Cryoelectron microscopy – Page 5

Structural basis of Integrator-dependent RNA polymerase II termination

[ad_1]

Molecular cloning and protein expression and purification

The constructs used for expressing Integrator were described previously¹ with some modification. In brief, INTS1 and INTS15 cDNA sequences were codon-optimized for protein expression in T. ni (Hi5 insect cells) and the cDNAs were purchased from Integrated DNA Technologies (IDT). Owing to its size, the cDNA for INTS1 was divided into three fragments for synthesis. The codon-optimized INTS1 cDNA fragments were cloned into vector 438-C (Addgene 55220) and combined with INTS12, which was cloned in vector 438-A (Addgene 55218), to create the INTS1–INTS12 construct. The cDNA for INTS15 was cloned into vector 438-C. Expression constructs for the INTS2–INTS3–INTS5–INTS6–INTS7–INTS8 subcomplex, the cleavage module, the INTS10–INTS13–INTS14 module and the PP2A complex were described previously¹.

Full-length human NABP2 (Q9BQ15-1) and INIP (Q9NRY2-1) cDNAs were codon-optimized for Hi5 insect cells, purchased from IDT and individually cloned into vector 438-B (Addgene 55219) by ligation-independent cloning⁵⁵.

Baculoviruses for protein expression in insect cells were generated in SF9 and SF21 cells (Thermo Fisher Scientific) using a previously described protocol⁵⁶. We expressed the eight-subunit Integrator core by co-infecting Hi5 cells (Thermo Fisher Scientific) with two baculoviruses, one expressing the INTS2–INTS3–INTS5–INTS6–INTS7–INTS8 subcomplex with an N-terminal 6×His-MBP tag on INTS5 and the other containing the INTS1–INTS12 construct. We expressed the tail module (INTS10–INTS13–INTS14–INTS15) by co-infecting Hi5 cells with baculoviruses containing 6×His-MBP–INTS15 and the INTS10–INTS13–INTS14 module. The PP2A complex and the Integrator cleavage module were expressed as previously described¹. NABP2 and INIP were also expressed in Hi5 cells using baculoviruses generated from their respective constructs.

The eight-subunit Integrator core, the cleavage module (and its mutants) and PP2A were purified using the published protocols¹. The tail module was purified essentially as described for the INTS10–INTS13–INTS14 module¹ except that we used amylose instead of Ni affinity.

To prepare NABP2, Hi5 insect cells expressing the protein were collected by centrifugation at 238g for 30 min in a high-speed centrifuge (Beckman Coulter) operated at 4 °C. The supernatant was discarded and the cell pellet from a 1.2-l culture was resuspended in 80 ml lysis buffer (50 mM Tris-HCl pH 7.5, 800 mM NaCl, 20 mM imidazole, 10% (v/v) glycerol, 2 mM EDTA and 5 mM DTT). Cells were lysed by sonication with 30% amplitude for 2 min with a 0.4-s pulse on and a 0.6-s pulse off using a Branson digital sonifier. The lysate was spun at 87,207g in a high-speed centrifuge at 4 °C for 1 h and filtered with a 0.8-μm syringe filter to remove cell debris. The clarified lysate was applied to a pre-equilibrated 5-ml HisTrap HP column (Cytiva) at a flow rate of 1.5 ml per min and the column was washed with 100 ml lysis buffer. The bound protein was eluted from the column using a gradient from 0–100% over 18 column volumes of an Ni elution buffer (50 mM Tris-HCl pH 7.5, 800 mM NaCl, 500 mM imidazole, 10% (v/v) glycerol, 2 mM EDTA and 5 mM DTT). The fractions containing NABP2 were combined and treated with 5 mg 6×His-TEV protease and lambda protein phosphatase, and dialysed overnight against 800 ml low-salt buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 20 mM imidazole, 10% (v/v) glycerol, 2 mM EDTA and 5 mM DTT) at 4 °C in a 7-kDa molecular weight cut-off (MWCO) SnakeSkin dialysis tubing (Thermo Fisher Scientific). The digested sample was applied to a 5-ml HisTrap HP column to remove uncleaved protein and TEV protease. The flow-through fraction was applied to a pre-equilibrated 5-ml HiTrap SP HP column. NABP2 was recovered in the flow-through, concentrated in an Amicon 15-ml centrifugal filter (10 kDa MWCO) (Millipore) to around 1.0 ml and applied to a Superdex 75 10/300 GL column (Cytiva) equilibrated in 50 mM HEPES pH 7.5, 300 mM NaCl, 10% (v/v) glycerol and 2 mM TCEP. Peak fractions were analysed by SDS–PAGE, and the fractions that contain pure NABP2 were concentrated, aliquoted, flash-frozen and stored at −80 °C.

To prepare INIP, Hi5 cells were collected, lysed, filtered and clarified using the protocol for NABP2. Cells were resuspended in a low-salt lysis buffer (20 mM MES pH 6.1, 150 mM NaCl, 20 mM imidazole and 2 mM DTT). Cleared lysate was applied to a pre-equilibrated 5-ml HisTrap HP column (Cytiva) at a flow rate of 1.5 ml per min and the column was washed with 100 ml low-salt lysis buffer. Elution was performed using Ni elution buffer (20 mM MES pH 6.1, 150 mM NaCl, 500 mM imidazole and 2 mM DTT), and peak fractions were analysed by SDS–PAGE. Fractions containing INIP were combined with lambda phosphatase and dialysed overnight at 4 °C in SnakeSkin dialysis tubing (3.5 kDa MWCO) (Thermo Fisher Scientific) against 800 ml low-salt lysis buffer. After dialysis, the protein was applied to a pre-equilibrated 5-ml HiTrap SP HP cation-exchange column. INIP-containing fractions after ion exchange were pooled and concentrated in an Amicon 15-ml centrifugal filter (3 kDa MWCO) (Millipore) to around 1.0 ml and applied to a Superdex 75 10/300 GL column (Cytiva) equilibrated in 50 mM HEPES pH 7.5, 300 mM NaCl, 10% (v/v) glycerol and 2 mM TCEP. Peak fractions were concentrated, aliquoted, flash-frozen in liquid nitrogen and stored at −80 °C.

Preparation of mammalian Pol II (ref. ⁵⁷) human DSIF (ref. ³⁷), NELF (ref. ⁵) and human histones⁵⁸ was done as described in the corresponding references.

Nucleosome preparation

DNA fragments for nucleosome reconstitution were generated by PCR as described previously⁵⁹. In brief, nucleosome DNA was amplified from a vector containing the 145-bp Widom 601 sequence and a 40-bp run-up sequence upstream of the Widom 601. A 50-ml PCR was performed using the following primers: forward: 5′-GCAGTCCAGTTACGCTGGAGTC-3′ and reverse: 5′ATCAGAATCCCGGTGCCG −3′. The sequence of the PCR product is 5′-GCAGTCCAGTTACGCTGGAGTCTGAGGCTCGTCCTGAATGATATGCGGCCTCACGAAGCGTAGCATCACTGTCTTGTGTTTGGTGTGTCTGGGTGGTGGCCGATATCGATGTATATATCTGACACGTGCCTGGAGACTAGGGAGTAATCCCCTTGGCGGTTAAAACGCGGGGGACAGCGCGTACGTGCGTTTAAGCGGTGCTAGAGCTGTCTACGACCAATTGAGCGGCCTCGGCACCGGGATTCTGAT-3′. PCR product purification, TspRI digestion, octamer formation, nucleosome reconstitution and purification of nucleosome with a PrepCell system were performed as previously described⁵⁹. The concentration of the reconstituted and purified nucleosome was determined using the sum of the molar extinction coefficients of DNA and octamer at 280 nm and the absorbance of the nucleosome at this wavelength. Super-helical locations were assigned on the basis of previous publications (see references in ref. ⁵⁹).

RNA extension assays

We performed in vitro RNA extension assays to identify the NELF-dependent Pol II pause site in the nucleosome. A 5′ Cy5-labelled RNA (5′-Cy5/rUrUrArUrCrArCrUrGrUrC-3′) that anneals at the TspRI-generated overhang in the run-up to the nucleosome was used to load Pol II onto the nucleosomal substrate for RNA extension. Assays were performed in a volume of 10 µl in a final buffer containing 100 mM NaCl, 20 mM Na-HEPES, pH 7.4, 5 mM MgCl₂, 1 mM DTT and 4% glycerol. Depending on the reaction, RNA (480 nM) was incubated with either DNA substrate or nucleosomal substrate (240 nM) for 10 min on ice. Sus scrofa Pol II (300 nM) was added to the reaction and incubated for 10 min on ice. DSIF (600 nM), TFIIS (180 nM) and buffer were added to the samples. Transcription was initiated by adding 0.5 mM each of GTP, CTP, UTP and ATP or 3′-dATP with or without NELF (600 nM). After a 60-min incubation at 30 °C, 5 µl transcription reaction was quenched with 5 µl of a 2× Stop buffer (6.4 M urea, 50 mM EDTA, pH 8.0 and 2× TBE buffer). Quenched samples were treated with 1.6 units of proteinase K (NEB) for 30 min at 37 °C and denatured for 10 min at 95 °C before the fluorescent RNA was separated using denaturing PAGE (8 M urea, 1× TBE buffer, 12% acrylamide:bis-acrylamide 19:1 gel; run for 42 min at 300 V in 0.5× TBE buffer). RNA products were visualized by their Cy5 label in a Typhoon 9500 FLA imager.

Reconstitution of complexes for cryo-EM and XL-MS analyses

Pre-termination complex

The RNA extension assay showed that the presence of NELF impaired Pol II transcription to the nucleosomal substrate as compared with Pol II–DSIF alone. We thus used a two-step procedure to form the pre-termination complex for cryo-EM and XL-MS analyses. First, a transcribed Pol II–DSIF–Nuc complex was reconstituted in a buffer containing 100 mM NaCl, 20 mM HEPES, pH 7.4, 5 mM MgCl₂, 1 mM DTT and 4% (v/v) glycerol. The 5′ Cy5-labelled RNA (3.2 µM) and the nucleosomal substrate (1.6 µM) were mixed and incubated for 5 min on ice. S. scrofa Pol II (2 µM) was added to the reaction and incubated for another 5 min on ice. We added DSIF (6 µM) and 3′-dATP (1 mM) and the mixture was incubated for 10 min at 30 °C. Transcription was started by adding TFIIS (1.2 µM), CTP, GTP and UTP (each 1 mM), and it proceeded for 60 min at 30 °C in a final volume of 50 µl. In parallel, we mixed 3.8 µM each of the eight-subunit Integrator core, cleavage module, tail module and PP2A in a final volume of 80 µl and incubated on ice to form the integrator–PP2A complex. We used an INTS11(E203Q) mutant that has reduced catalytic activity in all complexes formed for cryo-EM and XL-MS analyses.

In the second step, we added the preformed Integrator–PP2A complex and NELF (2 µM) to the transcribed Pol II–DSIF–Nuc complex in a final buffer comprising 156 mM NaCl, 28 mM HEPES, pH 7.4, 5 mM MgCl₂, 1 mM DTT and 4% glycerol in a final volume of 200 µl. We incubated the mixture for 30 min at 30 °C. The assembled pre-termination complex was purified using a 4-ml 10–40% glycerol gradient as previously described¹. Samples removed after each step were analysed using denaturing PAGE.

PEC–Integrator–PP2A–SOSS and free Integrator–PP2A–SOSS complexes

The PEC–Integrator–PP2A–SOSS complex from which we obtained the post-termination structure was formed essentially as described for the PEC–Integrator–PP2A complex using the published DNA scaffolds^1,5 and a variant of the HIV TAR RNA that does not form a secondary structure. The RNA has the following sequence, 5′-/6-FAM/rUrUrArArGrGrArArUrUrArArGrUrCrGrUrGrCrGrUrCrUrArArUrArAr CrCrGrGrArGrArGrGrGrArArCrCrCrArCrU-3′. We pre-incubated 3.8 µM each of the eight-subunit Integrator core, Integrator cleavage module, tail module, PP2A, NABP2 and INIP in a final volume of 80 µl on ice to form the Integrator–PP2A–SOSS complex. We formed the PEC using 0.6 µM of Pol II, 1.2 µM each of nucleic acids and 1.8 µM of DSIF and NELF. The preformed Integrator–PP2A–SOSS complex was added to the PEC in a final volume of 163 µl. We incubated the mixture for 30 min at 30 °C and applied it to a 10–40% glycerol.

The free Integrator–PP2A–SOSS complex was formed by mixing 3.8 µM of each of the Integrator–PP2A subcomplexes with 3.8 µM of NABP2 and INIP on ice for 60 min. The complex was purified using a 10–40% glycerol gradient.

Cryo-EM sample preparation

Peak fractions from the glycerol-gradient analyses of the pre-termination, PEC–Integrator–PP2A–SOSS and free Integrator–PP2A–SOSS complexes were separately cross-linked using 0.2% (v/v) glutaraldehyde for 10 min on ice. The cross-linking reaction was quenched using 100 mM Tris-HCl (pH 8) for 10 min on ice. The cross-linked cryo-EM samples were dialysed for 4–6 h against a buffer containing 20 mM HEPES pH 7.4, 150 mM NaCl, 1% (v/v) glycerol, 3 mM MgCl₂, 1 mM DTT and 0.01% (w/v) CHAPS using a 20 kDA MWCO Slide-A-Lyzer MINI Dialysis Unit (Thermo Fisher Scientific). A 2.6–2.8-µm-thin carbon film was floated on the dialysed cryo-EM samples and incubated for 5–15 min depending on the concentration of the sample before cross-linking. The floated carbon film was transferred onto a Quantifoil R3.5/1 copper mesh 200 grid and instantly blotted for 2 s with blot force 5 before being vitrified in liquid ethane using a Vitrobot Mark IV (Thermo Fisher Scientific). The vitrobot was operated at 4 °C and 95–100% humidity.

Cryo-EM data collection and processing

All cryo-EM data were acquired at a nominal magnification of 81,000×, corresponding to a calibrated pixel size of 1.05 Å per pixel, using a K3 direct electron detector (Gatan) on a Titan Krios transmission electron microscope (Thermo Fisher Scientific) operated at 300 kV. Images were collected in EFTEM mode using a Quantum LS energy filter (Gatan) with a slit width of 20 eV. A defocus range of −0.5 to −2.0 μm was applied during data collection and images were recorded in electron counting mode. The SerialEM software⁶⁰ was used for automated data acquisition. Motion correction of collected movies, dose weighting, constrast transfer function (CTF) estimation and particle picking were performed using Warp⁶¹.

For the pre-termination complex sample, we collected 59,687 micrographs with a dose rate of 14.86 e⁻ per pixel per s for 3 s, resulting in a total dose of 40.44 e⁻ per Å² that was fractionated into 50 movie frames. Micrographs with bad CTF fits in Warp were excluded from further processing. We extracted 9,107,060 picked particles with a box size of 500 pixels and binned 2× to a pixel size of 2.1 Å per pixel using RELION 3.1 (ref. ⁶²). These particles were subjected to heterogenous refinement in CryoSPARC (ref. ⁶³) using initial models generated from our previous data¹. The selected good particles that had cryo-EM density for the PEC and the Integrator–PP2A complex were further sorted using two-dimensional (2D) classification in CryoSPARC. We identified 1.3 million good particles with this procedure, which were re-extracted in RELION 3.1 (ref. ⁶²) without binning. We performed one round of three-dimensional (3D) classification in RELION to eliminate Integrator–PP2A particles that have only a weak Pol II density, resulting in 278,693 particles. This set of particles were CTF refined and polished in RELION 3.1 to obtain a 3.8-Å reconstruction encompassing the PEC and Integrator–PP2A. We applied soft masks around various parts of this map and performed signal subtraction, 3D classification and refinement in RELION 3.1. This produced good focused refined maps better than 3.5 Å that aided model building. A subset of 80,717 particles was obtained from focused classification with a mask around the PEC. We reverted the signal for these particles and performed global 3D refinement to obtain the overall reconstruction for the pre-termination complex at a resolution of 4.1 Å (map 1). The density for the nucleosome was very weak, showing that it is highly dynamic in this complex.

For the PEC–Integrator–PP2A–SOSS sample that led to the post-termination structure of the Integrator–PP2A–SOSS–CTD complex, 52,976 micrographs were acquired. Each micrograph was acquired with a 2.84-s exposure at a dose rate of 15.50 e⁻ per pixel per s, resulting in a total dose of 39.93 e⁻ per Å² that was divided into 40 movie frames. We excluded micrographs with a bad CTF fit and extracted 9,165,848 particles in RELION 3.1 (ref. ⁶²) using a 480-pixel box size. The extracted particles were binned to a pixel size of 2.1 Å per pixel to speed up initial sorting. Bad particles were removed using iterative 3D and 2D classification in CryoSPARC as described above, resulting in 832,842 good particles. This set of particles was taken through Bayesian polishing, CTF refinement and 3D refinement procedures in RELION 3.1. We identified three main classes when we applied 3D classification without image alignment. The first two classes are similar to the published PEC–Integrator–PP2A complex¹. The third class of 236,382 particles led to the reconstruction of the post-termination complex. We applied a soft mask around this class to subtract out the weak Pol II density that could not be resolved owing to flexibility. Three-dimensional refinement of the signal-subtracted particles led to a 3.7-Å overall reconstruction for the post-termination complex (map 2). We improved the resolution of local regions of the map using signal subtraction, 3D classification and refinement.

