 °C min⁻¹. The ratio of fluorescence intensity (350/330 nm) was plotted against temperature, and the first derivative of this curve was used to calculate thermal melting (T_m) values.

Statistics and reproducibility

Statistical analyses were performed using GraphPad Prism 9. Normally distributed data were compared using two-tailed unpaired t-tests whereas non-normally distributed data were compared using two-tailed Mann–Whitney U-tests. Differences were considered to be statistically significant when P < 0.05. Reported n values refer to independent experiments for fluorescence anisotropy, biolayer interferometry analysis and SSA assays. Glycerol gradient sedimentation analysis and size-exclusion chromatography of U2OS nuclear extract recombinant RAD52-OR were repeated independently seven times with similar results. RAD52–ssDNA–RPA pull-down experiments were repeated independently five times with similar results. RAD52 purifications were repeated independently more than 50 times with similar results. RPA purifications were repeated for ten times with similar results. Purifications of RAD52 and RPA mutants were repeated for twice with similar results.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

[ad_2]

Source link

Streptomyces umbrella toxin particles block hyphal growth of competing species

[ad_1]

Bacterial strains and culture conditions

A complete list of strains used in this study can be found in Supplementary Table 6, and all strains generated in this study are available upon request from the corresponding author. Escherichia coli strain DH5α was used for plasmid maintenance, strain ET12567 (pUZ8002) for interspecies conjugation and strain Rosetta(DE3) for protein expression. E. coli strains were grown in Lysogeny broth (LB) at 37 °C with shaking or on LB medium solidified with 1.5% w/v agar. S. aureus strain RN4220 was used for plasmid maintenance and protein expression. S. aureus was grown in B2 broth, LB supplemented with 0.2% (w/v) glucose (LBG) or on LBG solidified with 1.5% (w/v) agar. Strain S. coelicolor A3(2) was used in Umb characterization studies. Unless otherwise noted, this and other Streptomyces spp. used were cultivated in R5 or TSBY liquid medium at 28 °C in baffled flasks with glass beads (3 mm diameter) shaking at 220 r.p.m. or on TSB, ISP2, ISP4 or SFM solidified with 1.5% w/v agar. Growth conditions of diverse bacterial species used in the broad Umb sensitivity screen can be found in Supplementary Table 5. Media were supplemented as needed with antibiotics at the following concentrations: carbenicillin (150 µg ml⁻¹, E. coli), apramycin (50 µg ml⁻¹, E. coli and Streptomyces), kanamycin (50 µg ml⁻¹, E. coli), gentamicin (15 µg ml⁻¹, E. coli), trimethoprim (50 µg ml⁻¹, E. coli and Streptomyces), chloramphenicol (25 µg ml⁻¹, E. coli; 10 µg ml⁻¹, S. aureus) and hygromycin (25 µg ml⁻¹, E. coli).

Plasmid construction

Plasmids used in this study, details of plasmid construction and primers used in this work are provided in Supplementary Table 6. Plasmids generated in this study are available upon request from the corresponding author. Primers and synthetic DNA fragments were obtained from Integrated DNA Technologies. All plasmid constructs were designed using Geneious Prime and generated using Gibson assembly, and all constructs were confirmed by sequencing. For heterologous expression of Umb complex proteins in E. coli, the genes were amplified and inserted into NcoI-digested and XhoI-digested pET-22b(+) or NdeI-digested and XhoI-digested pET-28b(+) to generate C-terminal or N-terminal hexahistidine fusions, respectively. VSV-G fusions, point mutations and linkers were introduced to genes amplified from the S. coelicolor genome through the cloning primers. umbC1(ring) expression plasmids were constructed by amplifying ALF1–ALF4 (residues A46–A241) and ALF5–ALF8 (residues A532–H798) as two DNA fragments with a linker of two GGGGS repeats introduced in the cloning primers.

Plasmids used for the heterologous expression of UmbC1 and UmbD1 in E. coli for mutational profiling were pSCrhaB2 and pPSV39-CV, respectively. To generate these plasmids, the genes were amplified from synthesized DNA fragments codon optimized for expression in E. coli. Plasmid pEPSA5 was used for the heterologous expression of various umbC toxin domains in S. aureus. The toxin domain was either inserted into digested plasmid alongside a N-terminal 3×Flag tag fragment or alongside a signal-sequence-containing 3×Flag tag fragment, with a N-terminal 3×Flag tag being introduced through the cloning primers. These Gibson reactions were transformed into S. aureus RN4220 through electroporation, and transformants were maintained in LB supplemented with 0.2% w/v glucose (to repress toxin expression) and chloramphenicol.

S. coelicolor genetic manipulation was conducted using a derivative of the suicide vector pKGLP2 (ref. ³²), in which the hygromycin-resistance cassette (hyg) was replaced with the apramycin resistance gene (aac(3)IV) and the promoter from pSET152 (ref. ³³). This plasmid, pKGLP2a, was generated by amplifying the vector backbone of pKGLP2 and the apramycin resistance cassette from pSET152 by PCR and combining by Gibson assembly. Constructs for introducing deletions, epitope tags and point mutations in the S. coelicolor genome with pKGLP2a were generated using Gibson assembly of 1.5–2 kb arms flanking the site of modification. Complementation of the umbC2 mutation in S. coelicolor was performed using pSET152, into which umbC2 and its native promoter were cloned using Gibson assembly.