We collected 47,268 micrographs using a grid prepared from the free Integrator–PP2A–SOSS complex. The images were collected with 2.82-s exposures with a dose rate of 15.83 e⁻ per pixel per s and a total dose of 40.49 e⁻ per Å² that was split into 40 movie frames. We extracted 7,014,615 particles with a box size of 480 pixels that we binned to 2.1 Å per pixel after preprocessing the data in Warp. We used 3D and 2D classification in CryoSPARC to remove junk and broken particles, resulting in 2,335,349 good particles that we re-extracted without binning and subjected to CTF and 3D refinement procedures in RELION 3.1. We obtained a 3.1-Å reconstruction using the above steps. We performed signal subtraction with recentring of the particles followed by 3D refinement to obtain cryo-EM maps better than 2.9 Å for various regions of Integrator–PP2A. For the tail module, we performed 3D classification on the signal-subtracted particles to identify a subset set of 118,383 particles that refined to 6.1 Å. Further classification of these particles did not improve the resolution of the tail module.

Model building and refinement

To build a model for the pre-termination complex, we first fitted the model of PEC–Integrator–PP2A (PDB ID: 7PKS) into map 1 using ChimeraX (ref. ⁶⁴) and adjusted the fit using focused refined maps. Manual adjustments to the model were made in Coot (ref. ⁶⁵) after initial rounds of ISOLDE flexible fitting⁴⁰. We determined the sequence register of nucleic acids bound in the Pol II cleft using the 3.2-Å PEC focused refinement map. Following this register, we built the DNA–RNA hybrid and extended the downstream DNA. The downstream nucleosome was modelled by rigid-body-docking a structure of the nucleosome (PDB ID: 7OHC) into the low-pass-filtered version of map 1 using the sequence register from the downstream DNA.

For the tail module, we rigid-body-docked AlphaFold2 (ref. ³⁹) models for INTS10 and INTS15 into the focused refined map of this module and adjusted them in Coot and ISOLDE. We predicted the interface between the C terminus of INTS10 and INTS14 using Colabfold (ref. ⁴¹). The predicted model was fitted in the focused refined map and adjusted using ISOLDE. The available crystal structure of INTS13–INTS14 (PDB ID: 6SN1)³⁴ was aligned on our model of INTS10–INTS14 to derive the correct orientation of the INTS13–INTS14 sting. This naturally placed the INTS13–INTS14 sting inside the low-pass-filtered map 1. The INTS13 CMBM, INTS6 inhibitory loop and DSS1 models were copied from the structure of the free Integrator–PP2A and manually adjusted using Coot. Various parts of the model were refined against respective focused refined maps using the phenix.real_space_refine tool in the PHENIX package^42,66. The final model was refined against map 1 with reference model restraints to account for regions with weak cryo-EM density in the consensus refinement.

We built a model for the post-termination complex by copying the Integrator–PP2A structure from the pre-termination complex structure above. The model was first fitted into the overall map of the post-termination complex (map 2) and adjusted in Coot and ISOLDE using the focused refined maps to fit residue side chains. INTS1 residues 1–866 and the INTS13–INTS14 sting were removed from the model because cryo-EM density for these regions was lacking. The crystal structure of the SOSS complex containing INTS3(1–501), NABP2 and INIP (PDB ID: 4OWW)³¹ was docked into the focused refinement map around INTS3 and the SOSS factors. Regions lacking cryo-EM density were removed and the model was further adjusted using ISOLDE. A combined model for the post-termination complex was created in map 2 and subjected to real-space refinement in the PHENIX package^42,66.

The model for free Integrator–PP2A was built by first docking a structure of Integrator–PP2A that was copied from the pre-termination complex structure into map 3. ISOLDE was used to adjust the model to fit the map. The higher-resolution focused refined maps were used to fit side chains. Our XL-MS data suggested that the INTS6 inhibitory loop binds in front of the PP2A-C active site. We used Colabfold to predict possible interfaces between the flexible INTS6 C terminus and PP2A-C. We found one predicted model that perfectly matched our cryo-EM density and used it to model the INTS6 inhibitory loop. The interface between INTS11 and the INTS13 CMBM was also at first predicted using Colabfold and subsequently adjusted using ISOLDE and Coot. To identify the DSS1 peptide in our cryo-EM density and build a model for it, we subjected the 2.7-Å focused refined map around INTS1–INTS2–INTS7 to sequence-free de novo modelling using ModelAngelo (ref. ⁶⁷). The software identified and modelled the conserved C-terminal part of DSS1 into our cryo-EM density. The modelled part of the T. ni DSS1 corresponds to residues 35–60 of the human orthologue. We did not assign a sequence numbering because there is no database with annotated T. ni DSS1. An AlphaFold2 model for the N terminus of INTS1 (residues 143-905) was rigid-body-docked into the overall map to complete the model. The final model was refined in real space using PHENIX^42,66.

The following regions were built as backbone traces where applicable because side-chain information was absent in our cryo-EM density maps. INTS1(143–906), INTS10, INTS13(11-564), INTS14 and INTS15.

Integrator RNA degradation assay

RNA cleavage and degradation activity of Integrator was tested using the RNA cleavage assay preciously described¹. In brief, a completely complementary template and non-template DNA and a single-stranded RNA that anneals to the template DNA were purchased from IDT. The nucleic acids have the following sequences: template DNA, 5′-GCTTTATTGAGGCTTAAGCAGTGGGTTCCAGGTACTAGTGTACAGCTATCGTAAGCTATCGTAGGCAAGGTCCACTGACT/3Bio/-3′; non-template DNA, 5′-AGTCAGTGGACCTTGCCTACGATAGCTTACGATAGCTGTACACTAGTACCTGGAACCCACTGCTTAAGCCTCAATAAAGC-3′; and RNA, 5′-rArGrUrCrGrUrGrCrGrUrCrUrArArUrArArCrCrGrGrArGrArGrGrGrAr ArCrCrCrArCrU/3Cy5Sp/-3′. Note that the RNA has a 3′ Cy5 fluorescent label for visualizing the Integrator cleavage products.

A 6× PEC master mix was prepared using 450 nM Pol II, 90 nM of each nucleic acid and 900 nM each of DSIF and NELF in a final volume of 40 µl. Aliquots of the PEC master mix (6.7 µl) were treated individually with 150 nM preformed Integrator–PP2A complexes containing wild-type INTS11, an INTS11(E203Q) mutant that has reduced enzymatic activity or an INTS11(D72K/H73A) mutant that is catalytically dead, or were not treated with Integrator. Reactions were performed in 40-µl final volumes in buffer R (20 mM HEPES pH 7.4, 150 mM NaCl, 10% (v/v) glycerol, 3 mM MgCl₂, 1 mM DTT, 1 U μl⁻¹ RNAsin plus (Promega)). For the free Integrator control, the preformed wild-type Integrator was mixed with the annealed DNA–RNA scaffold. All reactions were incubated at 30 °C for 1 h, quenched and analysed on a denaturing PAGE as described¹.

The above protocol was used for the time-course RNA cleavage and degradation by wild-type Integrator shown in Fig. 1d and Supplementary Fig. 2f,g, except for the following. For a more efficient PEC formation, the PEC scaffold that contains a mismatch bubble⁵ was used instead of the completely complementary scaffold. We used a 25-nt or 17-nt RNA that has a 3′ Cy5 label to show that Integrator cannot act on RNA that is covered inside Pol II. The RNA sequences are shown in Fig. 1d and Supplementary Fig. 2f,g.

Chemical cross-linking coupled with mass spectrometry

Chemical cross-linking was performed using the peak fractions from the pre-termination complex and the PEC–Integrator–PP2A–SOSS glycerol-gradient ultracentrifugation. For each complex, we ran two gradients using the protocol described above and pooled the peak fractions. This was required to get sufficient material for XL-MS. The pooled peak fractions were cross-linked with 3 mM BS3 for 30 min at 30 °C and quenched with 100 mM Tris-HCl (pH 8.0). Mass spectrometry was performed as previously described¹, except for the following. For PEC–INT–PP2A–SOSS BS3-cross-linked peptides were pre-fractionated by size exclusion or by C18 basic pH reverse-phase chromatography (bRP). For PEC–Nuc–INT–PP2A, only bRP pre-fractionation was performed. Both samples were measured in triplicate in a Thermo Orbitrap Exploris mass spectrometer without FAIMS installed (Thermo Fisher Scientific). BS3-mediated protein-protein cross-links were identified using pLink 2.3.11 (http://pfind.org/software/pLink/).

Visualization

Protein sequence alignments were made with Multalign (ref. ⁶⁸) and visualized with ESPRIPT 3.0 (ref. ⁶⁹). Structural figures were made with UCSF Chimera (ref. ⁷⁰) and ChimeraX (ref. ⁶⁴). The Supplementary Videos were made in ChimeraX. Please note that Supplementary Video 4 was made by interpolating between the various conformations of proteins in our structures and the trajectory of protein domains may not necessarily reflect intermediate conformations.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

[ad_2]

Source link

Cryo-EM structures of RAD51 assembled on nucleosomes containing a DSB site

[ad_1]

Purification of RAD51 proteins

The human RAD51 and RAD51 mutant proteins were purified as previously described²³. In brief, His₆-tagged human RAD51 and RAD51 mutants (K64A, K70A, K64A/K70A, R27A, S67E, R235D and E59R) were produced in E. coli cells and purified by Ni-NTA agarose chromatography (Qiagen). The His₆-tag portion was removed by thrombin protease treatment. The RAD51 proteins were then precipitated with spermidine, and dissolved in potassium phosphate buffer. RAD51 proteins were further purified by MonoQ column chromatography (Cytiva).

Purification of histones

Human histones were purified as previously described³⁸. In brief, human histones (H2A, H2B, H3.1, H4, taillessΔ15 H4 and taillessΔ19 H4) were produced in E. coli cells as His₆-tagged peptides. His₆-tagged histones were denatured with urea, and purified by Ni-NTA agarose chromatography (Qiagen). The His₆-tag portion was removed by thrombin protease treatment, and the histones were further purified by MonoS column chromatography (Cytiva).

Nucleosome preparation

The nucleosomes with the 153-base-pair (with a three-base 3′ ssDNA overhang) and 158-base-pair (with blunt ends) Widom 601 DNA were prepared as previously described^38,39. In brief, the histone octamer was reconstituted with histones H2A, H2B, H3.1 and H4, and the resulting histone complex was purified by gel filtration chromatography on a HiLoad16/60 Superdex 200 column (Cytiva). The 158-base-pair Widom 601 DNA fragment with blunt ends was amplified by PCR and purified by native polyacrylamide gel electrophoresis, using a Prep Cell apparatus (Bio-Rad). The sequence of the 158-base-pair DNA fragment is as follows: 5′-CGTGGTGGCCGTTTTCGTTGTTTTTTTCTGTCTCGTGCCTGGTGTCTTGGGTGTAATCCCCTTGGCGGTTAAAACGCGGGGGACAGCGCGTACGTGCGTTTAAGCGGTGCTAGAGCTGTCTACGACCAATTGAGCGGCCTCGGCACCGGGATTCTGAT-3′. Nucleosomes were reconstituted by the salt dialysis method and subsequently purified with a Prep Cell apparatus³⁸.

Preparation of the RAD51–nucleosome complex

RAD51 (2.4 µM) and the nucleosome (0.1 µM) were mixed in reaction buffer (20 mM HEPES-NaOH (pH 7.5), 15 mM NaCl, 1 mM MgCl₂, 1 mM dithiothreitol, 0.2 mM 2-mercaptoethanol, 0.03% NP-40 and 1.5% glycerol) in the absence or presence of 1 mM nucleotide (ATP, ADP or AMP-PNP). After an incubation at 37 °C for 30 min, the resulting complexes were fixed by the GraFix method⁴⁰ in the gradient solution (15–30% sucrose and 0-0.2% glutaraldehyde gradient in 10 mM HEPES-NaOH (pH 7.5), 30 mM NaCl and 1 mM DTT). The samples were applied on top of the gradient solution and centrifuged at 27,000 rpm at 4 °C for 16 h in an SW41Ti rotor (Beckman Coulter). After the ultracentrifugation, 640-μl aliquots were obtained from the top of the gradient solution and analysed by 4% non-denaturing polyacrylamide gel electrophoresis in 0.5× TBE buffer (45 mM Tris-borate and 1 mM EDTA), followed by ethidium bromide or SYBR Gold staining. The fractions containing the RAD51–nucleosome complexes were collected, and the buffer was then exchanged using a PD-10 column (Cytiva) to the final buffer (10 mM Tris-HCl (pH 7.5), 30 mM NaCl and 1 mM dithiothreitol). The resulting sample was concentrated with an Amicon Ultra 30K filter (Merck Millipore).

Cryo-EM grid preparation and data collection

Aliquots (2.5 μl) of the purified RAD51–nucleosome complexes in the absence or presence of nucleotide (ATP, ADP or AMP-PNP) were applied to glow-discharged Quantifoil R1.2/1.3 200-mesh Cu grids. The grids were blotted at 4 °C for 4 or 6 s under 100% humidity using a Vitrobot Mark IV (Thermo Fisher Scientific), and then rapidly frozen in liquid ethane. Cryo-EM data of the RAD51–nucleosome complexes were collected on a Krios G4 microscope (Thermo Fisher Scientific) operating at 300 kV and a magnification of 81,000× (pixel size of 1.06 Å). The data acquisition was performed using the EPU automation software (Thermo Fisher Scientific). The defocus range varied from −1.0 to −2.5 μm. A K3 BioQuantum direct electron detector (Gatan) was used, and a stack of 40 frames was obtained for each dataset. The detailed conditions that were used for obtaining the cryo-EM data are shown in Extended Data Tables 1 and 2.

Image processing

The detailed process is shown in Extended Data Figs. 2–5 and 7. All frames in the movies of each dataset were aligned using MotionCor2⁴¹ with dose weighting, and the contrast transfer function (CTF) estimation was then performed using CTFFIND4⁴² on digital micrographs. Micrographs were selected on the basis of the strong correlation of the CTF. The following image-processing steps were performed using Relion 4 beta2¹⁶. Picked particles by Laplacian-of-Gaussian (LoG)-based auto-picking were subjected to two-dimensional (2D) classification, and 2D class averages with nucleosome and additional densities were used as references for the following particle picking. Picked particles were extracted from micrographs with 2× binning. Further 2D classification was performed to discard junk particles. An initial model was then generated de novo, and several rounds of 3D classification were performed using a reasonable model as a reference. After removing the 2× binning, Bayesian polishing and CTF refinement were conducted. A mask was created around the RAD51 ring, and further 3D classification was performed using the created mask. The final map was generated by using high-quality classes for sharpening in each class with various numbers of RAD51 molecules.

In the dataset of RAD51–nucleosome complexes containing the 153-base-pair DNA obtained in the presence of ATP, two classes were identified: one with the RAD51 ring bound to the linker DNA and nucleosome, and another with an additional RAD51 ring bound to the nucleosome without linker DNA binding. In the first round of 3D classification, these classes were separated. For the image processing of the RAD51 ring bound to the nucleosome without linker DNA binding, focused refinement on the RAD51-ring structure was performed. To analyse the binding of the RAD51 L1 loop to the sticky DNA end, focused refinement was performed after the CTF refinement by masking the sticky DNA end and RAD51. We conducted this focused refinement with the RAD51 protomers bound to the linker DNA without selecting specific ring structures. To analyse RAD51 binding to the histone H4 tail, focused refinement was performed by masking the region around the histone H4 tail. We conducted this focused refinement with the H4 tail without selecting specific ring structures.

In the analysis of the dataset of the RAD51–nucleosome complex containing the 158-base-pair DNA with blunt ends obtained in the presence of ATP, only the RAD51 ring bound to the linker DNA was analysed. The structures were refined separately, on the basis of the number of protomers in each RAD51 ring. To analyse the binding of the linker DNA to the RAD51 L1 loop, focused refinement was performed by masking the DNA blunt end and RAD51. We conducted this focused refinement with the RAD51 protomers bound to the linker DNA without selecting specific ring structures.

In the analysis of the samples obtained in the presence of ADP, fractions separated by GraFix were obtained: one containing complexes with RAD51 rings bound to linker DNA, and the other containing two rings of RAD51 bound to the nucleosome. For each dataset, the RAD51 ring was focused and refined, resulting in the final maps.

For the samples obtained in the presence of AMP-PNP, two datasets of the F1 and F2 fractions were collected individually (Extended Data Fig. 5). For the image processing of F1, the processes were performed as described above. For the image processing of F2, the 2D class averages of nucleosomes with additional densities were obtained, and used as the reference for particle picking. The filament structure of RAD51 bound to the nucleosome was obtained by 2D classification and two rounds of 3D classification, and used as the reference for Topaz particle picking⁴³. After 2D and 3D classifications, Bayesian polishing and CTF refinement were performed without 2× binning, and the dimer and monomer structures of the nucleosome–RAD51 filament complex were obtained. In addition, 2D class averages of the naked DNA–RAD51 filament structure were obtained, and used as the reference for particle picking. By 2D classification and two rounds of 3D classification, the cryo-EM map of the naked DNA–RAD51 complex was obtained from the reference-based particle picking of the filament structure.

Model building

The atomic models of the RAD51–nucleosome complexes were built using the atomic coordinates of the histone octamer from the human nucleosome (Protein Data Bank (PDB) ID: 5Y0C)⁴⁴ and the atomic coordinates of a 145-bp Widom 601 sequence from the Xenopus laevis nucleosome (PDB ID: 7OHC)⁴⁵. The atomic model of RAD51 was built using the crystal structure of human RAD51 (PDB ID: 5NWL)⁴⁶, and refined using the cryo-EM map of the highest-resolution RAD51 single molecule with phenix.real_space_refine⁴⁷. The atomic coordinates of the NLD and RecA domains were adjusted and fitted to each cryo-EM map. The sequences of the nucleosomal DNA and linker DNA were modified using Chimera⁴⁸. The atomic coordinates of the DNA were refined by manual editing with ISOLDE⁴⁹ and Coot⁵⁰. The resulting atomic coordinates of RAD51 and nucleosome were fitted to the cryo-EM map by rigid body fitting, using the ‘Fit in Map’ mode of ChimeraX⁵¹. The major clashes were modified with phenix.real_space_refine and Coot.

For model building of the histone H4 tail bound to the RAD51, the atomic coordinates were refined by manual editing with ISOLDE and Coot.

For model building of the RAD51 filament–nucleosome complex, the DNA was built by connecting the nucleosomal DNA (PDB ID: 7OHC), the kinked DNA (PDB ID: 1WD1)⁵² and the extended DNA from the human RAD51 post-synaptic complex (PDB ID: 5H1C)²⁸. The atomic coordinates of the nucleosomal DNA were refined by manual editing with ISOLDE.

Assay for RAD51–nucleosome or DNA binding

The nucleosomes (0.1 µM) or the 153-base-pair DNA (0.01 µM) and RAD51 or RAD51 mutants (0.24, 0.48 and 0.72 μM for DNA-binding assay, and 1.2, 2.4 and 3.6 μM for nucleosome-binding assay) were incubated at 37 °C for 30 min in the reaction buffer (20 mM HEPES-NaOH (pH 7.5), 15 mM NaCl, 1 mM MgCl₂, 1 mM dithiothreitol, 0.2 mM 2-mercaptoethanol, 0.03% NP-40 and 1.5% glycerol) in the absence or presence of 1 mM ATP, ADP or AMP-PNP. The samples were analysed by 4% non-denaturing polyacrylamide gel electrophoresis in 0.5× TBE buffer (45 mM Tris-borate and 1 mM EDTA), followed by ethidium bromide staining. Band intensities were quantitated by an Amersham Imager 680 with ImageQuant TL (Cytiva).

Visualization of RAD51 in the absence of nucleosomes and DNA

Wild-type (WT) RAD51 (92.5 µM) and the K64A/K70A (73.3 µM) and R235D (55.2 µM) mutants were incubated at 37 °C for 30 min in reaction buffer (34 mM HEPES-NaOH (pH 7.5), 135 mM NaCl, 1 mM MgCl₂, 0.9 mM dithiothreitol, 1.8 mM 2-mercaptoethanol, 0.03% NP-40 and 9% glycerol) in the presence of 1 mM AMP-PNP. Aliquots (2.5 μl) were applied to glow-discharged Quantifoil R1.2/1.3 200-mesh Cu grids. The grids were blotted at 4 °C for 4 or 6 s at 100% humidity, and then rapidly frozen in liquid ethane. Micrographs of RAD51 were collected on a Krios G4 microscope operated at 300 kV and a magnification of 81,000× (pixel size of 1.06 Å).

Saccharomyces cerevisiae strains and DNA damage sensitivity assays

The S. cerevisiae strains used in this study are listed in Extended Data Table 3. The rad51 deletion strain (Δrad51 strain) was generated by replacing the endogenous Rad51 gene with the kanamycin resistance gene (kanMX6). To construct rad51Δ + rad51 WT and mutant stains, the rad51 deletion (rad51Δ::kanMX6) strain was transformed with DNA fragments containing Rad51 (WT, Δrad51, rad51^K122A, rad51^K128A or rad51^K122A^/^K128A) -Ura3 genes, which were amplified by PCR or purchased (Integrated DNA Technologies). Strains were selected on synthetic complete medium without uracil (SC-Uracil: 6.7 g l⁻¹ Difco yeast nitrogen base without amino acids (BD Biosciences, 291940), 1.92 g l⁻¹ yeast Synthetic Drop-out medium supplements (Merck, Y1501-20G), 2% glucose and 2% Difco Bacto Agar).

S. cerevisiae cells were grown at 30 °C in yeast complete medium (YPD: 1% yeast extract, 2% peptone and 2% glucose) overnight. The pre-cultures were twofold diluted in YPD medium and incubated at 30 °C for 2 h. Afterwards, 8.0 × 10⁷ cells grown in YPD medium were collected and suspended in 1 ml of sterile water, and tenfold serial dilutions were prepared. For all spots, 5-μl aliquots of serial dilution samples were spotted on YPD plates in the absence or presence of 0.02% (v/v) MMS, 30 µM CPT or 150 mM HU. To assess the X-ray sensitivity, yeast cultures spotted onto YPD plates were irradiated with a CellRad X-ray irradiator (Faxitron Bioptics). The plates were incubated at 30 °C for several days. The quantification was performed using the third spot (1:100 dilution) of X-ray irradiation, according to a previously described method⁵³.

Protein extraction from S. cerevisiae and western blots

Cells (1.0 × 10⁸) grown in YPD medium were collected and suspended in 500 µl of ice-cold sterile water, and 75 µl of lysis buffer (2 M NaOH, 7.5% 2-mercaptoethanol) was added. After an incubation on ice for 10 min, 75 µl of 50% (v/v) trichloroacetic acid was added. After another 10 min incubation on ice, pellets obtained by centrifugation were resuspended in 60 µl Laemmli Sample Buffer (Bio-Rad, 1610737) with 5% (v/v) 2-mercaptoethanol, and the pH of the suspension was adjusted to alkaline using 1 M Tris (pH 8.8). Samples were then incubated at 65 °C for 10 min and the supernatant was used as the extracted proteins.

To detect endogenous S. cerevisiae Rad51, the extracted proteins were separated by SDS 10%-polyacrylamide gel electrophoresis. The gels were transferred onto membranes using an iBlot 2 Gel Transfer Device (Thermo Fisher Scientific), and the membranes were blocked with Blocking One-P (Nacalai Tesque). The membranes were then probed with the rabbit anti-S. cerevisiae Rad51 (1:5,000; BioAcademia, 62-101) antibody, with HRP-conjugated anti-rabbit IgG (1:5,000; Merck; NA9340) as the secondary antibody. As a loading control, α-tubulin was detected by HRP-conjugated anti-tubulin α (1:5,000; Bio-Rad, MCA77P). Can Get Signal (TOYOBO) was used for antibody dilution. Signals were enhanced by ECL Prime (Cytiva) and detected using an Amersham Imager 680 (Cytiva).

Statistical analysis

Statistical analyses were performed using R and Python. For the electrophoretic mobility shift assays, differences in band intensities were assessed between the canonical nucleosome and each nucleosome containing a histone H4 deletion mutant, as well as between RAD51 and each RAD51 mutant at each RAD51 concentration. In the spot assay, differences in spot intensities were estimated between the + WT strains and each mutant strain. Welch’s t-test was used to assess the differences in the means of the two datasets without conducting any pre-tests, as recommended⁵⁴.

Use of large language models

ChatGPT was used for grammatical correction of the text and supplied the basis of the Python programs. The programs were used to generate the quantification graphs and to process PDB files.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

[ad_2]

Source link

The UFM1 E3 ligase recognizes and releases 60S ribosomes from ER translocons

[ad_1]

Antibodies and recombinant proteins

Details of the antibodies and recombinant proteins used in this study are provided in Supplementary Table 1.

Mammalian cell culture and cell line generation

Flp-In T-REx HEK293 cells (Invitrogen, R78007) were cultured in high-glucose DMEM supplemented with 10% (v/v) fetal bovine serum (FBS), 50 mg ml⁻¹ penicillin–streptomycin and 2 mM l-glutamine. Cells were maintained at 37 °C under 5% CO₂ in an incubator in a humidified environment and routinely checked for mycoplasma. CDK5RAP3-KO cells were generated using CRISPR–Cas9. CRISPR sense and anti-sense guides were cloned into pX335 (DU64982) and pBABED puro U6 (DU64977) plasmids, respectively. In a separate strategy, single guide RNAs were cloned into the px459 vector (Addgene, 48139). In brief, around 2 million cells were seeded into a 10 cm dish in antibiotic-free Dulbecco’s modified Eagle medium (DMEM) and transfected with 1 μg plasmid DNA using Lipofectamine 2000 (Invitrogen, 1168019) according to the manufacturer’s instructions. Then, 24 h after transfection, cells were selected in 2 μg ml⁻¹ puromycin for 24 h followed by a 24 h recovery period in preconditioned medium. Cells were submitted for single-cell sorting, expanded and knockouts were confirmed by sequencing and immunoblot analysis.

Cytosolic and membrane fractionation

For chemical induction of ribosome stalling, cells were treated with 200 nM anisomycin for 4 h before collection. The parent cell line (Flp-In T-REx HEK293 cells) and KOs were washed once in ice-cold PBS, collected in ice-cold PBS and pelleted by centrifugation at 800g. Cell pellets (around 2 × 10⁶ cells) were resuspended in 125 μl of 0.02% (w/v) digitonin, 50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM CaCl₂, and 1× cOmplete protease inhibitor cocktail EDTA-free (Roche). Cells were incubated on ice for 10 min and centrifuged at 17,000g for 10 min at 4 °C. The supernatant was transferred to a fresh tube (cytoplasmic extract). The remaining pellet was washed with 1× PBS and centrifuged at 7,000g for 5 min at 4 °C. The pellet was resuspended in 125 μl 1% Triton X-100, 50 mM HEPES pH 7.5, 150 mM NaCl and 1× EDTA-free protease inhibitor cocktail tablet. This was further incubated on ice for 10 min and centrifuged at 17,000g for 10 min at 4 °C. The supernatant was transferred to a new Eppendorf tube (membrane extract). Equal volumes of the cytosolic and membrane fractions were resolved by SDS–PAGE and analysed using immunoblotting.

Expression and purification of recombinant proteins

UBA5, UFC1, UFM1, UFL1–UFBP1 and CDK5RAP3 were expressed and purified as described previously³. GST–3C–UFBP1(178–204) was applied onto Glutathione Sepharose 4B beads (Cytiva) followed by 3C-protease cleavage on the beads and purified on the HiLoad 26/600 Superdex 75 pg column, pre-equilibrated with 25 mM HEPES pH 7.5 and 200 mM NaCl. E3_mUU constructs were applied onto HisTrap columns, pre-equilibrated with 50 mM Tris pH 7.5, 200 mM NaCl, 20 mM imidazole (pH 8.0) and eluted with the same buffer containing 300 mM imidazole. Constructs with a cleavable His-tag were incubated with 1:50 TEV protease and dialysed against 25 mM Tris pH 7.5, 200 mM NaCl at 4 °C overnight and further purified on the HiLoad 26/600 Superdex 75 pg column, pre-equilibrated with 25 mM HEPES pH 7.5, 200 mM NaCl and 1 mM DTT. For crystallization of the E3_mUU(ΔUFIM)–UFC1 complex, 6×His-TEV-UFL1(1–179) was co-expressed with a UFC1-UFBP1 204-C fusion construct. Here, the His-tag was not cleaved.

Discharge assays

Single-turnover lysine discharge assays were performed to analyse the activity of UFC1 and UFL1–UFBP1 as described previously³. In brief, UFC1 was charged by incubating 0.5 μM UBA5, 10 μM UFC1 and 10 μM UFM1 in reaction buffer containing 50 mM HEPES pH 7.5, 50 mM NaCl, 0.5 mM DTT, 10 mM ATP and 10 mM MgCl₂ for 20 min. The reaction was quenched by addition of 50 mM EDTA (pH 8.0) to the reaction mix followed by incubation for 10 min at room temperature. Discharge was performed in the presence of 50 mM lysine (pH 8.0). The reaction was stopped at the indicated timepoints and analysed under non-reducing conditions on a 4–12% SDS–PAGE gel followed by Coomassie staining.

Preparation of 80S ribosomes and polysomes

HEK293 cells (around 80% confluency) grown in five 15 cm dishes were washed briefly with ice-cold PBS and collected in a 15 ml falcon tube. Cells were lysed in buffer containing 20 mM Tris pH 7.5, 150 mM NaCl, 5 mM MgCl₂, 1 mM DTT, 100 µg ml⁻¹ cycloheximide, 1% Triton X-100, 1× cOmplete protease inhibitor cocktail, EDTA-free (Roche) and RNasin for 10 min on ice followed by centrifugation at 13,000g for 10 min. The clarified supernatant was collected and layered onto a 10–50% sucrose gradient containing 20 mM Tris pH 7.5, 150 mM NaCl, 5 mM MgCl₂, 1 mM DTT, 100 µg ml⁻¹ cycloheximide and 1% Triton X-100, followed by centrifugation at 36,000 rpm for 3 h using the SW41 Ti rotor. The fractions containing 80S ribosomes and polysomes were collected and layered onto a 50% sucrose cushion and centrifuged at 40,000 rpm for 12 h in a Type 70 Ti rotor. Ribosome pellets were then resuspended in buffer containing 20 mM HEPES pH 7.6, 100 mM KCl, 5 mM Mg(OAc)₂, 10 mM NH₄Cl and 1 mM DTT and stored at −80 °C until further use.

Purification of stable 60S ribosomes from HEK293 cells

60S ribosomes were purified as described previously^39,40 with minor changes. HEK293 cells were grown to around 80% confluency in fifteen 15 cm dishes with medium containing high-glucose DMEM supplemented with 10% (v/v) FBS, 50 mg ml⁻¹ penicillin–streptomycin and 2 mM l-glutamine. To collect cells, the medium was first removed by aspiration, washed with ice-cold PBS followed by removal of PBS by aspiration. Cells were scrapped in residual PBS and transferred to a 15 ml falcon. Cells were pelleted by centrifugation at 1,000g for 3 min and the supernatant was discarded. Next, the cell pellets were resuspended in lysis buffer (containing 15 mM Tris pH 7.6, 1,500 mM NaCl, 10 mM MgCl₂, 1% Triton X-100, 2 mM DTT, RNAsin (60 U), 1× cOmplete mini protease inhibitor cocktail (Roche)) and mixed gently followed by incubation on ice for 10 min. The cell lysates were then centrifuged at 17,000g for 10 min and the supernatant was collected. The collected supernatant was layered directly onto a high-salt sucrose cushion containing 20 mM Tris pH 7.5, 500 mM KCl, 30% (v/v) sucrose, 10 mM MgCl₂, 0.1 mM EDTA pH 8.0 and 2 mM DTT. Total ribosomes were sedimented by centrifugation at 63,000g (24,800 rpm) for 18 h using a Type 70 Ti rotor (Beckman Coulter). The sedimented ribosomes were then resuspended in buffer containing 20 mM Tris pH 7.5, 500 mM KCl, 7.5% (v/v) sucrose, 2 mM MgCl₂, 75 mM NH₄Cl, 2 mM puromycin and 2 mM DTT. The resolubilized pellet containing ribosomes was incubated at 4 °C for 1 h and then at 37 °C for 1.5 h. To isolate 40S and 60S ribosomal subunits, the solution was layered directly onto a linear 10–30% sucrose gradient containing 20 mM Tris pH 7.5, 500 mM KCl, 6 mM MgCl₂ and 2 mM DTT. The 60S and 40S were separated by centrifugation at 49,123g (16,800 rpm) for 9 h 42 min at 4 °C using a SW41 Ti rotor (Beckman Coulter). Gradients were fractionated into 0.5 ml fractions using the BioComp fractionating system. The fractions containing 60S ribosomal subunits were collected and exchanged into buffer containing 20 mM HEPES pH 7.2, 100 mM KCl, 5 mM MgCl₂, 2 mM DTT and stored at −80 °C.