Structural modelling of Umb proteins and PPIs

Structural predictions for UmbC1–UmbC3, UmbA1–UmbA5 and UmbB1–UmbB3 were made using AlphaFold2 (ref. ¹⁸). MSAs were generated by running hhblits³⁴ against UniRef30 (ref. ³⁵) and BFD³⁶. These multiple sequence alignments (MSAs) were uploaded to ColabFold³⁷ and a total of five AlphaFold predictions were generated for each target. Only UmbC3 generated predictions that were consistent with the cryo-EM density of the protein, whereas models for UmbC1 and UmbC2 all resulted in the long coiled-coil folding back on itself. This result prompted the decision to use the UmbC3 model as a template structure for predicting UmbC1 and UmbC2, which enabled the generation of models with a straight coiled-coil consistent with the cryo-EM density. The models with highest predicted local distance difference test (lDDT) were selected for each.

RoseTTAFold2 (ref. ³⁸) was used to predict UmbA–UmbB protein complex structures. MSAs were generated as described above for UmbC1–UmBC3. Paired MSAs for all UmbA–UmbB pairs were generated by matching taxonomy identifiers according to previously published methods³⁹. These paired MSAs were provided as inputs to RoseTTAFold2 and produced confident predictions in all cases (predicted lDDTs > 0.8). A similar method was used to compute predictions for interactions between UmbB and individual ALF repeats of UmbC1–UmbC3. In brief, MSAs were generated for UmbB1, UmbB2, UmbB3, UmbC1, UmbC2 and UmbC3 by running HHblits³⁴ against Uniref30 and BFD, and paired MSAs for all three pairs were generated by maxing taxonomy identifiers. Then, predictions were made for each UmbB model against each of the eight ALF repeats of the corresponding UmbC model. Rather than regenerating the MSA for individual repeats, the paired full-length MSA was trimmed over the region of each repeat.

Owing to the availability of cryo-EM data, models for UmbC1–UmbB1 were generated first. Three different variants of repeat modelling were attempted: (1) trimming to exactly the two-helix repeat; (2) extending by five residues on either side of the repeat; and (3) extending by ten residues on either side of the repeat. To evaluate each modelling variant, the predicted structure and predicted interface error of the UmbC–UmbB interface¹⁸ were considered. All three trimming approaches produced results consistent with the EM data, but the most distinct signal in terms of interfacial predicted interface error was achieved by adding in ten residues of padding. This strategy was applied to UmbC2–UmbB2 and UmbC3–UmbB3.

Construction of genetically modified Streptomyces strains

The pKGLP2a suicide plasmid was used to generate genetically modified S. coelicolor strains, including gene deletion mutants and strains expressing chromosomally encoded, epitope-tagged proteins as previously described³², with modifications described below. Genetic modification constructs were transferred to S. coelicolor by intergeneric E. coli–Streptomyces conjugation using donor strain E. coli ET12567 (pUZ8002) as previously described⁴⁰. In brief, overnight cultures of E. coli ET12567 (pUZ8002) harbouring the plasmid to be transferred were grown in LB supplemented with chloramphenicol, kanamycin and apramycin. These cultures were washed, concentrated and combined with Streptomyces spores following a 10-min 50 °C heat-shock treatment. The mixture was plated on SFM medium supplemented with 10 mM MgCl₂ and incubated at 30 °C for 16–20 h. The plate was then overlaid with 1 ml sterilized dH₂O supplemented with trimethoprim and apramycin. Incubation was continued at 30 °C until transconjugants appeared and were restreaked onto medium supplemented with trimethoprim and apramycin. Confirmed transconjugants were grown in non-selective TSBY medium for about 36 h. These cultures were then restreaked on non-selective SFM agar and incubated at 30 °C for 7 days to produce spores. Spores were then collected, diluted and plated on SFM agar supplemented with 50 mg l^–1 5-bromo-4-chloro-3-indolyl-b-d-glucuronide. After incubation for 36 h, white colonies were screened for the presence of the desired allele by PCR. Apramycin-resistant S. griseus and complemented S. coelicolor ΔumbC2 were generated through intergeneric transfer of the integrative vector pSET152 or pSET152::umbC2, respectively, delivered through conjugation in a similar manner to pKGLP2a.