In vitro UREL–ribosome association assays

Approximately, 0.2 µM of preformed UREL was added to a mixture of 0.2 µM of 60S ribosomes (1×) and 0.5 µM of 80S ribosomes (2.5×) and incubated for 15 min at 23 °C. After incubation, the mix was layered onto a 10–50% sucrose gradient containing 20 mM HEPES pH 7.5, 50 mM KCl, 5 mM MgCl₂ and centrifuged at 36,000 rpm for 6 h at 4 °C. The samples were then manually fractionated into 22 fractions (100 µl each) and analysed for co-migration by immunoblotting using the indicated antibodies.

Cryo-EM sample preparation

Reconstitution of stable ribosome–E3 complexes

Approximately 10 µM of UREL complexes was incubated with 1 µM of purified 60S ribosomes in the presence of excess UFC1–UFM1 conjugate (5 µM) in buffer containing 20 mM HEPES pH 7.2, 50 mM KCl, 5 mM MgCl₂ and 0.25 mM TCEP for 2 h at 4 °C. After incubation, the samples were mixed with 0.05% glutaraldehyde for 30 s at 23 °C followed by quenching with 100 mM Tris pH 8.0 (final concentration). The cross-linked sample was then layered onto a 10–30% sucrose gradient containing 20 mM HEPES pH 7.5, 50 mM KCl, 5 mM MgCl₂ and 0.25 mM TCEP, and centrifuged using the TLS55 rotor at 24,000 rpm for 6 h at 4 °C. The sucrose gradient of 2.2 ml volume was then manually fractionated into 100 µl fractions and analysed for co-migration of UREL components, 60S ribosomes and UFC1–UFM1 by immunoblotting. The fractions containing UREL–60S ribosome–UFC1–UFM1 were then pooled and concentrated to 7.7 mg ml⁻¹ and buffer-exchanged to remove excess sucrose.

Reconstitution of UFMylated 60S ribosome–UREL complexes

First, an in vitro UFMylation reaction was performed by incubating 0.1 µM UBA5, 5 µM UFC1, 10 µM UFM1, 3 µM UFL1–UFBP1, 5 µM CDK5RAP3 and 1 µM 60S ribosomes in the presence of 5 mM MgCl₂ and 5 mM ATP. After the reaction, 10 µM UFC1–UFM1 was added to the reaction and further incubated at 4 °C for 2 h. The reaction products were then separated on a sucrose gradient and the fractions containing 60S–UREL–UFC1–UFM1 were collected as described in the previous section.

Cryo-EM data collection and image processing

UREL–60S EM grid preparation

Cryo-grids were prepared with 0.05% glutaraldehyde-cross-linked 60S–UREL–UFC1–UFM1 complex at 7.7 mg ml⁻¹ in 25 mM HEPES pH 7.5, 50 mM KCl, 5 mM MgCl₂, 2 mM DTT. Quantifoil R3.5/1 copper 200 mesh holey grids were glow discharged using the PELCO easiGlow glow discharge unit at 15 mA for 30 s. Cryo-grids were prepared using the Thermo Fisher Scientific Vitrobot MK IV with a chamber temperature of 4 °C and 100% humidity. A total of 3 μl of protein was applied to the grid and immediately blotted for 6 s with blot force 1, followed by rapid plunge-freezing into liquid ethane.

UREL–60S cryo-EM data collection

Single-particle cryo-EM data were collected on the Thermo Fisher Scientific Titan Krios G2 transmission electron microscope with a Thermo Fisher Scientific Falcon 4i direct electron detector and SelectrisX energy filter. Data were collected with an accelerating voltage of 300 kV and nominal magnification of ×165,000, which corresponds to a pixel size of 0.74 Å (full data acquisition settings are shown in Extended Data Table 1). A total of 59,394 cryo-EM videos was acquired.

UREL–60S image processing

Cryo-EM videos were imported, beam-induced motion corrected (MOTIONCOR2) and the CTF parameters were estimated (CTFFIND4.1) using RELION (v.3.1)^41,42,43. Approximately 2.2 million particles were picked from motion-corrected micrographs using crYOLO (v.1.6.1)⁴⁴ untrained particle picking (2019 general model) with a particle box size of 400 pixels and a picking confidence threshold of 0.2. Picked particles were extracted in RELION with a particle box size of 588 pixels, rescaled to 128 pixels (rescaled pixel size, ~3.4 Å). Extracted particles were imported into cryoSPARC (v.3.2)⁴⁵ for processing. Seven rounds of reference-free 2D class averages were generated with the initial classification uncertainty factor set between 2 and 7, the number of online-EM iterations set to 40 and batchsize per class set to 200, and all ribosome-like particles were taken forward. The selected 1.6 million particles were used to generate an initial 3D model with C₁ symmetry. The initial 3D model was further refined using the non-uniform refinement algorithm with the dynamic masking start resolution set to a value below the resolution of the data (that is, 1 Å) to generate a refined 3D model and a mask that encompasses the entire box size. The mask and model were input for 3D variability analysis asking for three classes. Particles from the class containing ligase-bound 60S ribosomes were taken forward for another round of 3D refinement, this time with dynamic masking start resolution set to default (12 Å) and the dynamic mask threshold set to 0.1. This was then followed by several more rounds of 3D variability analysis, asking for two classes to separate ligase-bound 60S ribosomes from unbound 60S ribosomes, resulting in 356,394 ligase-bound ribosome particles. Particles were then downsampled to 128 pixels and a cryoDRGN (v.3.2.0)⁴⁶ model was trained with 8 latent dimensions and 50 training iterations. CryoDRGN particle filtering removed 57,386 junk particles, resulting in a final particle stack of 299,008 particles. The homogenous particle population containing ligase-bound ribosomes were re-extracted in Relion at the full box size. A 3D model was generated with C₁ symmetry, followed by non-uniform refinement with per particle defocus optimization, Ewald sphere correction and CTF refinement in cryoSPARC (v.4.2.1) to generate the ligase-bound 60S ribosome map.

To further refine the density for the ligase complex, two masks were created from the final 3D refinement volume using UCSF ChimeraX (v.1.2.5)⁴⁷: one that encompasses the ligase complex plus RPL10a and another that encompasses the ribosome. The ribosome mask was used for particle signal subtraction. Signal-subtracted particles were then used for local refinement of the ligase complex plus RPL10a using the ligase mask to generate a ligase-only map. A cryoSPARC (v.4.2.1) 3DFlex¹⁹ training model was generated for the ligase with 6 latent dimensions and a rigidity prior of 2. The resulting 3DFlex model was used for 3DFlex reconstruction with 40 max BFGS iterations to generate the final ligase map.

UREL–60S model building

The ligase-bound 60S map was sharpened using Phenix (v.1.2.1)⁴⁸ autosharpen map job and the ligase-only map was sharpened using the DeepEMhancer⁴⁹ tight target sharpening protocol. Atomic models were built using Coot (v.0.9.8.1)⁵⁰. For the ligase-bound 60S ribosome map, PDB 7QWR (ref. ⁵¹) was used as a starting model for the 60S ribosome by rigid-body fitting the model into the density map, followed by rebuilding in Coot. No ligase components were built into the ligase-bound ribosome map except for the UFL1 PTC loop. For the ligase complex, AlphaFold2 models of the individual proteins were separated into smaller segments and then rigid-body fitted into the density map, followed by manual rebuilding in Coot. The UFL1 CTD (residues 515–786), CDK5RAP3 UUBD (residues 15–116) and UFM1 displayed poor side-chain density and the side chains of these regions were therefore set to an occupancy of 0. Atomic models were refined using Phenix real space refinement and validated using MolProbity. All 3D density maps were visually inspected in UCSF ChimeraX (v.1.2.5)⁴⁷.

UFMylated ribosome data collection and image processing

Cryo-EM grids were prepared as described above with 1.5 mg ml⁻¹ sample. Single-particle cryo-EM data were collected on the Thermo Fisher Scientific Titan Krios G2 transmission electron microscope with a Thermo Fisher Scientific Falcon 4 direct electron detector. Data were collected with an accelerating voltage of 300 kV and a nominal magnification of ×96,000, corresponding to a pixel size of 0.82 Å (full data-acquisition settings shown in Extended Data Table 1). A total of 3,028 cryo-EM videos was acquired. The data were processed as previously, with the final map being generated from the particles after several rounds of 3D variability analysis.

XL-MS sample preparation and analysis

Approximately 1.2 µM UFL1–UFBP1, 2 µM CDK5RAP3, 0.2 µM ribosomes and 10 µM of UFC1–UFM1 were incubated with 1 mM DSBU (disuccinimidyl dibutyric urea) in buffer containing 50 mM HEPES pH 7.5, 50 mM KCl, 6 mM MgCl₂, 0.5 mM TCEP for 30 min at 23 °C. The reaction was quenched by addition of 50 mM Tris pH 8.0. Cross-linked samples were processed for MS analysis using S-Trap micro spin columns (Protifi) according to the manufacturer’s protocol. In brief, cross-linked samples were reduced by adding 20 mM DTT (10 min, 50 °C), and then alkylated with 40 mM iodoacetamide (30 min, 20 °C). The samples were acidified by the addition of phosphoric acid to a final concentration of 5%, and subsequently diluted with 90% methanol in 100 mM triethylammonium bicarbonate (TEAB) pH 7.1 (1:7 (v/v) sample: buffer). A total of 1 µg trypsin (Promega) was added, and the samples were then bound to a S-Trap micro spin column (Protifi). Subsequently, the column was washed three times with 90% methanol in 100 mM TEAB. An additional 0.6 µg of trypsin was applied to the column, and digestion was then performed by incubating the S-trap column at 47 °C for 90 min. Peptides were recovered by washing the column sequentially with 50 mM TEAB (40 µl), 0.2% (v/v) formic acid (40 µl) and 50% acetonitrile/0.2% (v/v) formic acid (40 µl). The eluate was then evaporated to dryness in a vacuum centrifuge and the peptides were resuspended in 5% (v/v) acetonitrile/0.1% (v/v) formic acid (20 μl) before MS analysis. Peptides (5 µl) were injected onto the Vanquish Neo LC (Thermo Fisher Scientific) system and the peptides were trapped on the PepMap Neo C18 trap cartridge (Thermo Fisher Scientific, 5 µm particle size, 300 µm × 0.5 cm) before separation using the Easy-spray reverse-phase column (Thermo Fisher Scientific, 2 µm particle size, 75 µm × 500 mm). Peptides were separated by gradient elution of 2–40% (v/v) solvent B (0.1% (v/v) formic acid in acetonitrile) in solvent A (0.1% (v/v) formic acid in water) over 80 min at 250 nl min⁻¹. The eluate was infused into an Orbitrap Eclipse mass spectrometer (Thermo Fisher Scientific) operating in positive-ion mode. Orbitrap calibration was performed using FlexMix solution (Thermo Fisher Scientific). Data acquisition was performed in data-dependent analysis mode and fragmentation was performed using higher-energy collisional dissociation. Each high-resolution full scan (m/z 380–1,400, R = 60,000) was followed by high-resolution product ion scans (R = 30,000), with a stepped normalized collision energies of 21%, 26% and 31%. A cycle time of 3 s was used. Only charge states 3–8⁺ were selected for fragmentation. Dynamic exclusion of 60 s was used. Cross-link identification was performed using Proteome discoverer (v.3.0) and the in-built XlinkX module (Thermo Fisher Scientific) using the following settings: crosslinker: DSBU, mass deviation tolerances of 10 ppm in MS and 0.02 Da for Sequest HT and 20 ppm for XlinkX tandem MS (MS/MS). Carbamidomethylation of Cys residues was set as a static modification, and dynamic modifications were set as Met oxidation and DSBU dead-end modifications (DSBU-amidated, DSBU Tris and DSBU hydrolysed) (maximum of three modifications per peptide). Only results with scores corresponding to a false-discovery rate of <1% were taken forward. Finally, a minimum XlinkX score of 45 was used to filter cross-linked peptides^52,53.

Ribosome UFMylation assays

Ribosome UFMylation assays were performed as described previously³. Purified 60S ribosomes (approximately 0.05 µM) were mixed with 0.5 μM UBA5, 1 μM UFC1, 1 μM UFM1 and 0.1 µM UFL1–UFBP1 in a reaction buffer containing 25 mM HEPES pH 7.5, 100 mM NaCl, 10 mM MgCl₂ and 5 mM ATP and incubated at 37 °C for 10 min or the indicated time duration. The reaction was stopped by the addition of SDS loading buffer and run on a 4–12% SDS–PAGE gel under reducing conditions followed by immunoblotting using the indicated antibodies. In reactions containing CDK5RAP3, approximately 0.15 µM of CDK5RAP3 was added to the reaction along with 0.1 µM of UFL1–UFBP1.

Polysome profiling using HEK293 cell lysates

Polysomes were isolated from HEK293 cells as described previously with slight modification. In brief, HEK293 cells were seeded one night before the experiment. On the day of the experiment, cells were treated with either 0.1% DMSO or 200 nM anisomycin for around 20 min before collection. Cells were washed with ice-cold PBS, scraped off and pelleted by centrifugation at 800g for 5 min. The pellet was then resuspended in lysis buffer containing 20 mM Tris pH 7.5, 150 mM NaCl, 5 mM MgCl₂, 1 mM DTT, 100 µg ml⁻¹ cycloheximide, 0.02% Digitonin, cOmplete protease inhibitor cocktail, EDTA-free (Roche) and RNasin. Digitonin-treated cells were incubated for 5 min on ice and centrifuged at 17,000g for 10 min at 4 °C. The supernatant containing the cytoplasmic extract was discarded and the remaining pellet was washed with 20 mM Tris pH 7.5, 150 mM NaCl and 5 mM MgCl₂ and centrifuged at around 7,000g for 5 min. Supernatant was discarded and the pellet was resuspended in lysis buffer containing 20 mM Tris pH 7.5, 150 mM NaCl, 5 mM MgCl₂, 1 mM DTT, 100 µg ml⁻¹ cycloheximide, 0.5% Triton X-100, cOmplete protease inhibitor cocktail, EDTA-free (Roche) and RNasin. The resuspended pellets were incubated on ice for 10 min and centrifuged at 17,000g for 10 min at 4 °C. The supernatant containing the membrane fraction extract was transferred to a new Eppendorf tube and the amount of RNA was quantified for each sample using the NanoDrop system. RNA-normalized samples were then layered onto a 10–50% sucrose gradient containing 20 mM Tris pH 7.5, 150 mM NaCl, 5 mM MgCl₂, 1 mM DTT, 100 µg ml⁻¹ cycloheximide and RNAsin, and then centrifuged at 36,000 rpm for 3 h. Polysomes were then separated by fractionation using the Biocomp fractionating system and analysed using western blotting.

Comparison of 60S and 80S UFMylation in vitro

In vitro UFMylation reactions were performed by incubating 0.1 µM 60S ribosome, 0.2 µM or 0.3 µM enriched 80S (two or threefold excess over 60S) with 0.5 µM UBA5, 1 µM UFC1, 1 µM UFM1, 0.3 µM UFL1–UFBP1 and 0.3 µM CDK5RAP3 in the presence of 5 mM MgCl₂ and 5 mM ATP at 37 °C for 15 min. After incubation, the reaction mix was layered over a 10–50% sucrose gradient containing 20 mM Tris pH 7.5, 150 mM NaCl, 5 mM MgCl₂, 1 mM DTT and centrifuged at 36,000 rpm for 3 h at 4 °C using a SW41 Ti rotor. The gradients were fractionated using the BioComp fractionation system. The sucrose gradient fractions were then run on a 4–12% SDS–PAGE gel and analysed for UFMylation of RPL26 by immunoblotting.

Preparation of membrane-associated 60S ribosomes

Parental cells (WT HEK293) or CDK5RAP3-KO cells (around 80% confluency) grown in ten 15 cm dishes were washed briefly with ice-cold PBS and collected in a 15 ml falcon tube. Cells were pelleted down by centrifugation at 500g for 5 min. Cell pellets were resuspended in buffer containing 20 mM Tris pH 7.5, 150 mM NaCl, 5 mM MgCl₂, 1 mM DTT, 100 µg ml⁻¹ cycloheximide, 0.02% (w/v) digitonin, 1× cOmplete protease inhibitor cocktail, EDTA-free (Roche) and RNasin for 10 min on ice followed by centrifugation at 17,000g for 10 min. The clarified supernatant is the cytosolic fraction and was discarded. The remaining membrane pellet was resuspended in lysis buffer containing 20 mM Tris pH 7.5, 150 mM NaCl, 5 mM MgCl₂, 1 mM DTT, 100 µg ml⁻¹ cycloheximide, 1% (w/v) decyl maltose neopentyl glycol (DMNG), 1× cOmplete protease inhibitor cocktail, EDTA-free (Roche) and RNasin for 15 min on ice, and then centrifuged at 17,000g for 10 min. The clarified supernatant was collected and layered onto a 10–30% sucrose gradient containing 20 mM Tris pH 7.5, 150 mM NaCl, 5 mM MgCl₂, 1 mM DTT, 100 µg ml⁻¹ cycloheximide and 0.01% DMNG, and then centrifuged at 36,000 rpm for 3 h using the SW41 Ti rotor. Fractions containing 60S ribosomes were collected and exchanged into buffer containing 20 mM HEPES pH 7.2, 100 mM KCl, 5 mM MgCl₂ and 2 mM DTT and stored at −80 °C until use.