IP–MS analysis of UmbC-interacting proteins from S.
coelicolor

Spores of S. coelicolor strains containing umbC1–V, umbC3–V or umbA1–V at the native loci were inoculated in R5 medium and grown for 36 h then back diluted 1:200 in 50 ml R5 medium and further grown for 24–30 h until the optical density at 600 nm (OD₆₀₀) reached 3–4. Spores of S. coelicolor containing umbC2–V at the native locus were inoculated in 50 ml TSBY medium and grown for approximately 36 h until the OD₆₀₀ reached 4–5. For each strain, 10 ml of the cell culture, including both the cells and culture supernatant, was then mixed with 2.5 ml 5× lysis buffer (750 mM NaCl, 100 mM Tris-HCl pH 7.5, 10% glycerol (v/v), 1 mg ml⁻¹ lysosome and 1 mU benzonase). Cells were lysed by sonication and the cellular debris was removed by centrifugation at 35,000g for 30 min. VSV-G-tagged proteins were enriched by incubation of cell lysates with 40 μl anti-VSV-G agarose beads at 4 °C for 4–5 h with constant rotation. The agarose beads were then pelleted by centrifugation at 300g for 2 min, washed 3 times with 10 ml wash buffer (150 mM NaCl, 2% glycerol (v/v) and 20 mM Tris-HCl pH 7.5) and then washed 3 times with 10 ml 20 mM ammonium bicarbonate. Anti-VSV-G agarose beads and bound proteins were then treated with 10 μl of 10 μg μl^–1 sequence-grade trypsin (Promega) for 16 h at 37 °C with gentle shaking. After digestion, the agarose beads and peptides were gently mixed and centrifuged at 300g for 2 min. After collection of the supernatant, 90 μl of 20 mM ammonium bicarbonate was added to the beads, gently mixed and centrifuged again. The supernatant was collected and combined as the peptide fraction. The mixture was reduced with 5 mM tris(2-carboxyethyl) phosphine hydrochloride for 1 h at 37 °C, followed by alkylation using 14 mM iodoacetamide for 30 min in the dark at room temperature. The alkylation reaction was quenched by adding 5 mM 1,4-dithiothreitol. Acetonitrile (ACN) and trifluoroacetic acid (TFA) were added to the samples for a final concentration of 5% (v/v) and 0.5% (w/v), respectively. Then, the samples were applied to MacroSpin C18 columns (7–70 μg capacity) that had been charged with 100% ACN, LC–MS-grade water and 0.1% TFA. Bound peptides were washed twice with 0.1% TFA and then eluted with 80% ACN with 25 mM formic acid. The dried peptides were dissolved in 5% ACN with 0.1% formic acid and analysed by LC–MS/MS as previously described⁴¹. Data were analysed using MaxQuant⁴², and filtered to remove noise from low abundance proteins with five or fewer spectral counts in IP samples. Enrichment of proteins in the IP samples was determined by dividing the relative abundance of each protein passing the filtering criteria in the IP samples by its relative abundance in the control.

Purification of heterologously expressed Umb proteins

A subset of the PPI studies and the protease activity assay used purified, heterologously expressed Umb proteins. To purify these proteins, overnight cultures of E. coli Rosetta(DE3) carrying pET-22b(+) or pET-28b(+) constructs expressing the protein of interest were back diluted 1:300 in 2×YT broth and grown at 37 °C with shaking at 220 r.p.m. until the OD₆₀₀ reached 0.4. The incubation temperature was reduced to 18 °C, and after 30 min, IPTG was added to a final concentration of 0.3 mM and the cultures were incubated for a total of 18 h. Cells were then collected by centrifugation and resuspended in lysis buffer containing 200 mM NaCl, 50 mM Tris-HCl pH 7.5, 10% glycerol (v/v), 5 mM imidazole, 0.5 mg ml^–1 lysosome and 1 mU benzonase. Cells were then lysed by sonication and the cellular debris removed by centrifugation at 35,000g for 30 min at 4 °C. The 6×His-tagged proteins were purified from lysates using a 1 ml HisTrap HP column on an AKTA fast protein liquid chromatographer (FPLC). Column-bound protein was eluted using a linear imidazole gradient from 5 to 500 mM. Protein purity was assessed by SDS–PAGE and Coomassie staining. The fractions with high purity were concentrated using 10 kDa cut-off Amicon filters and then further purified by FPLC using a HiLoad 16/600 Superdex 200 pg column (GE Healthcare) equilibrated with sizing buffer (500 mM NaCl, 50 mM Tris-HCl pH 7.5 and 10% glycerol (v/v)).

PPI assays

Interactions between Umb proteins were probed using proteins heterologously expressed in E. coli. For tests of the interactions between UmbB1, UmbA5(T) and UmbC1(ring), 400 μl equilibration buffer (200 mM NaCl, 50 mM Tris-HCl pH 7.5 and 10 mM imidazole) containing 5 µg of purified UmbB1–H, UmbA5(T)–H or UmbC1(ring)–H was mixed with 400 μl E. coli cell lysate containing UmbA5(T)–V, UmbC1(ring)–V or UmbB1–V, respectively. To assess input protein levels, 40 μl of these samples was mixed with 4× Laemmli loading buffer (Bio-Rad) and boiled for 20 min at 95 °C for western blot analysis. The remaining protein mixtures were incubated with 50 μl Ni-NTA agarose beads (Qiagen) at 4 °C for 1.5 h with constant rotation. Agarose beads were pelleted by centrifugation at 300g for 3 min and washed 5 times with 1.4 ml wash buffer (500 mM NaCl, 50 mM Tris-HCl pH 7.5 and 25 mM imidazole). Proteins bound to the Ni-NTA resin were then eluted with 100 μl elution buffer (500 mM NaCl, 50 mM Tris-HCl and 300 mM imidazole). The eluate was mixed with 4× Laemmli loading buffer, boiled and subjected to western blot analysis. For the competitive binding experiments between UmbB1 and its partners UmbA5(T) and UmbC1(ring), 3 μg of purified UmbB1–H was incubated with 50 μl Ni-NTA agarose beads at 4 °C for 1 h with constant rotation, followed by 2 washes with equilibration buffer. Next, 400 μl equilibration buffer with 2-fold molar excess of purified competitor UmbC1(ring)–H or UmbA5(T)–H was mixed with 400 μl E. coli cell lysates containing UmbA5(T)–V or UmbC1(ring)–V, respectively. The protein mixture was further incubated with UmbB1–H bound to Ni-NTA agarose beads and then washed and processed as described above. For the other PPI assays (Figs. 2d–f and 3e and Extended Data Fig. 5a), E. coli cell lysates containing 6×His-tagged bait proteins were mixed directly with E. coli cell lysates containing VSV-G-tagged target proteins then incubated with Ni-NTA agarose beads, washed and processed as detailed above.