In vitro 60S ribosome–SEC61 dissociation assays

The in vitro 60S–SEC61 dissociation reaction was performed by incubating 0.05 µM membrane solubilized 60S ribosomes (60S–SEC61 solubilized and enriched from CDK5RAP3-KO cells) with 0.5 µM UBA5, 1 µM UFC1, 1 µM UFM1, 0.1 µM UFL1–UFBP1, 0.1 µM CDK5RAP3 in the presence of 5 mM MgCl₂ and 5 mM ATP at 37 °C for 25 min. At the end of the reaction, the reaction mix was layered over a 10–50% sucrose gradient containing 20 mM Tris pH 7.5, 150 mM NaCl, 5 mM MgCl₂ and 1 mM DTT, and centrifuged at 36,000 rpm for 3 h using the SW41 Ti rotor. Sucrose gradients were fractionated using the BioComp fractionation system. The sucrose gradient fractions were separated on a 4–12% SDS–PAGE gel and analysed for co-migration of SEC61β with 60S ribosomes by immunoblotting.

LC–MS/MS sample preparation, data acquisition and analysis

First, an in vitro ribosome UFMylation reaction was performed to generate UFMylated ribosomes in the presence of either UFL1–UFBP1 or UREL. Then, the reaction products were run on a 4–12% SDS–PAGE gel to separate the mono- and di-UFMylated ribosomes. Next, the bands corresponding to mono- and di-UFMylated ribosomes were excised and in-gel digestion was performed according to a previously described protocol⁵⁴. Digested peptides were analysed by liquid chromatography coupled with MS/MS (LC–MS/MS) on the Exploris 240 (Thermo Fisher Scientific) system coupled to the Evosep One (Evosep). The samples were loaded onto the Evotips according to the manufacturer’s recommendations and analysed using the 30 SPD method. Peptides were then analysed in on the Exploris 240 system using data-dependant acquisition with an MS1 resolution of 60,000, an AGC target of 300% and a maximum injection time of 25 ms. Peptides were then fragmented using TOP 2 s method, MS2 resolution of 15,000, NCE of 30%, AGC of 100% and maximum injection time of 100 ms. Peptide identification was performed in MaxQuant (v.2.0.2.0) against UniProt SwissProt Human containing isoforms (released 5 May 2021) with match between runs enabled. Carbamidomethylation (C) was set as a fixed modification and oxidation (M), acetyl (protein N-term) and the addition of the dipeptide valine–glycine (K) were set as variable modifications. The other parameters were left as the default.

Preparation of isopeptide-linked UFC1–UFM1 conjugate

First, 30 µM UBA5, 30 µM UFC1(C116K) and 60 µM UFM1 were incubated in 25 mM HEPES pH 7.5, 200 mM NaCl, 10 mM MgCl₂ and 10 mM ATP. The pH of the reaction mixture was adjusted to 9.8 with 0.5 M CAPS, pH 11.5, and incubated for 18 h at 23 °C. UFC1–UFM1 was subsequently separated from UBA5 and unreacted UFC1 and UFM1 using the HiLoad 26/600 Superdex 75 pg column, pre-equilibrated with 25 mM HEPES pH 7.5, 200 mM NaCl, 1 mM DTT.

Crystallization and structure determination

UFC1–UFM1 conjugate

UFC1–UFM1 crystals were obtained using the sitting-drop vapour diffusion technique whereby UFC1–UFM1 (22.8 mg ml⁻¹) was 1:1 mixed with 30% (v/v) PEG 400, 0.1 M Tris pH 8.5, 0.2 M Na citrate and incubated at 19 °C. Single crystals appeared within 2–3 days. Crystals were flash-frozen in crystallization buffer containing 30% (v/v) ethylene glycol. Datasets were collected at Diamond Light Source (DLS), beamline I04, and processed with Xia2 (ref. ⁵⁵) and DIALS⁵⁶. The crystal structure was solved by molecular replacement (PHASER)⁵⁷ using the crystal structures of UFC1 (PDB: 3EVX)⁵⁸ and UFM1 (PDB: 5IA7)⁵⁹ as the starting model. Refinement and model building was performed using REFMAC⁶⁰ and Coot⁵⁰ (CCP4i2 suite), respectively. The statistics for data collection and refinement are listed in Extended Data Table 2.

UFL1–UFBP1–UFC1 complex

UFL1–UFBP1–UFC1 crystals were obtained using the sitting-drop vapour diffusion technique whereby UFL1–UFC1–UFBP1 (20.2 mg ml⁻¹) was 1:1 mixed with 1.03 M Li₂SO₄, 0.1 M HEPES pH 7.2 and incubated at 19 °C. Single crystals appeared within 1–2 days. Crystals were flash-frozen in crystallization buffer containing 30% (v/v) ethylene glycol. Datasets were collected at the European Synchrotron Radiation Facility (ESRF), beamline ID23-EH2, and processed with the autoPROC suite⁶¹ (including XDS⁶², Pointless⁶³ Aimless⁶⁴, CCP4 (ref. ⁶⁵) and STARANISO⁶⁶). The crystal structure was solved by molecular replacement (PHASER)⁵⁷ using the AlphaFold¹¹ predicted models for UFL1 and UFBP1 and the crystal structure of UFC1 (PDB: 3EVX)⁵⁸ as starting models. Refinement and model building was performed using REFMAC⁶⁰ and Coot⁵⁰ (CCP4i2 suite), respectively. The statistics for data collection and refinement are listed in Extended Data Table 2.

SEC

Analytical SEC runs were performed using the Superdex 200 Increase 3.2/300 column, pre-equilibrated with 25 mM HEPES pH 7.5, 200 mM NaCl, 0.5 mM TCEP. A total of 50 µl protein of the different components was mixed and incubated on ice for 30 min before loading onto the column.

ITC

ITC experiments were performed using a MicroCal PEAQ-ITC (Malvern). Proteins were first dialysed into ITC buffer containing 25 mM HEPES pH 7.5, 200 mM NaCl, 0.44 mM TCEP. Each experiment consisted of 13 injections for a duration of 6 s each followed by a 150 s spacing between injections except the experiment for UFBP1 UFIM–UFM1, which consisted of 19 injections instead. All of the experiments were performed at 25 °C.

Figures

Adobe Illustrator, BioRender and ChimeraX⁴⁷ were used to make figures.

Materials availability

All cDNA constructs in this study were generated by H.M.M., J.J.P. and the cloning team at the MRC PPU Reagents and Services team. All of the plasmids have been deposited at the MRC PPU Reagents and Services and are available at https://mrcppureagents.dundee.ac.uk/.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

[ad_2]

Source link

Targeted protein degradation via intramolecular bivalent glues

[ad_1]

Chemical synthesis

Additional details are provided in the Supplementary Methods.

Plasmids and oligonucleotides

The design and construction of the human CRL-focused sgRNA library used for BRD4 stability screens, lentiviral sgRNA expression vectors used for single gene knockouts, as well as viral vectors used for the engineering of inducible Cas9 cell lines have been described previously^48,49. For the engineering of the fluorescent protein stability reporters, the short isoform of BRD4 (BRD4(S)) (Twist Bioscience), BRD2 (Addgene plasmid #65376, a gift from K. Miller⁵⁰) or BRD3 (Addgene plasmid #65377, a gift from K. Miller⁵⁰) were cloned into a pRRL lentiviral vector, fused to a 3×V5 tag and mTagBFP, and coupled to mCherry for normalization. For knockout and rescue studies, DCAF16 open reading frame cDNA (Twist Bioscience) was synonymously mutated to remove the sgRNA protospacer adjacent motif and seed sequence, coupled to a Flag tag and cloned into a pRRL lentiviral vector expressing iRFP670 for flow-cytometric detection. All plasmids and sgRNAs used in this study are shown in Extended Data Table 1, and the CRL-focused sgRNA libraries used for FACS-based and viability-based CRISPR–Cas9 screens are shown in Supplementary Tables 2 and 4, respectively.

Cell culture

HEK293, HCT-116, HeLa and MV4;11 cell lines, originally sourced from ATCC, were provided by the MRC PPU reagents facility at the University of Dundee. KBM7 iCas9 cells were a gift from J. Zuber. HEK293, HeLa, Lenti-X 293 T lentiviral packaging cells (Clontech) and HCT-116 were cultured in DMEM (Gibco) supplemented with 10% fetal bovine serum (FBS; Thermo Fisher), 100 U ml⁻¹ penicillin-streptomycin (Thermo Fisher) and 2 mM l-glutamine (Thermo Fisher). MV4;11 and KBM7 cells were cultured in IMDM (Gibco), supplemented with the same additives as above. All cell lines were grown in a humidified incubator at 37 °C and 5% CO₂ and routinely tested for mycoplasma contamination. All cell lines were authenticated by short tandem repeat profiling.

Lentivirus production and transduction

Semiconfluent Lenti-X cells were co-transfected with lentiviral plasmids, the lentiviral pCMVR8.74 helper (Addgene plasmid #22036, a gift from D. Trono) and pMD2.G envelope (Addgene plasmid #12259, a gift from D. Trono) plasmids using polyethylenimine (PEI) transfection (PEI MAX MW 40,000, Polysciences) as previously described. Virus containing supernatant was clarified by centrifugation. Target cells were infected at limiting dilutions in the presence of 4 μg ml⁻¹ polybrene (Santa Cruz Biotechnology).

CRISPR–Cas9 DCAF15-knockout cell line generation

The HCT-116 DCAF15-knockout cell line was generated via ribonuclear protein (RNP) transfection using sgRNAs (IDT) targeting DCAF15 exon 2 and exon 4 (Extended Data Table 1), spCas9 Nuclease V3 (IDT) and TransIT-X2 (Mirus Bio). Following transfection for 48 h, cells were trypsinized and re-plated in 96-well plates at low density and allowed to grow for >2 weeks. Single colonies were isolated and expanded and verified for DCAF15 knockout via western blotting, using an optimized RBM39 degradation assay as well as via genomic DNA sequencing.

CRISPR–Cas9 HiBiT and BromoTag knock-in cell line generation

HiBiT BRD2, BRD3 and BRD4 cell lines were generated via RNP transfection of single-stranded DNA oligonucleotides (IDT) as the ssODN donor templates, spCas9 (Sigma-Aldrich) and target-specific sgRNA (IDT) (Extended Data Table 1). HEK293 cells were resuspended in buffer R (Thermo Fisher), along with the RNP complex and ssODN template, and electroporated using a 10 µl Neon Electroporation System cuvette tip (Thermo Fisher). Immediately following electroporation, cells were added to pre-warmed DMEM supplemented with 10% FBS and 100 U ml⁻¹ penicillin–streptomycin added for BromoTag cell lines only. Edited pools were analysed for HiBiT insertion by assaying for luminescence on a PHERAstar spectrophotometer (BMG Labtech) 48–72 h post-electroporation. Successful knock-in of HiBiT three days post-electroporation was first established using HiBiT lytic assay (Promega) on the mixed cell population. Following identification of luminescent signal these cells underwent single cell sorting using an SH800 cell sorter (Sony Biotechnology). Single cells were sorted into 3× 96-well plates per experiment in 200 μl of 50% filtered preconditioned media from healthy cells and 50% fresh DMEM. After two weeks, all visible colonies were expanded, validated using the HiBiT lytic assay.

BromoTag cell lines were generated in HEK293 cells via simultaneous transfection of two vectors at a 4:1 reagent:DNA ratio with FuGENE 6 (Promega). The first vector was a pMK-RQ vector containing 500-bp homology arms on either side of either an eGFP-IRES-BromoTag or eGFP-IRES-HiBiT-BromoTag sequence for integration into MCM4 and BRD4, respectively (Extended Data Table 1). The second vector was a custom pBABED vector harbouring U6-sgRNA, Cas9 and puromycin expression cassettes. Following transfection, cells were repeatedly washed with PBS and then treated with 1 µg ml⁻¹ puromycin for one week before FACS sorting. Single cell clones were generated by FACS sorting of single GFP⁺ cells using an SH800 cell sorter and sorting between 2 to 10 96-well plates in 200 μl of 50% filtered preconditioned media from healthy cells mixed with 50% fresh media.

siRNA-mediated knockdown

Cells were transfected for 48 h using ON-TARGETplus SMARTPool siRNAs for DCAF15, DCAF16, DDB1, RBX1, CUL4A and CUL4B (all from Dharmacon) and RNAiMAX (Invitrogen) following the manufacturer’s instructions, with 35 pmol of siRNA per well in 6-well plates. When simultaneously targeting two genes, half the amount of siRNA was used for each gene.

Cell viability assay

MV4;11, HCT-116 or KBM7 cells were plated in 96-well plates at a density of 0.5 × 10⁶ (MV4;11 and HCT-116) or 0.1 × 10⁶ (KBM7) cells per ml in 50 µl cell suspension per well. The following day, 2× stocks of compounds were added for a final volume of 100 µl. Cells were treated for 24 h (MV4;11), 72 h (KBM7) or 96 h (HCT-116) in a humidified incubator at 37 °C and 5% CO₂. CellTiterGlo (G7570, Promega) or CellTiterGlo 2.0 reagent (G924A, Promega) was added to the plates per manufacturer instructions, before shaking the plate for 3–20 min at 300 rpm and measuring the luminescence using a PHERAstar (BMG Labtech) operated on PHERAstar software (firmware v1.33) or VICTOR X3 (PerkinElmer) multilabel plate reader operated on PerkinElmer 2030 software (v4.0). The results were normalized to DMSO controls and analysed using Graphpad Prism (v9.5.1) to derive EC₅₀ values by four-parameter non-linear regression curve fitting or interpolation of a sigmoidal standard curve.

Degradation assays and western blotting

HEK293 and HCT-116 cells were plated in 6-well plates at varying densities (0.2 to 0.6 × 10⁶ cells per ml) depending on experimental setup. In all experiments, media was changed prior to compound treatment. Stock solutions of compounds were prepared in DMSO at a concentration of 10 mM and stored at −20 °C. Working dilutions were made fresh using DMEM media and added dropwise to 6-well plates. For competition assays, cells were pre-treated with 10 µM of the competition compounds, 3 µM MLN4924 or 50 µM MG132 for 1 h, before treating with IBG1 at 10 nM for 2 h.

For cell collection, cells were washed once with ice-cold PBS before lysis for 15 min on ice with RIPA buffer supplemented with benzonase (1:1,000, Sigma or Millipore 70746) and cOmplete EDTA-free Protease Inhibitor Cocktail (11873580001, Roche). Following clearance via centrifugation, protein concentration of lysates was determined using the Pierce BCA Protein Assay (23225, Fisher Scientific) and 20–30 µg of lysate was prepared using 4× LDS sample buffer (Thermo Fisher) and 10% 2-mercaptoethanol or 50 mM dithiothreitol (DTT) and run on NuPAGE 4–12% bis-tris gels (Thermo Fisher). Proteins were transferred to nitrocellulose membranes, blocked for 1 h in 5% milk TBS-T at room temperature, before incubating with primary antibodies overnight at 4 °C. The following primary antibodies were used: BRD2 (1:1,000, no. Ab139690, Abcam), BRD3 (1:2,000, Ab50818, Abcam), BRD4 (1:1,000, E2A7X, 13440, Cell Signaling Technology and Ab128874, Abcam), BromoTag (1:1,000, NBP3-17999, Novus Biologicals), CUL4A (1:2,000, A300-738A, Bethyl Laboratories), CUL4B (1:2,000, 12916-1-AP, Proteintech), DDB1 (1:1,000, A300-462A, Bethyl Laboratories), MCM4 (1:1,000, ab4459, Abcam) RBM39 (1:1,000, HPA001591, Atlas Antibodies), RBX1 (1:1,000, D3J5I, 11922, Cell Signalling Technology), DCAF11 (1:2,000, A15519, ABclonal), cleaved caspase-3 (1:1,000, D3E9, 9579, Cell Signalling Technology), PARP1 (1:1,000, 9542, Cell Signalling Technology), MYC (1:500, D84C12, 5605, Cell Signalling Technology), β-actin (1:10,000, AC-15, A5441, Sigma-Aldrich), α-tubulin (1:500, DM1A, T9026, Sigma-Aldrich). Membranes were then washed in TBS-T and incubated with fluorescent or horseradish peroxidase (HRP)-conjugated secondary antibodies for 1 h at room temperature, before further washes and imaging on a ChemiDoc Touch imaging system (Bio-Rad) operated on Image Lab software (v2.4.0.03). Secondary antibodies used were HRP anti-rabbit IgG (1:2500, 7074, Cell Signaling Technology), HRP anti-mouse IgG (1:5,000, 7076, Cell Signaling Technology), IRDye 680RD anti-mouse (1:5,000, 926-68070, Li-Cor), IRDye 800CW anti-rabbit (1:5,000, 926-32211, Li-Cor), StarBright blue 520 goat anti-mouse (1:5,000, 12005866, Bio-Rad) and hFABTM rhodamine anti-tubulin (1:5,000, 12004165, Bio-Rad). Western blots were quantified using Image Lab software (v6.1 build 7).