Western blot analysis

To analyse the PPI assays performed using heterologously expressed Umb proteins, equal volumes of input samples or co-IP samples were resolved using SDS–PAGE then transferred to nitrocellulose membranes (Bio-Rad). Following transfer, membranes were blocked in TBST (10 mM Tris-HCl pH 7.5, 150 mM NaCl and 0.1% w/v Tween-20) with 5% w/v BSA (RPI) at room temperature for 1 h. Primary antibodies (anti-His HRP-conjugated (Qiagen) or anti-VSV-G (Millipore Sigma)) were then added at a dilution of 1:5,000 and incubated at room temperature for 1 h. Blots were then washed four times with TBST, and anti-VSV-G blots were incubated with secondary antibody (anti-rabbit HRP-conjugated (Millipore Sigma) diluted 1:5,000 in TBST) at room temperature for 1 h. Finally, blots were washed four times with TBST and were developed using Clarity Max Western ECL Substrate (Bio-Rad) and visualized using an Invitrogen iBright 1500 imager.

Trypsin assays

The protease activity of purified UmbA1 and UmbA5 trypsin domains was assessed using universal protease substrate (Millipore Sigma) following the manufacturer’s protocol. In brief, 50 μl substrate solution (0.4% casein (w/v)) and 50 μl incubation buffer (0.2 M Tris-HCl pH 7.8 and 0.02 M CaCl₂) were combined with 100 μl sample buffer (300 mM NaCl and 50 mM Tris-HCl pH 7.8) containing 500 ng purified protein (UmbA1(T) or UmbA5(T)), 100 ng trypsin (Promega, positive control) or no protein (blank). The mixture was incubated at 37 °C for 15 min before adding 480 μl stop reagent (5% trichloroacetic acid (w/v)). The samples were further incubated 37 °C for 10 min and centrifuged at 13,000g for 5 min. Next, 400 μl of the reaction mixture was combined with 600 μl assay buffer (0.5 M Tris-HCl, pH 8.8) in a cuvette and absorbance was measured at 574 nm.

Purification of the Umb1 particle for structural studies

S. coelicolor spores expressing UmbA1–8×His from the native locus were inoculated into 30 ml R5 medium and incubated at 30 °C with shaking at 220 r.p.m. for 36 h. Cultures were back diluted 1:200 in 50 ml R5 for a total combined culture volume of 700 ml and incubated for 24–30 h, until the OD₆₀₀ reached 4. Cells were then pelleted by spinning at 21,000g for 45 min and the resulting supernatant was filtered (GenClone 25-229, Vacuum Filter Systems, 1,000 ml PES Membrane, 0.22 µm). Next, 600 ml supernatant was combined with 150 ml 5× lysis buffer (1 M NaCl and 250 mM Tris-HCl pH 7.5) and run over a 1 ml HisTrap FF column on an AKTA FPLC purification system to purify the His-tagged proteins. The bound proteins were eluted using a linear imidazole gradient from 0 to 300 mM. Collected fractions were pooled and concentrated using a 100 kDa cut-off Amicon concentrator until reaching a final volume of 600 μl. The protein sample was further purified by FPLC using a Superose 6 Increase 10/300 GL column (GE Healthcare) equilibrated in sizing buffer (150 mM NaCl, 20 mM Tris-HCl pH 7.5 and 3% glycerol) (v/v)). Each fraction was assessed for purity by SDS–PAGE and silver staining. The fractions with the highest purity and concentration were used for negative-stain EM or cryo-EM.

Negative-stain EM

Purified Umb1 particles were diluted to 0.01 mg ml^–1 and immediately subject to adsorption to glow-discharged carbon-coated copper grids for 60 s followed by 2% uranyl formate (w/v) staining. Micrographs were recorded using Leginon⁴³ on a 120 KV FEI Tecnai G2 Spirit with a Gatan Ultrascan 4,000 4k × 4k CCD camera at ×67,000 nominal magnification. The defocus ranged from −1.0 to −2.0 µm and the pixel size was 1.6 Å. The parameters of the contrast transfer function (CTF) were estimated using CTFFIND⁴⁴. All particles were picked in a reference-free manner using DoG Picker⁴⁵. The particle stack from the micrographs was pre-processed in Relion⁴⁶. Particles were re-extracted with a binning factor of 4, resulting in a final box size of 80 pixels and a final pixel size of 6.4 Å. The reference-free 2D classification was performed using CryoSPARC⁴⁷.

Cryo-EM sample preparation, data collection and data processing

Cryo-EM grids of the Umb complex were prepared using two separate methods and data were combined during data processing. For the first dataset 3 µl of 0.1 mg ml^–1 protein samples was loaded onto freshly glow-discharged lacey grid with a thin layer of evaporated continuous carbon before plunge-freezing using a Vitrobot Mark IV (ThermoFisher Scientific) with a blot force of −1 and 2.5 s blot time at 100% humidity and 22 °C. A total of 18,975 movies were collected at a defocus range between −0.2 and −3 μm. For the second dataset, 3 μl of a 3 mg ml^–1 purified Umb1 particle sample was loaded onto freshly glow-discharged R 2/2 UltrAuFoil grids before plunge-freezing using a Vitrobot Mark IV (ThermoFisher Scientific) with a blot force of 0 and 6 s blot time at 100% humidity and 22 °C. A total of 3,942 movies were collected at a defocus range between −0.5 and −2.5 μm.

For both datasets, the data were acquired using a FEI Titan Krios transmission electron microscope operated at 300 kV and equipped with a Gatan K3 direct detector and Gatan Quantum GIF energy filter, operated in zero-loss mode with a slit width of 20 eV. Automated data collection was carried out using Leginon⁴³ at a nominal magnification of ×105,000 with a pixel size of 0.843 Å. The dose rate was adjusted to 15 counts per pixel per s, and each movie was acquired in super-resolution mode fractionated in 75 frames of 40 ms. Movie frame alignment, estimation of the microscope CTF parameters, particle picking and extraction were carried out using Warp⁴⁸. Particles were extracted with a box size of 304 pixels with a pixel size of 1.686 Å.

Two rounds of reference-free 2D classification were performed using CryoSPARC⁴⁷ to select well-defined particle images. After 2D classification, initial models were generated with ab initio reconstruction in cryoSPARC. The initial models were used as references for 3D heterogenous refinement. Particles belonging to classes with the best resolved umbrella-like morphology were selected. To further improve particle picking, we trained the Topaz picker on Warp-picked particle sets belonging to the selected classes after heterogeneous 3D refinement. The particles picked using Topaz were extracted, and particles were subjected to two rounds of 2D classification and heterogenous 3D refinement in cryoSPARC⁴⁷. Particle picking with Topaz improved the number of unique 2D views. The two different particle sets picked from Warp and Topaz were merged, and duplicate particle picks were removed using a minimum distance cut-off of 60 Å. The particles from both the first and second datasets were subsequently combined. 3D refinements were carried out using non-uniform refinement and the particles were transferred from cryoSPARC to Relion using pyem (https://github.com/asarnow/pyem) to be subjected to the Bayesian polishing procedure implemented in Relion⁴⁹. Subsequent 3D refinements in cryoSPARC used heterogeneous refinements to remove junk particles and non-uniform refinement⁵⁰ along with per-particle defocus refinement to produce the final reconstruction at 4.3 Å resolution comprising 386,275 particles. The resulting map showed clear density for the overall quaternary architecture and secondary structure of the Umb1 particle. To further improve the density of each spoke, local refinements were performed using soft masks comprising each ternary complex (UmbC1, UmbB1 and UmbA1) using cryoSPARC⁴⁷, which produced final resolutions of 4.0–4.14 Å. The best resolved map that produced the 4.0 Å map after local refinement unambiguously showed that the ALF domain of UmbC, UmbB1 and UmbA1 can be fitted into the density of the local refinement map. Reported resolutions are based on the 0.143 gold-standard Fourier shell correlation (FSC) criterion and FSC curves were corrected for the effects of soft masking by high-resolution noise substitution^51,52. Local resolution estimation was carried out using cryoSPARC⁴⁷.

Umb1 particle model building and refinement

All models were built and refined by iterating between manual rebuilding and refinement in Coot⁵³ and Rosetta⁵⁴. For the ALF domain of the UmbC1 with UmbB1 and UmbA1 structure, AlphaFold models were used as a starting point. The relevant segments of the ALF domain with UmbB1 and UmbA1 were built into the locally refined map and the atomic coordinates of the disordered regions were removed. The final model of the ALF domain with the UmbB1 and UmbA1 structure was refined and relaxed with Rosetta, using the 4.0 Å locally refined sharpened and unsharpened maps⁵⁴. For the full Umb1 structure, the AlphaFold model of UmbC1 and locally refined ALF domain with the UmbB1 and UmbA1 structure were used as a starting point to manually rebuild models. The ALF domain, UmbB1 and UmbA1 model from local refinement were fitted into each of the five spoke densities. The final Umb1 complex model including UmbA1 and UmbB1 from each spoke and UmbC1 was subsequently refined and relaxed with Rosetta using sharpened and unsharpened maps⁵⁴. Map figures were generated with dust hidden (size 5) and coloured using the ‘color near atom’ command (range 10) in ChimeraX.