HiBiT degradation assays

Endogenously tagged HiBiT cells were plated in 96-well plates (PerkinElmer) at a density of 0.5 × 10⁶ cells per ml, with 50 µl of cell suspension per well. The following day, 2× stocks of compounds were added for a final volume of 100 µl. Cells were treated for 5, 6 or 24 h as indicated in the respective figure legends before lysis using the HiBiT lytic assay buffer (Promega) per manufacturer instructions. Plates were then read on a BMG Pherastar plate reader for luminescence detection. Treated wells were normalized to a DMSO-only control and analysed using GraphPad Prism (v9.3.1) via fitting of non-linear regression curves for extraction of DC₅₀ and maximal degradation (D_MAX) values.

Kinetic ubiquitination and degradation assays

For kinetic ubiquitination assays, HiBiT-tagged HEK293 cells were seeded in 6-well plates at a density of 8 × 10⁶ cells per ml in 2 ml volume. After 5 h, LgBiT and Halo-Ub cDNA (Promega) were transfected using FuGENE HD (Promega) with 1 µg of each plasmid at a 3:1 transfection reagent:plasmid ratio. The following day, cells were trypsinized and resuspended in phenol red-free OptiMEM (Gibco) supplemented with 4% FBS and seeded in 96-well plates at a density of 3.5 × 10⁵ cells per ml in the presence or absence of 0.1 mM HaloTag NanoBRET ligand (Promega). Following overnight incubation, media was removed from the wells and replaced with 90 µl OptiMEM (4% FBS) with a 1:100 dilution of Vivazine substrate. The plates were incubated at 37 °C for 1 h before 10× stocks of experimental compounds were added and the plates were analysed on a GloMax Discover microplate reader (software v4.0.0, firmware v4.92; Promega) in kinetic mode for NanoBRET ratio metric (460 nm donor and 618 nm acceptor emissions) signal detection for 6 h, with measurements taken every 3–5 min. Data was processed by subtracting NanoBRET ligand-free controls before plotting NanoBRET signal versus time in GraphPad Prism (v9.3.1).

Kinetic degradation assays were performed as previously described⁵¹, using the HiBiT-tagged cells with exogenous LgBiT transfection as described above for the kinetic ubiquitination assays. Cells were incubated in Endurazine substrate (1:100) for 2.5 h at 37 °C prior to 10× compound addition, with luminescence measurements taken on a GloMAX Discover microplate reader (Promega) every 15 min for 24 h. Data were normalized to DMSO-only controls and plotted for luminescence signal versus time in GraphPad Prism (v9.3.1).

NanoBRET bromodomain confirmational sensor assay

Transient transfection of the dual NanoLuc and Halo-Tagged tagged BRD4^Tandem plasmid (Promega) was performed as described previously⁵¹. In brief, 0.02 µg of plasmid and 2 µg of carrier DNA were combined with FuGENE HD (Promega) at a 3:1 ratio and added per well of a 6-well plate seeded with 70% confluent HEK293 cells. The following day, cells were trypsinized and resuspended in phenol red-free OptiMEM (Gibco) supplemented with 4% FBS and 100 µl were seeded per well in 96-well plates at a density of 2 × 10⁵ cells per ml in the presence or absence of 0.1 mM HaloTag NanoBRET ligand (Promega). The following morning, the media was aspirated and replaced with phenol red-free media containing MG132 (10 µM final concentration) for 1 h, before cells were incubated with test compounds for 3 h. For cell lysis and detection, 100 µl of 2× NanoBRET substrate solution was added per well, the plate was incubated in darkness while shaking at 400 RPM for 3 min, before reading on a BMG Pherastar plate reader equipped with a NanoBRET filter (618/460 nm). Wells lacking Halo ligand were subtracted from wells containing Halo ligand, and the fold increase in signal compared to DMSO was plotted using GraphPad Prism (v9.3.1).

FACS-based CRISPR–Cas9 BRD4 stability screens

For pooled FACS-based CRISPR–Cas9 BRD4 protein stability screens, a CRL-focused sgRNA library⁴⁹ was packaged in lentivirus using polyethylenimine (PEI MAX MW 40,000, Polysciences) transfection of Lenti-X cells and the lentiviral pCMVR8.74 helper (Addgene plasmid #22036, a gift from D. Trono) and pMD2.G envelope (Addgene plasmid #12259, a gift from D. Trono) plasmids. The virus containing supernatant was cleared of cellular debris by filtration through a 0.45-µm polyethersulfone filter and used to transduce KBM7 BRD4–BFP reporter cells harbouring a doxycycline-inducible Cas9 allele (iCas9) at a multiplicity of infection of 0.05 and 1,000-fold library representation. Library-transduced cells were selected with G418 (1 mg ml⁻¹, Gibco) for 14 days, expanded and Cas9 expression was induced with doxycycline (0.4 µg ml⁻¹, PanReac AppliChem).

Three days after Cas9 induction, 25 million cells per condition were treated with DMSO (1:1,000), MZ1 (10 nM), IBG1 (1 nM), GNE-0011 (1 µM), IBG3 (0.1 nM) or IBG4 (100 nM) for 6 h in 2 biological replicates. Cells were washed with PBS, stained with Zombie NIR Fixable Viability Dye (1:1,000, BioLegend) and APC anti-mouse Thy1.1 (also known as CD90.1) antibody (1:400, 202526, BioLegend) in the presence of Human TruStain FcX Fc Receptor Blocking Solution (1:400, 422302, BioLegend), and fixed with 0.5 ml methanol-free paraformaldehyde 4% (Thermo Scientific Pierce) for 30 min at 4 °C, while protected from light. Cells were washed with and stored in FACS buffer (PBS containing 5% FBS and 1 mM EDTA) at 4 °C overnight. The next day, cells were strained trough a 35-µm nylon mesh and sorted on a BD FACSAria Fusion (BD Biosciences) operated on BD FACSDiva software (v8.0.2) using a 70-µm nozzle. Aggregates, dead (Zombie NIR positive), Cas9-negative (GFP) and sgRNA library-negative (THY1.1–APC) cells were excluded, and the remaining cells were sorted based on their BRD4–BFP and mCherry levels into BRD4^high (5–10% of cells), BRD4^mid (25–30%) and BRD4^low (5–10%) fractions. For each sample, cells corresponding to at least 1,500-fold library representation were sorted per replicate.

Next-generation sequencing (NGS) libraries of sorted cell fractions were prepared as previously described⁴⁸. In brief, genomic DNA was isolated by cell lysis (10 mM Tris-HCl, 150 mM NaCl, 10 mM EDTA, 0.1% SDS), proteinase K treatment (New England Biolabs) and DNAse-free RNAse digest (Thermo Fisher Scientific), followed by two rounds of phenol extraction and 2-propanol precipitation. Isolated genomic DNA was subjected to several freeze–thaw cycles before nested PCR amplification of the sgRNA cassette.

Barcoded NGS libraries for each sorted population were generated using a two-step PCR protocol using AmpliTaq Gold polymerase (Invitrogen). The resulting PCR products were purified using Mag-Bind TotalPure NGS beads (Omega Bio-tek) and amplified in a second PCR introducing the standard Illumina adapters. The final Illumina libraries were bead-purified, pooled and sequenced on HiSeq 3500 or NovaSeq 6000 platforms (Illumina).

Screen analysis was performed as previously described⁴⁸. In brief, sequencing reads were trimmed using fastx-toolkit (v0.0.14), aligned using Bowtie2 (v2.4.5) and quantified using featureCounts (v2.0.1). The crispr-process-nf Nextflow workflow is available at https://github.com/ZuberLab/crispr-process-nf/tree/566f6d46bbcc2a3f49f51bbc96b9820f408ec4a3. For statistical analysis, we used the crispr-mageck-nf Nextflow workflow, available at https://github.com/ZuberLab/crispr-mageck-nf/tree/c75a90f670698bfa78bfd8be786d6e5d6d4fc455. To calculate gene-level enrichment, the sorted populations (BRD4^high or BRD4^low) were compared to the BRD4^mid populations in MAGeCK (0.5.9)⁵², using median-normalized read counts.

Viability-based CRISPR–Cas9 screen

The ubiquitin–NEDD8 system CRISPR-knockout library (Supplementary Table 4) was generated using the covalently closed circular-synthesized (3Cs) technology, as previously described^53,54. The library contained 3,347 gRNAs cloned under the U6 promoter in a modified pLentiCRISPRv2-puromycin vector containing a modified gRNA scaffold sequence starting with GTTTG. Each gene was represented by four gRNAs selected with the Broad Institute CRISPick tool^55,56,57. Additionally, the library included a set of essential genes, non-targeting as well as AAVS1-targeting control sgRNAs.

HCT-116 cells were transduced with the ubiquitin–NEDD8 system lentiviral CRISPR–Cas9 library at a multiplicity of infection of 0.5 and a coverage of 500. Cells were selected with 1 μg ml⁻¹ puromycin for 12 days. Eight million selected cells per condition were then plated in T175 flasks. Cells were treated with DMSO or IBG1 (58 nM), corresponding to 4 times the IC₅₀ value for 3 days, followed by replating and treatment for additional 3 days. After a total of 6 days of treatment, cells were trypsinized, washed three times with PBS, followed by genomic DNA isolation. Sequencing libraries were prepared via PCR as previously described⁵⁴ and purified via GeneJET Gel Extraction Kit (Thermo Fisher Scientific).

Raw sequencing data were demultiplexed with bcl2fastq v2.20.0.422 (Illumina) to generate raw fastq files. To determine the abundance of individual gRNAs per samples, the fastq files were trimmed using cutadapt (v2.8) to retain only the putative gRNA sequences. These sequences were then aligned to the original gRNA library with Bowtie2 (v2.3.0) and only perfect matches were counted. Statistical analysis was performed via MAGeCK⁵², using median or total read count normalization and removal of gRNAs with zero counts in the control samples. Genes with a log₂-transformed fold change (LFC) > 1 or < −1 and a P value < 0.01 were labelled as significantly depleted or enriched hits.

Flow-cytometric BRD4 reporter assay

KBM7 iCas9 cells were transduced with lentivirus expressing wild-type, mutated or truncated versions of the SFFV–BRD4(S)–mTagBFP–P2A–mCherry reporter to generate stable reporter cell lines. For evaluation of reporter degradation, cells were treated with DMSO (1:1,000), IBG1 (1 nM), dBET6 (10 nM), IBG3 (0.1 nM) or IBG4 (100 nM) for 6 h before flow cytometry analysis on an LSR Fortessa (BD Biosciences) operated on BD FACSDiva software (v9.0).

To quantify the influence of genetic perturbations on compound-induced reporter degradation, stable BRD4(S) or BRD4^Tandem reporter cell lines were transduced with lentiviral sgRNA (pLenti-U6-sgRNA-IT-EF1αs-THY1.1-P2A-NeoR) and/or transgene expression vectors (pRRL-SFFV-3xFlag-DCAF16-EF1αs-iRFP670) to 30–50% transduction efficiency. Cas9 expression was induced with doxycycline (0.4 µg ml⁻¹) for 3 days, followed by 6 h of degrader treatment. Cells were stained for sgRNA expression with an APC-conjugated anti-mouse Thy1.1 antibody (202526, BioLegend; 1:400) and human TruStain FcX Fc receptor blocking solution (422302, BioLegend; 1:400) for 5 min in FACS buffer (PBS containing 5% FBS and 1 mM EDTA) at 4 °C. Cells were washed and resuspended in FACS buffer and analysed on an LSR Fortessa (BD Biosciences).

Flow-cytometric data analysis was performed in FlowJo v10.8.1. BFP and mCherry mean fluorescence intensity values for were normalized by background subtraction of the respective values from reporter-negative KBM7 cells. BRD4 abundance was calculated as the ratio of background subtracted BFP to mCherry mean fluorescence intensity, and is displayed normalized to DMSO-treated, sgRNA and cDNA double-negative cells.

Quantitative proteomics

For unbiased identification of degrader target proteins, 50 × 10⁶ KBM7 iCas9 cells per condition were treated with DMSO (1:1,000), IBG1 (1 nM) or dBET6 (10 nM) for 6 h in biological triplicates. Cells were collected via centrifugation, washed three times in ice-cold PBS and snap-frozen in liquid nitrogen. Cell pellets were lysed in 500 µl of freshly prepared lysis buffer (50 mM HEPES pH 8.0, 2% SDS, 1 mM PMSF and protease inhibitor cocktail (Sigma-Aldrich)). Samples incubated at room temperature for 20 min before heating to 99 °C for 5 min. DNA was sheared by sonication using a Covaris S2 high-performance ultrasonicator. Cell debris was removed by centrifugation at 16,000g for 15 min at 20 °C. Supernatant was transferred to fresh tubes and protein concentration determined using the BCA protein assay kit (Pierce Biotechnology). Filter-aided sample preparation was performed using a 30 kDa molecular weight cut-off centrifugal filters (Microcon 30, Ultracel YM-30, Merck Millipore) as previously described⁵⁸. In brief, 200 µg of total protein per sample was reduced by the addition of DTT to a final concentration of 83.3 mM, followed by incubation at 99 °C for 5 min. Samples were mixed with 200 μl freshly prepared 8 M urea in 100 mM Tris-HCl (pH 8.5) (UA solution) in the filter unit and centrifuged at 14,000g for 15 min at 20 °C to remove SDS. Residual SDS was washed out by a second wash step with 200 μl UA. Proteins were alkylated with 100 µl of 50 mM iodoacetamide in the dark for 30 min at room temperature. Thereafter, three washes were performed with 100 μl of UA solution, followed by three washes with 100 μl of 50 mM TEAB buffer (Sigma-Aldrich). Proteolytic digestion was performed using trypsin (1:50) overnight at 37 °C. Peptides were recovered using 40 μl of 50 mM TEAB buffer followed by 50 μl of 0.5 M NaCl. Peptides were desalted using Pierce Peptide Desalting Spin Columns (Thermo Scientific). TMTpro 16plex Label Reagent Set was used for labelling according to the manufacturer’s instructions (Pierce). After the labelling reaction was quenched, the samples were pooled, the organic solvent removed in a vacuum concentrator, and the labelled peptides purified by C18 solid phase extraction.

For offline fractionation via reverse phase high-performance liquid chromatography (HPLC) at high pH as previously described⁵⁹, tryptic peptides were re-buffered in 10 mM ammonium formate buffer (pH 10). Peptides were separated into 96 time-based fractions on a Phenomenex C18 reverse phase column (150 × 2.0 mm Gemini-NX, 3 µm C18 110 Å, Phenomenex) using an Agilent 1200 series HPLC system fitted with a binary pump delivering solvent at 50 µl min⁻¹. Acidified fractions were consolidated into 36 fractions via a concatenated strategy as previously described⁵⁹. After removal of solvent in a vacuum concentrator, samples were reconstituted in 0.1% TFA prior to liquid chromatography–mass spectrometry (LC–MS/MS) analysis.

Mass spectrometry analysis was performed on an Orbitrap Fusion Lumos Tribrid mass spectrometer coupled to a Dionex Ultimate 3000 RSLCnano system (via a Nanospray Flex Ion Source) (all Thermo Fisher Scientific) interface and operated via Xcalibur (v4.3.73.11) and Tune (v3.4.3072.18). Peptides were loaded onto a trap column (PepMap 100 C18, 5 μm, 5 × 0.3 mm, Thermo Fisher Scientific) at a flow rate of 10 μl min⁻¹ using 0.1% TFA as loading buffer. After loading, the trap column was switched inline with an Acclaim PepMap nanoHPLC C18 analytical column (2.0 µm particle size, 75 µm internal diameter × 500 mm, 164942, Thermo Fisher Scientific). The column temperature was maintained at 50 °C. Mobile phase A consisted of 0.4% formic acid in water, and mobile phase B consisted of 0.4% formic acid in a mixture of 90% acetonitrile and 10% water. Separation was achieved using a 4-step gradient over 90 min at a flow rate of 230 nl min⁻¹. In the liquid junction setup, electrospray ionization was enabled by applying a voltage of 1.8 kV directly to the liquid being sprayed, and non-coated silica emitter was used. The mass spectrometer was operated in a data dependent acquisition (DDA) mode using a maximum of 20 dependent scans per cycle. Full MS1 scans were acquired in the Orbitrap with a scan range of 400−1,600 m/z and a resolution of 120,000 at 200 m/z. Automatic gain control (AGC) was set to ‘standard’ and a maximum injection time (IT) of 50 ms was applied. MS2 spectra were acquired in the Orbitrap at a resolution of 50,000 at 200 m/z with a fixed first mass of 100 m/z. To achieve maximum proteome coverage, a classical tandem MS approach was chosen instead of the available synchronous precursor selection (SPS)-MS3 approach. To minimize TMT ratio compression effects by interference of contaminating co-eluting isobaric peptide ion species, precursor isolation width in the quadrupole was set to 0.5 Da and an extended fractionation scheme applied. Monoisotopic peak determination was set to ‘peptides’ with inclusion of charge states between 2 and 5. Intensity threshold for MS2 selection was set to 2.5 × 10⁴. Higher energy collision induced dissociation (HCD) was applied with a normalized collision energy (NCE) of 34%. Normalized AGC was set to 200% with a maximum injection time of 86 ms. Dynamic exclusion for selected ions was 90 s.