UmbC toxicity analysis in S.
aureus

For analysis of the toxicity of UmbC toxin domains in a heterologous host, toxin domains were cloned into the xylose-inducible plasmid pEPSA5. The deaminase and lipid II phosphatase domains were derived from UmbC1 and UmbC3, respectively, of S. coelicolor. The 4TM tox domain was derived from Streptomyces anulatus. Plasmids harbouring the toxin of interest or empty vector were isolated from S. aureus and transformed in triplicate into competent RN4220 by electroporation followed by 1 h of recovery in B2 medium at 37 °C 220 r.p.m. Transformations were plated on LBG supplemented with chloramphenicol and 0.2% xylose (w/v) to induce toxin expression. Transformant colonies were enumerated, and transformation efficiencies of empty plasmid and toxin-containing plasmid were computed and compared. The entire experiment was repeated independently with a separate preparation of RN4220 competent cells; data from both replicates are included in Fig. 2a.

Mutational profiling of E.
coli expressing the toxin domain of UmbC1

Three E. coli strains (MG1655 Δung pPSV39-CV-umbD1 pSCrhaB2-umbC1, MG1655 Δung pPSV39-CV-umbD1 pSCrhaB2 (no insert) and MG1655 Δung pPSV39-CV-dddAI and pSCrhaB2-dddA (32641830)) were grown overnight in LB supplemented with 15 μg ml^–1 gentamycin, 50 μg ml^–1 trimethoprim and 160 μM IPTG. The cultures were diluted 1:100 into fresh medium without IPTG, incubated until the OD₆₀ reached 0.6, then supplemented with 0.2% rhamnose (w/v) for toxin induction. Genomic DNA was isolated from the cultures after 60 min of induction, and sequencing libraries were prepared as previously described⁵⁵ and sequenced on an Illumina iSeq. Single-nucleotide variant profiling was performed using previously described analysis methods^55,56.

Preparation of concentrated supernatant for use in Umb toxicity assays

Spores of S. coelicolor wild-type and derivative strains were inoculated in R5 medium and grown for 36 h. The cultures were then back diluted 1:200 in 50 ml R5 medium for a total combined culture volume of 150 ml and incubated for 24–30 h until the OD₆₀₀ reached 4. Cells were then pelleted by centrifugation at 21,000g for 30 min. The resulting supernatant was filtered with a 0.45 μm PES membrane vacuum filter and then concentrated using 100 kDa cut-off Amicon concentrators until reaching a final volume of 3 ml. The concentrated supernatant was run over an Econo-Pac 10DG desalting column (Bio-Rad), aliquoted and stored at −80 °C until use.

Isolation of bacteria from soil used in Umb toxicity screening

Soil isolate strains used in the broad Umb sensitivity screen were collected from sorghum plants grown at the University of California’s Agriculture and Natural Resources Kearney Agriculture Research and Extension Center in Parlier, CA, as previously described^57,58. Root samples were obtained from mature sorghum plants that had been subjected to a prolonged pre-flowering drought. Immediately after extraction of plants from the soil, roots were removed and placed in 25% glycerol (v/v) for 30 min, then placed on dry ice until they were transferred to −80 °C. To remove soil, roots were placed in phosphate buffer and briefly sonicated. They were subsequently vortexed for 60 s in 99% ethanol, 6 min in 3% NaOCl (w/v) and 30 s in 99% ethanol to sterilize the root surface. Roots were washed twice in sterilized dH₂O, and 100 μl of rinse water was plated to check surface sterility. Roots were then cut into 1 cm pieces and placed into 2 ml tubes with 25% glycerol (v/v) and incubated for 30 min at room temperature before storing at −80 °C. One 2 ml tube of roots (approximately 200 mg) was thawed and placed in a sterile ceramic mortar with 1 ml PBS buffer. Root tissue was gently ground to release endophytic bacteria into the solution while minimizing lysis of bacterial cells. The solution was serially diluted, and 100 μl dilutions (10⁻¹, 10⁻² and 10⁻³) were plated onto various media types: ISP2, M9 minimal medium, skim milk, tap water yeast extract and humic acid. Plates were placed at 30 °C, and growth was monitored daily. When colonies were visible, they were picked and streaked onto a fresh plate of ISP2, followed by subsequent streaks if necessary to eliminate contamination, until only a single morphology was observed. The 16S ribosomal V3-V4 RNA sequences of the isolates were determined by Sanger sequencing.

Screening diverse organisms for sensitivity to S.
coelicolor Umb toxins

Strains used in this assay included both isolates obtained from culture collections and a subset isolated in this study from the root endosphere of field-grown sorghum plants (see above); all strains used in the assay, their sources and their growth conditions are listed in Supplementary Table 5. Strains were grown at 30 °C. Optical densities of initial cultures were measured and used to prepare 1 ml samples at an OD₆₀₀ of 0.01 in the appropriate medium for each strain. Next, 90 μl of each sample was transferred in duplicate to adjacent wells in a 96-well plate. To one of these wells, 10 μl of Umb supernatant from wild-type S. coelicolor was added. To the other well, 10 μl of Δumb supernatant from S. coelicolor Δumb was added. The plates were then incubated in a BioTek LogPhase 600 Microbiology Reader set to incubate the plates at 30 °C with shaking at 800 r.p.m. taking OD₆₀₀ measurements every 20 min for a total of 48 h. Growth curves were monitored for the beginning of exponential phase. When an organism reached the beginning of its exponential growth phase, the corresponding duplicate cultures were removed from the incubator, combined with 100 μl BacTiter-Glo reagent (Promega BacTiter-Glo Microbial Cell Viability Assay) and incubated at room temperature for 7 min. The luminescent signal was measured in a BioTek Cytation 1 imaging reader. Growth inhibition was assessed by calculating the ratio of signal obtained from cultures incubated with Δumb supernatant by that obtained from Umb supernatant-treated samples. Two biological replicates of the screen were formed, and Z scores were calculated from the average of log₂-transformed average ratios from across all strains screened.