The acquired raw data files were processed using Proteome Discoverer (v.2.4.1.15), via the TMT16plex quantification method. Sequest HT database search engine and the Percolator validation software node were used to remove false positives with FDR 1% at the peptide and protein level. All MS/MS spectra were searched against the human proteome (Canonical, reviewed, 20 304 sequences) and appended known contaminants and streptavidin, with a maximum of two allowable miscleavage sites. The search was performed with full tryptic digestion with or without deamidation on amino acids asparagine, glutamine, and arginine. Methionine oxidation and protein N-terminal acetylation, as well as methionine loss and protein N-terminal acetylation with methionine loss were set as variable modifications, while carbamidomethylation of cysteine residues and tandem mass tag (TMT) 16-plex labelling of peptide N termini and lysine residues were set as fixed modifications. Data were searched with mass tolerances of ±10 ppm and ±0.025 Da for the precursor and fragment ions, respectively. Results were filtered to include peptide spectrum matches with Sequest HT cross-correlation factor (Xcorr) scores of ≥1 and high peptide confidence assigned by Percolator. MS2 signal-to-noise (S/N) values of TMTpro reporter ions were used to calculate peptide or protein abundance values. Peptide spectrum matches with precursor isolation interference values of ≥70% and average TMTpro reporter ion S/N ≤ 10 were excluded from quantification. Both unique and razor peptides were used for TMT quantification. Correction of isotopic impurities was applied.

Data were normalized to total peptide abundance and scaled ‘to all average’. Abundances were compared to DMSO-treated cells and protein ratios were calculated from the grouped protein abundances using an ANOVA hypothesis test. Adjusted P values were calculated using the Benjamini–Hochberg method. Proteins with less than three unique peptides detected were excluded from downstream analysis.

Protein construction, expression and purification

His₆–TEV–BRD4 bromodomain 1 (BRD4^BD1) (amino acids 44–178) and His₆–TEV–BRD4 bromodomain 2 (BRD4^BD2) (amino acids 333–460) were expressed in Escherichia coli BL21(DE3) and purified as described previously⁶⁰. In brief, proteins were purified by nickel affinity chromatography and SEC. His₆ tag cleavage and reverse nickel affinity was performed prior to SEC for some applications, for others the tag was left on. Purified proteins in 20 mM HEPES, 150 mM sodium chloride, 1 mM DTT, pH 7.5 were aliquoted and flash frozen in liquid nitrogen and stored at −80 °C.

His₆–SUMO–TEV–BRD4^Tandem (residues 1–463) was prepared as previously described⁵¹. In brief, protein was expressed in E. coli BL21(DE3) and purified sequentially by nickel affinity on a HisTrap HP 5 ml column (Cytiva), His₆ tag cleavage by SENP1 followed by reverse nickel affinity, cation exchange on a HiTrap SP HP 5 ml column (Cytiva), and size exclusion on a HiLoad 16/600 Superdex 200 pg column (Cytiva). Purified protein in 20 mM HEPES, 100 mM sodium chloride, 1 mM TCEP, pH 7.5 was aliquoted and flash frozen in liquid nitrogen then stored at −80 °C.

BRD4^Tandem (residues 43–459) was cloned into pRSF-DUET or a modified pGEX4T1 with an N-terminal His₁₀ tag and HRV3C cleavage site or a His₁₂-GST tag and TEV cleavage site, respectively.

His₁₀−3C-BRD4^Tandem (residues 43–459) was transformed into E. coli BL21(DE3) and overnight expression at 18 °C was induced with 0.35 mM IPTG at OD₆₀₀ ~ 0.8–1. Cells were collected by centrifugation and pellets were resuspended in ice-cold PBS then spun down again. Supernatant was removed and pellets were flash frozen in liquid nitrogen and stored at −80 °C. Cells were thawed and resuspended in lysis buffer (50 mM HEPES, 500 mM NaCl, 0.5 mM TCEP, pH 7.5) supplemented with 2 mM magnesium chloride, DNAse and cOmplete EDTA-free Protease Inhibitor Cocktail (Roche, 1 tablet per litre initial culture volume) and lysed at 30,000 psi using a CF1 Cell Disruptor (Constant Systems). The lysate was cleared by centrifugation at 20,000 rpm for 30 min at 4 °C then syringe-filtered using a 0.45-μm filter. The lysate was supplemented with 40 mM imidazole and loaded on to a 5 ml HisTrap HP column (Cytiva) equilibrated in lysis buffer with 40 mM imidazole, washed at 60 mM imidazole and eluted with a gradient up to 100% elution buffer (50 mM HEPES, 500 mM NaCl, 0.5 mM TCEP, 500 mM imidazole, pH 7.5). The prep was split as required for tag cleavage or for purification of the His₁₀–3C-tagged form. For tag cleavage, the sample was buffer exchanged into lysis buffer on a HiPrep 26/10 Desalting column and HRV3C protease was added to cleave the tag overnight at 4 °C. Imidazole was added to 20 mM to the cleaved BRD4^Tandem and the sample was run on a 5 ml HisTrap HP column equilibrated in lysis buffer with 20 mM imidazole and washed with the same imidazole concentration. The flow-through and wash containing BRD4^Tandem were pooled and, along with uncleaved His₁₀–3C–BRD4^Tandem, were concentrated in 10,000 MWCO Amicon centrifugal filter units (Merck Millipore). The proteins were each loaded separately onto a HiLoad 26/600 Superdex 200 pg column (GE LifeSciences) equilibrated in 20 mM HEPES, 150 mM NaCl, 0.5 mM TCEP, pH 7.5. Fractions containing either pure BRD4^Tandem or His₁₀–3C–BRD4^Tandem were confirmed by SDS–PAGE, then pooled, concentrated and aliquoted for storage at −80 °C until use.

For use in cryo-electron microscopy (cryo-EM) with DCAF16 and IBG1, His₁₂–GST–TEV–BRD4^Tandem (residues 43–459) expression in E. coli BL21(DE3) cells was induced at OD₆₀₀ = 2 with 0.5 mM IPTG at 20 °C for 16 h. Cells were collected by centrifugation and resuspended in lysis buffer (50 mM HEPES, 500 mM NaCl, 20 mM imidazole, 0.5 mM TCEP, pH 7.5) (10 ml g⁻¹ pellet weight) supplemented with DNAse and 1 cOmplete EDTA-free Protease Inhibitor Cocktail tablet (Roche) per 2 l of culture. Cells were lysed at 30,000 psi using a CF1 Cell Disruptor (Constant Systems) and lysate was clarified by centrifugation. Lysate was filtered through a BioPrepNylon Matrix Filter (BioDesign) then incubated with 1 ml Ni-NTA resin per litre culture for 1 h. The lysate–resin slurry was poured into a Bio-Rad Econo-column and resin was washed with >10 column volumes lysis buffer. Bound protein was eluted with elution buffer (50 mM HEPES pH 7.5, 150 mM NaCl, 500 mM imidazole, 0.5 mM TCEP) then incubated with 1 ml glutathione agarose resin per litre culture for 30 min. The mixture was poured into an Econo-column and resin was washed with 20 mM HEPES, 150 mM NaCl, 0.5 mM TCEP, pH 7.5. TEV protease was added to the resin slurry for on-bead cleavage and the column was incubated overnight on a roller at 4 °C. Protein was eluted from the column then concentrated and run on a HiLoad 16/600 Superdex 75 pg column equilibrated in 20 mM HEPES, 150 mM NaCl, 0.5 mM TCEP, pH 7.5. Fractions containing protein were pooled, concentrated and aliquoted then flash frozen in liquid nitrogen then stored at −80 °C until use.

A DCAF15 construct lacking the proline-rich region (amino acids 276–380; DCAF15Δpro) with N-terminal His₆-TEV-Avi tag, DDB1(ΔBPB) (residues 396–705 replaced with a GNGNSG linker), and full-length DDA1 coding sequences were cloned into a pFastBacDual vector. Bacmid was generated using the Bac-to-Bac baculovirus expression system (Thermo Fisher Scientific). Baculovirus was generated via an adapted single-step protocol^61,62. In brief, bacmid (1 µg ml⁻¹ culture volume) was mixed with 2 µg PEI 25 K (Polysciences) per µg bacmid in 200 µl warm PBS and incubated at room temperature for 30 min. The mixture was added to a suspension culture of Sf9 cells at 1 × 10⁶ cells per ml in Sf-900 II SFM (Gibco) and incubated at 27 °C with shaking at 110 rpm. Viral supernatant (P0) was collected after 4–6 days. For expression, Spodoptera frugiperda cells (Sf9) were grown to densities between 1.9 to 3.0 × 10⁶ cells per ml in Sf-900 II SFM (Gibco) and infected with a total virus volume of 1% per 1 × 10⁶ cells per ml. Cells were incubated at 27 °C in 2 l Erlenmeyer flasks (~500 ml culture per flask) with shaking at 110 rpm for 48 h. Cells were spun at 1,000g for 10 min and supernatant was discarded. Pellets were resuspended in lysis buffer (50 mM HEPES, 200 mM NaCl, 2 mM TCEP, pH 7.5) with magnesium chloride (to 2 mM), benzonase (to 1 µg ml⁻¹) and cOmplete EDTA-free Protease Inhibitor Cocktail (Roche, 2 tablets per litre initial culture volume). The suspension was frozen and stored at −80 °C, and then thawed. Cell suspensions were sonicated and lysates were centrifuged at 40,000 rpm for 30 min. The supernatant was incubated with 1.5 ml Ni-NTA agarose resin (Qiagen) on a roller at 4 °C for 1.5 h. The lysate–resin slurry was loaded into a glass bench top column. Supernatant was allowed to flow through then the resin was washed with wash buffer (50 mM HEPES, 200 mM NaCl, 2 mM TCEP, 20 mM imidazole, pH 7.5). Bound protein was eluted with elution buffer (50 mM HEPES pH 7.5, 200 mM NaCl, 2 mM TCEP, 500 mM imidazole). TEV protease was added to protein and dialysed with buffer (50 mM HEPES, 200 mM NaCl, 2 mM TCEP, pH 7.5). Cleaved protein was run over 1.5 ml Ni-NTA agarose resin and the flow-through and washes with binding buffer were collected and pooled. Protein was diluted with buffer (25 mM HEPES, 2 mM TCEP, pH 7.5) to adjust the NaCl concentration to 50 mM, then loaded onto a HiTrap Q HP 5 ml column (Cytiva). The column was washed with IEX buffer A and bound protein was eluted with a 0–100% IEX buffer B (25 mM HEPES, 1 M NaCl, 2 mM TCEP, pH 7.5) gradient. Fractions containing protein were pooled and concentrated to ~1–2 ml then run on 16/600 Superdex 200 pg column in GF buffer (25 mM HEPES, 300 mM NaCl, 1 mM TCEP, pH 7.5). Fractions containing the purified protein complex were pooled, concentrated and aliquoted then flash frozen in liquid nitrogen for storage at −80 °C.

The coding sequences for full-length DCAF16 or DCAF11 with TEV-cleavable N-terminal His₆-tags were cloned into a pFastBacDual vector under the control of the polh promoter. Coding sequences for full-length DDB1 or DDB1(ΔBPB) and full-length DDA1 were cloned into a pFastBacDual vector under the control of polh and p10 promoters, respectively. Bacmid was generated using the Bac-to-Bac baculovirus expression system (Thermo Fisher Scientific). Baculovirus was generated as described above and viral supernatant (P0) was collected after 5–7 days. For expression, Trichoplusia ni High Five cells were grown to densities between 1.5 to 2 × 10⁶ cells per ml in Express Five SFM (Gibco) supplemented with 18 mM l-glutamine and infected with a total virus volume of 1% per 1 × 10⁶ cells per ml, consisting of equal volumes of DCAF16/DCAF11 and DDB1 + DDA1 baculoviruses. Cells were incubated at 27 °C in 2 l Erlenmeyer flasks (~600–650 ml culture per flask) with shaking at 110 rpm for 72 h. Cells were spun at 1,000g for 20 min and supernatant was discarded. Pellets were resuspended in 25 ml binding buffer (50 mM HEPES, 500 mM NaCl, 1 mM TCEP, pH 7.5), flash frozen in liquid nitrogen and stored at −80 °C. Pellets were thawed and diluted with binding buffer to ~100 ml l⁻¹ original culture volume. Tween-20 (to 1% (v/v)), magnesium chloride (to 2 mM), benzonase (to 1 µg ml⁻¹) and cOmplete EDTA-free Protease Inhibitor Cocktail (Roche, 2 tablets per litre initial culture volume) were added to the cell suspension and stirred at room temperature for 30 min. Cell suspensions were sonicated, and lysates were centrifuged at 23,000 rpm for 60 min. Supernatants were filtered through 0.45-µm filters and supplemented with 10 mM imidazole then incubated with 2 ml cobalt agarose resin per litre culture on a roller at 4 °C for 1 h. The lysate–resin slurry was loaded into a glass bench top column. Supernatant was allowed to flow through then the resin was washed with wash buffer (50 mM HEPES, 500 mM NaCl, 1 mM TCEP, 15 mM imidazole, pH 7.5). Bound protein was eluted with elution buffer (50 mM HEPES, 500 mM NaCl, 1 mM TCEP, 250 mM imidazole, pH 7.5) and buffer exchanged on a 26/10 HiPrep Desalting column (Cytiva) into Binding Buffer. TEV protease was added to protein and incubated for 2 h at room temperature then 4 °C overnight. Imidazole was added to the cleaved protein to a concentration of 10 mM and the sample was run over cobalt agarose resin. Flow-through and washes with binding buffer supplemented with 10 mM imidazole were collected and pooled. Protein was buffer exchanged into ion exchange (IEX) buffer A (50 mM HEPES, 50 mM NaCl, 1 mM TCEP, pH 7.5) on a 26/10 HiPrep Desalting column then loaded onto a HiTrap Q HP 5 ml column (Cytiva). The column was washed with IEX buffer A and bound protein was eluted with a 0–100% IEX buffer B (50 mM HEPES, 1 M NaCl, 1 mM TCEP, pH 7.5) gradient. Fractions containing protein were pooled and concentrated then run on 16/600 Superdex 200 pg column in equilibrated in 20 mM HEPES, 150 mM NaCl, 1 mM TCEP, pH 7.5. Fractions containing the purified protein complex were pooled and concentrated then aliquoted and flash frozen in liquid nitrogen for storage at −80 °C.

Sulfo-Cy5 NHS ester labelling

For DCAF16 labelling, sulfo-Cy5 NHS ester (Lumiprobe) in DMF was prepared to a final concentration of 800 µM with DCAF16–DDB1(ΔBPB)–DDA1 (100 µM) and sodium bicarbonate (100 mM). For DCAF11 labelling, sulfo-Cy5 NHS ester (Lumiprobe) in DMF was prepared to a final concentration of 1 mg ml⁻¹ with DCAF11–DDB1(ΔBPB)–DDA1 (1 mg ml⁻¹) and sodium bicarbonate (100 mM). The solutions were protected from light and shaken for 1 h at room temperature. The solutions were spun down at 15,000g for 5 min then run on a Superdex 200 10/300 GL column (Cytiva) to remove free dye and aggregated protein. Fractions containing the sulfo-Cy5-labelled protein were pooled and concentrated, the degree of labelling was calculated to be greater than 100% for each batch of labelled protein. Labelled protein was aliquoted then flash frozen in liquid nitrogen and stored at −80 °C.

Fluorescence polarization assay

Stock solutions of reaction components including DCAF15(Δpro)–DDB1(ΔBPB)–DDA1, DCAF16–DDB1(ΔBPB)–DDA1, His₆–BRD4^BD1, His₆–BRD4^BD2, BRD4^Tandem (residues 43–459), and FITC-sulfonamide probe⁷ were prepared in FP assay buffer (25 mM HEPES pH 7.5, 300 mM NaCl, 1.0 mM TCEP). DCAF15(Δpro)–DDB1(ΔBPB)–DDA1, DCAF16–DDB1(ΔBPB)–DDA1, BRD4^BD1, BRD4^BD2 and BRD4^Tandem were titrated 1:3 in FP assay buffer. Components were added to Corning 384-Well solid black polystyrene microplates to a final volume of 15 µl. Final concentration of 20 nM for FITC-sulfonamide probe was used while DCAF15(Δpro)–DDB1(ΔBPB)–DDA1, DCAF16–DDB1(ΔBPB)–DDA1, BRD4^BD1, His₆–BRD4^BD2 and BRD4^Tandem were titrated from 4 µM to 5.5 nM. Background subtraction was performed with 20 nM FITC-sulfonamide probe and no protein constructs. Components were mixed by spinning down plates at 50g for 1 min and the plate was covered and incubated at room temperature for 1 h, before analysis on a PHERAstar FS (BMG LABTECH) with fluorescence excitation and emission wavelengths of 485 and 520 nm, respectively, with a settling time of 0.3 s.

AlphaLISA displacement assay

The alphaLISA assays were performed as described previously⁵¹ using His₆–BRD4^BD1, His₆–BRD4^BD2 or His₁₀–BRD4^Tandem and the biotinylated JQ1 probe. Assay conditions in the present work used were as follows: 100 nM bromodomain protein, 10 nM Bio-JQ1 probe, 25 µg ml⁻¹ acceptor (nickel chelate) and donor (anti-His–europium; both PerkinElmer). All components were diluted to working concentrations in alphaLISA buffer (50 mM HEPES, 100 mM NaCl, 0.1% BSA, 0.02% CHAPS, pH 7.5). Bromodomain protein was co-incubated with test compounds using 384-well AlphaPlates (PerkinElmer) in the absence or presence of DCAF16 (1 µM) for 1 h, before adding the acceptor and donor beads simultaneously in a low light environment and incubating the plate at room temperature for a further 1 h. The plate was then read on a BMG Pherastar equipped with an alphaLISA module. Data were normalized to a DMSO control and expressed as % bound vs log[concentration] of compound and analysed by non-linear regression, with extraction of binding affinity values (IC₅₀) from the curves. Where applicable, K_d values were calculated from a titration of bromodomain protein on the same assay plate alone into the probe, as described previously⁶³.

TR-FRET proximity assay

Stock solutions of reaction components including sulfo-Cy5-labelled DCAF16–DDB1(ΔBPB)–DDA1, sulfo-Cy5-labelled DCAF11–DDB1(ΔBPB)–DDA1, His₆–BRD4^BD1, His₁₀–BRD4^BD2, His₁₀–BRD4^Tandem, experimental compounds and LANCE Eu-W1024 Anti-His₆ donor (PerkinElmer) were prepared in TR-FRET assay buffer (50 mM HEPES pH 7.5, 100 mM NaCl, 1 mM TCEP, 0.05% Tween-20). Two types of TR-FRET assay were performed: titration of compound into protein (complex-formation assay) and titration of sulfo-Cy5-labelled DCAF into BRD4 vs BRD4–compound (complex-stabilization assay). For the former, compounds were titrated 1:4 into 100 nM BRD4 and 100 nM Cy5-DCAF to a PerkinElmer OptiPlate-384 (white) to a final well volume of 16 μl. For the complex-stabilization assay, sulfo-Cy5-labelled DCAF16–DDB1(ΔBPB)–DDA1 or DCAF11–DDB1(ΔBPB)–DDA1 were titrated 1:4 and 1:3 respectively in TR-FRET assay buffer. Components were added to PerkinElmer OptiPlate-384 (white) to a final well volume of 16 μl. Final concentrations of 100 or 200 nM for BRD4 constructs and 0.5 µM or 1 µM for IBG1 respectively were used. LANCE Eu-W1024 anti-His₆ donor and DMSO concentrations were kept constant across the plate for both assay formats at 2 nM and 0.5%, respectively. Background subtraction was performed with using concentration matched samples containing sulfo-Cy5-labelled DCAF complexes but not BRD4. Components were mixed by spinning down plates at 50g for 1 min and plates were covered and incubated at room temperature for 30 min. Plates were read on a PHERAstar FS (BMG LABTECH) with fluorescence excitation and dual emission wavelengths of 337 and 620/665 nm, respectively, with an integration time between 70 and 400 μs. Data were processed in GraphPad Prism (v9.3.1), curve fitting for the IBG1 curve was performed by setting the maximum as DMSO-only 5 µM sulfo-Cy5-labelled DCAF16–DDB1(ΔBPB)–DDA1 datapoint.

Analytical SEC

For DCAF16 experiments, DCAF16–DDB1(ΔBPB)–DDA1, BRD4^Tandem (residues 1–463), BRD4^BD1 (His₆ tag removed), BRD4^BD2 (His₆ tag removed), and IBG1 were incubated alone and in various combinations in buffer (20 mM HEPES, 150 mM NaCl, 1 mM TCEP, 2% DMSO, pH 7) on ice for 50 min. Final concentrations used for Fig. 4a and Extended Data Fig. 4a were 10 µM DCAF16–DDB1(ΔBPB)–DDA1, 5 µM BRD4^Tandem, 25 µM IBG1 in 250 µl reaction volumes. Final concentrations used for Fig. 4b were 5 µM DCAF16–DDB1(ΔBPB)–DDA1, 5 µM BRD4^Tandem, 5 µM BRD4^BD1, 5 µM BRD4^BD2, 12.5 µM IBG1 in 200 µl reaction volumes. Samples were run on a Superdex 200 Increase 10/300 gl column in 20 mM HEPES, 150 mM NaCl, 1 mM TCEP, pH 7.

For DCAF11 experiments, DCAF11–DDB1(ΔBPB)–DDA1, BRD4^Tandem (residues 43–463) and IBG4 were incubated alone and in various combinations in buffer (20 mM HEPES, 150 mM NaCl, 0.5 mM TCEP, 2% DMSO, pH 7.5) at final concentrations of 5 µM, 5 µM and 10 µM, respectively. Samples were run on a Superdex 200 Increase 10/300 gl column in 20 mM HEPES, 150 mM NaCl, 0.5 mM TCEP, pH 7.5.

For BRD4 intramolecular dimerization experiments, BRD4^Tandem (residues 43–463) and compounds were incubated in buffer (20 mM HEPES, 150 mM NaCl, 0.5 mM TCEP, 2% DMSO, pH 7.5) at final concentrations of 5 µM and 10 µM, respectively. Samples were run on a Superdex 200 Increase 10/300 gl column in 20 mM HEPES, 150 mM NaCl, 0.5 mM TCEP, pH 7.5.

Isothermal titration calorimetry

Titration experiments were performed with an ITC200 instrument (Malvern) in 100 mM Bis-tris propane, 50 mM NaCl, 0.5 mM TCEP, pH 7.5 at 298 K. Protein samples were prepared by dialysing in buffer in D-Tube Dialyzer Midi, MWCO 6–8 kDa (Millipore). BRD4^Tandem (residues 43–459) was pre-incubated alone, or with either IBG1 or IBG3 at a 1:1.1 molar ratio for 30 min at room temperature prior to titrations at a DMSO concentration of 2% (v/v). DCAF16–DDB1(ΔBPB)–DDA1 at 2% DMSO (v/v) was titrated into either BRD4^Tandem alone, pre-complexed BRD4^Tandem–IBG1 or pre-complexed BRD4^Tandem–IBG3. The titration consisted of 0.4 μl initial injection (discarded during data analysis) followed by 19 injections of 2 μl at 180 s intervals between injections. Data were fitted using a one-set-of-site binding model to obtain dissociation constant (K_d), binding enthalpy (ΔH) and stoichiometry (N) using MicroCal PEAQ-ITC Analysis Software1.1.0.1262.

Cryo-EM sample and grid preparation

Protein complexes for cryo-EM were prepared by first co-incubating BRD4^Tandem (residues 43–459) with IBG1 in 20 mM HEPES, 50 mM NaCl, 0.5 mM TCEP-HCl, 2% (v/v) DMSO, pH 7.5 for 10 min at room temperature. DCAF16–DDB1(ΔBPB)–DDA1 was added to the mixture to give final concentrations of 14 µM BRD4^Tandem, 14 µM DCAF16–DDB1(ΔBPB)–DDA1 and 35 µM IBG1 in a final reaction volume of 200 µl and incubated on ice for 50 min. The sample was loaded onto a Superdex 200 Increase 10/300 GL column in 20 mM HEPES, 50 mM NaCl, 0.5 mM TCEP-HCl, pH 7.5. Due to incomplete complex formation and to avoid monomeric proteins, only the earliest eluting fraction containing the ternary complex was taken and concentrated to 4.8 µM. Quantifoil R1.2/1.3 Holey Carbon 400 mesh gold grids (Electron Microscopy Sciences) were glow discharged for 60 s with a current of 35 mA under vacuum using a Quorum SC7620. The complex (3.5 µl) was dispensed onto the grid, allowed to disperse for 10 s, blotted for 3.5 s using blot force 3, then plunged into liquid ethane using a Vitrobot Mark IV (Thermo Fisher Scientific) with the chamber at 4 °C and 100% humidity.

Cryo-EM data acquisition

Cryo-EM data were collected on a Glacios transmission electron microscope (Thermo Fisher) operating at 200 keV. Micrographs were acquired using a Falcon4i direct electron detector, operated in electron counting mode. Movies were collected at 190,000× magnification with the calibrated pixel size of 0.74 Å per pixel on the camera. Images were taken over a defocus range of –3.2 µm to −1.7 µm with a total accumulated dose of 12.7 e⁻ Å⁻² using single-particle EPU (Thermo Fisher Scientific, v3.0) automated data software. A total of 2,075 movies were collected in EER format and after cleaning up for large motion and poor contrast transfer function (CTF) a total of 1,896 movies were used for further processing. Cryo-EM data collection, refinement and validation statistics are presented in Extended Data Table 2.

Cryo-EM image processing

Movies were imported into cryosparc⁶⁴ (v4.1.2) and the EER movie data was fractionated into 8 fractions to give a dose of 1.59 e⁻ Å⁻² per fraction. Movies were processed using patch motion correction and CTF correction then manually curated to remove suboptimal movies. Manual picking of 153 particles was performed on 20 micrographs, which were used for blob tuner with minimum and maximum diameters of 70 and 130 Å, respectively. 12,579 particles were picked by blob tuner, extracted with a box size of 324 pix (240 Å) and run through initial 2D classification. Good classes with diverse views were selected and used as templates for template picking on 1,895 movies. Picks were inspected and curated, and 1.35 million particles were extracted with box size 324 pix and used for 2D classification. Particles from the well-resolved, diverse classes were used for ab initio reconstruction with 3 classes. One class contained primarily empty DDB1(ΔBPB) and a second class contained biased views upon testing of the particle set with 2D re-classification, leading to smeared maps. The third class unambiguously contained density corresponding to DDB1(ΔBPB), two bromodomains, and density likely corresponding to DCAF16 between them. Particles belonging to the second and third class were run through heterogenous refinement. The best class yielded a map into which DDB1(ΔBPB) and two bromodomains could be placed with confidence. To improve the resolution, movies were re-imported in cryosparc and fractionated into 18 fractions to give a lower dose of ~0.7 e⁻ Å⁻² per fraction. 50 templates for particle picking were generated using the create templates job with the input map from the previous heterogeneous refinement. The templates were used in the template picker to pick particles from 1,132 curated movies with a minimum CTF fit resolution cut-off of 3.5. Picks were curated with thresholds of NCC score > 0.4, local power >368 and <789, resulting in 564,575 particles that were extracted with a box size of 324 pixels and used for ab initio reconstruction with 4 classes. Resulting classes were subjected to a heterogeneous refinement, with one class clearly containing all components of the complex and the others either junk, DDB1(ΔBPB) alone or biased views. The map and particles (192,014) from the best class were used for homogenous refinement with the dynamic mask threshold set to 0.5. Local refinement with a dynamic map threshold of 0.5 produced a map with a gold-standard Fourier shell correlation (GSFSC) resolution of 3.77 Å at cut-off 0.143. The workflow, GSFSC curve, local resolution estimation, angular distribution plot, and posterior position directional distribution plot are presented in Extended Data Fig. 4.

Cryo-EM model building

DDB1(ΔBPB), BRD4^BD1 and BRD4^BD2 extracted from PDB entries 5FQD²⁷, 3MXF⁶⁵ and 6DUV, respectively, were manually placed into the map in WinCoot⁶⁶ (v0.9.8.1) by rigid body fitting. Despite co-purifying with DCAF16 and DDB1(ΔBPB), we did not see density for DDA1, as was observed in another DDB1-substrate receptor structure from a recent publication⁶⁷. Correct placement of each bromodomain was aided by manual inspection of residues Asn93 and Gly386 in equivalent positions in the ZA loops of BD1 and BD2, respectively. In one bromodomain, this position was facing solvent while in the other it was at a protein–protein interface with density corresponding to DCAF16. Given that mutation of Gly386 to Glu prevents degradation of BRD4 by IBG1 (Fig. 3i), BD2 was placed in the position where Gly386 was adjacent to the DCAF16 density. The BD2 ZA loop is three residues longer than the BD1 ZA loop, further confirming the correct positioning of each domain based on the map around these positions. Both bromodomains were joined onto a single chain designation. Initial restraints for IBG1 were generated using a SMILES string with eLBOW (in Phenix v1.20.1-4487)⁶⁸, then run through the GRADE webserver (Grade2 v1.3.0). IBG1 was fitted into density by overlaying the JQ1 moiety with its known binding mode in either the BRD4^BD1 or BRD4^BD2. Positioning the ligand in BD2 was compatible with electron density, whereas positioning in BD1 caused a clash with DCAF16 due to the rigid linker. DCAF16 was built using a combination of models from ColabFold^69,70 (v1.3), ModelAngelo⁷¹ (v0.2.2) and manual building in Coot (v0.9.8.1). ColabFold correctly predicted the α5 and α6 helices that bind the DDB1 central cavity while ModelAngelo correctly built the 4-helical bundle of α3, 4, 7 and 8, as well as α6 in the DDB1 cavity. Correctly built parts of the models were combined, and the structure was refined with rounds of model building in Coot, fitting with adaptive distance restraints in ISOLDE⁷² (v1.6) and refinement with Phenix (v1.20.1-4487) real-space refinement^73,74. Figures were generated in ChimeraX⁷⁵ (v1.6) and The PyMOL Molecular Graphics System⁷⁶ (v2.5.2, Schrödinger, LLC).

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

[ad_2]

Source link

Tag: Cryoelectron microscopy

Molecular cloning and protein expression and purification

Nucleosome preparation

RNA extension assays

Reconstitution of complexes for cryo-EM and XL-MS analyses

Pre-termination complex

PEC–Integrator–PP2A–SOSS and free Integrator–PP2A–SOSS complexes

Cryo-EM sample preparation

Cryo-EM data collection and processing

Model building and refinement

Integrator RNA degradation assay

Chemical cross-linking coupled with mass spectrometry

Visualization

Reporting summary

Purification of RAD51 proteins

Purification of histones

Nucleosome preparation

Preparation of the RAD51–nucleosome complex

Cryo-EM grid preparation and data collection

Image processing

Model building

Assay for RAD51–nucleosome or DNA binding

Visualization of RAD51 in the absence of nucleosomes and DNA

Saccharomyces cerevisiae strains and DNA damage sensitivity assays

Protein extraction from S. cerevisiae and western blots

Statistical analysis

Use of large language models

Reporting summary

Antibodies and recombinant proteins

Mammalian cell culture and cell line generation

Cytosolic and membrane fractionation

Expression and purification of recombinant proteins

Discharge assays

Preparation of 80S ribosomes and polysomes

Purification of stable 60S ribosomes from HEK293 cells

In vitro UREL–ribosome association assays

Cryo-EM sample preparation

Reconstitution of stable ribosome–E3 complexes

Reconstitution of UFMylated 60S ribosome–UREL complexes

Cryo-EM data collection and image processing

UREL–60S EM grid preparation

UREL–60S cryo-EM data collection

UREL–60S image processing

UREL–60S model building

UFMylated ribosome data collection and image processing

XL-MS sample preparation and analysis

Ribosome UFMylation assays

Polysome profiling using HEK293 cell lysates

Comparison of 60S and 80S UFMylation in vitro

Preparation of membrane-associated 60S ribosomes

In vitro 60S ribosome–SEC61 dissociation assays

LC–MS/MS sample preparation, data acquisition and analysis

Preparation of isopeptide-linked UFC1–UFM1 conjugate

Crystallization and structure determination

UFC1–UFM1 conjugate

UFL1–UFBP1–UFC1 complex

SEC

ITC

Figures

Materials availability

Reporting summary

Chemical synthesis

Plasmids and oligonucleotides

Cell culture

Lentivirus production and transduction

CRISPR–Cas9 DCAF15-knockout cell line generation

CRISPR–Cas9 HiBiT and BromoTag knock-in cell line generation

siRNA-mediated knockdown

Cell viability assay

Degradation assays and western blotting

HiBiT degradation assays

Kinetic ubiquitination and degradation assays

NanoBRET bromodomain confirmational sensor assay

FACS-based CRISPR–Cas9 BRD4 stability screens

Viability-based CRISPR–Cas9 screen

Flow-cytometric BRD4 reporter assay

Quantitative proteomics

Protein construction, expression and purification

Sulfo-Cy5 NHS ester labelling

Fluorescence polarization assay