Validation of initial hits from the diverse organism Umb sensitivity assay

Potential target strains S. griseus NRRL B-2682 and S. ambofaciens SAI 195 along with negative control strain Streptomyces mobaraensis NRRL B-3729 were grown on SFM plates for 3 days. Colonies from these plates were excised and used to inoculate 30 ml TSBY and incubated for 20 h (S. ambofaciens and S. griseus) or 36 h (S. mobaraensis) before being prepared for the Umb supernatant sensitivity assay as described above. Assay plates were initially incubated in a log phase for 7 h. Samples were then collected, combined with BacTiter-Glo reagent and luminescence was measured every 2–3 h until the plates reached 20 h of total growth. At 16 h, samples of each culture were serially diluted and plated on ISP2 agar to obtain an independent measure of growth yield.

Assessing the toxicity of Umb supernatant deriving from S.
coelicolor mutants

The toxicity of supernatant deriving from individual Umb particle mutants was assessed towards the sensitive species S. griseus. For these experiments, the concentrated supernatants from wild-type S. coelicolor, mutants unable to synthesize individual Umb particles, S. coelicolor ΔumbC2 (pSET152::umbC2) and S. coelicolor ΔumbC2 (pSET152) were prepared as described above. Pre-cultured S. griseus (grown for 20 h, as described above) was diluted to OD₆₀₀ of 0.01 in TSBY medium, and 90 μl of this was mixed with 10 μl concentrated supernatant in a 96-well plate. Assay plates were incubated in a log phase for 16 h. The samples were then collected, mixed with BacTiter-Glo reagent (Promega) and luminescence measured. Data represent the r.l.u. normalized by the maximum and minimum levels detected across treatments in an assay.

Streptomyces co-culture competition assays

For growth competition experiments between Streptomyces species, S. coelicolor spores were first inoculated into two 50 ml TSBY cultures and grown for about 36 h. Apramycin-resistant S. griseus was similarly inoculated in TSBY and grown for 20 h. When S. coelicolor cultures reached an OD₆₀₀ of 3, 10 ml was aliquoted into four replicate baffled flasks. S. griseus cells were washed twice with TSBY and then added to the culture flasks at OD₆₀₀ of 0.03, establishing an initial S. coelicolor and S. griseus ratio of 100:1. Cultures were serially diluted and plated on selective (for S. griseus) and non-selective medium (total population) for quantification of colony-forming units at an initial time point and after incubation at 28 °C for 12 h.

Microscopy

Imaging was performed on a Nikon Eclipse Ti-E wide-field microscope equipped with a sCMOS camera (Hamamatsu). A ×60, 1.4 NA oil-immersion PH3 objective was used for imaging. The microscope was controlled using NIS-Elements (v.3.30.02). The microscope chamber was heated to 28 °C, and S. griseus spores were loaded into all four chambers of a bacterial microfluidic plate (B04 from EMD Millipore). Using a CellASIC ONIX (Model EV262) microfluidic perfusion system, a pressure of 2 psi was applied to two columns over two roughly 6-h intervals. One chamber was treated with medium and Umb supernatant for interval one (0–370 min) followed by medium alone for interval two (370–660 min). A second chamber was treated with medium and ΔumbC2 supernatant followed by medium and Umb supernatant. A third chamber was treated with medium alone followed by medium and Umb supernatant. Finally, a fourth chamber was treated with PBS followed by medium alone.

Z stacks were acquired at each of the three positions in each imaging chamber every 10 min. Z stacks were merged using Gaussian focus stacking followed by automatic frame alignment in Fiji⁵⁹. Cells that were imaged without occlusion or growth outside the field of view for the duration of 11 h were manually selected and exported in napari⁶⁰ using the napari-crop and napari-nd-cropper plugins. Cells were automatically segmented frame-by-frame using Omnipose (bact_phase_omni model)⁶¹. Spurious labels arising from plate defects, debris or pillars were manually removed in napari following automatic edge-based filtering in Python. Finally, cells were tracked (and any oversegmentation resolved) by manually recolouring Z stack labels in napari using the fill tool in 3D mode. All processed space–time labels were then loaded into Python for extracting area over time per cell.

Bioinformatics analysis

To comprehensively retrieve UmbC protein homologues, the PSI-BLAST program⁶² was used for iterative searches against the NCBI non-redundant (nr) protein database until convergence, with a cut-off e-value of 0.005. The five upstream and five downstream gene neighbours of UmbC were extracted from the NCBI GenBank files for use in the gene neighbourhood analysis⁶³. All protein neighbours were clustered based on their sequence similarities using the BLASTCLUST program, a BLAST score-based single-linkage clustering method (https://ftp.ncbi.nih.gov/blast/documents/blastclust.html). Protein clusters were then annotated based on their domain architectures using the HMMSCAN program⁶⁴, searching against the Pfam database⁶⁵ and our in-house custom HMM profile database. Signal peptide and transmembrane region prediction was determined using the Phobius program⁶⁶. For systematic identification and classification of C-terminal toxin domains in UmbC proteins and the immunity families represented by UmbD proteins, we utilized the CLANS program⁶⁷. This program uses a network analysis to organize sequences through the application of the Fruchterman and Reingold force-directed layout algorithm⁶⁸ based on their sequence similarities derived from all-against-all BLASTP comparisons. A representative sequence of the novel domain family served as a seed in PSIBLAST searches to retrieve homologues. Following removal of highly similar sequences by BLASTCLUST, MSAs were built using KALIGN⁶⁹, MUSCLE⁷⁰ or PROMALS3D⁷¹. To identify the conserved residues for each domain family, the Chroma program⁷² was used to calculate the conservation pattern of the MSA based on different categories of amino acid physiochemical properties as previously reported⁷³. Structural models for representative sequences of each domain family were predicted using AlphaFold2 (ref. ¹⁸) and models with the highest predicted lDDT scores were selected. Determination of domain boundaries for each family was guided by both the structure models and the PAE matrix provided by AlphaFold2. Functional predictions for toxin domains belonging to uncharacterized families were generated using DALI⁷⁴ and Foldseek⁷⁵ searches with representative structural models from each family to identify structurally related proteins with characterized functions. Function predictions were assigned when structurally similar proteins or protein domains (DALI Z score > 3, or Foldseek E value < 0.01) with known toxin activities were identified.

Statistics and reproducibility

Significance of differences in transformation efficiency under heterologous toxin expression, growth yields of S. griseus in supernatant toxicity experiments (with supernatant from S. coelicolor individual umb particle mutants) and competitive indices in competitive growth assays were assessed using analysis of variance and two-sided Dunnett’s multiple comparison tests. Significance of differences in protease activity between trypsin and UmbAT proteins and in growth yields from S. coelicolor Umb and Δumb supernatant toxicity assays were determined using two-tailed t-tests. Tests were performed using GraphPad Prism. All western blot assays and were replicated independently a minimum of two times. For bacterial growth assays, the number of replicates collected from independent cultures grown in parallel on a single day are indicated in the figure legends. Each experiment was also replicated at least once on separate days with three additional independent cultures. Statistical methods were not used to predetermine sample size, and blinding and randomization were not employed.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

[ad_2]

Source link

April 17, 2024

Tag: Cryoelectron microscopy

MS2 affinity selection of CE complexes

Add-back experiments using purified pre-B

Western blotting

Protein–protein crosslinking

EM sample preparation and imaging

EM data processing

Model building and refinement

Reporting summary

Purification of recombinant human RAD52

Purification of Flag–RAD52 from Sf9 insect cells

Purification of recombinant human RPA

Oligonucleotides

Fluorescence anisotropy

Single-stranded DNA annealing

Biolayer interferometry analysis

CD analysis

Intact protein MS

GuHCl denaturation and renaturation

Negative-stain EM sample preparation and data acquisition

Negative-stain EM data analysis

Cryo-EM sample preparation

Cryo-EM data collection, image processing and atomic model building

SEC–MALLS analysis

Nuclear/chromatin extraction and analysis

RAD52 Resource S chromatogram peak fitting

RAD52–ssDNA–RPA pull downs

Reconstitution of the RAD52–ssDNA–RPA complex

Protein disorder prediction

Multiple-sequence alignment

XL-MS analysis

Peptide array

Nanoscale differential scanning fluorometry

Statistics and reproducibility

Reporting summary

Bacterial strains and culture conditions

Plasmid construction

Structural modelling of Umb proteins and PPIs

Construction of genetically modified Streptomyces strains

IP–MS analysis of UmbC-interacting proteins from S. coelicolor

Purification of heterologously expressed Umb proteins

PPI assays

Western blot analysis

Trypsin assays

Purification of the Umb1 particle for structural studies

Negative-stain EM

Cryo-EM sample preparation, data collection and data processing

Umb1 particle model building and refinement

UmbC toxicity analysis in S. aureus

Mutational profiling of E. coli expressing the toxin domain of UmbC1

Preparation of concentrated supernatant for use in Umb toxicity assays

Isolation of bacteria from soil used in Umb toxicity screening

Screening diverse organisms for sensitivity to S. coelicolor Umb toxins

Validation of initial hits from the diverse organism Umb sensitivity assay

Assessing the toxicity of Umb supernatant deriving from S. coelicolor mutants

Streptomyces co-culture competition assays

Microscopy

Bioinformatics analysis

Statistics and reproducibility

Reporting summary

IP–MS analysis of UmbC-interacting proteins from S.
coelicolor

UmbC toxicity analysis in S.
aureus

Mutational profiling of E.
coli expressing the toxin domain of UmbC1

Screening diverse organisms for sensitivity to S.
coelicolor Umb toxins

Assessing the toxicity of Umb supernatant deriving from S.
coelicolor mutants