Dark Mode Light Mode
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.
Join us on a journey where chemistry meets creativity, and the wonders of science unfold. Quench your intellectual thirst with thought-provoking articles that transcend the boundaries of conventional knowledge.

Functional chimeric mRNAs encode proteins in mammalian immunity

Functional chimeric mRNAs encode proteins in mammalian immunity Functional chimeric mRNAs encode proteins in mammalian immunity


Long-read direct RNA-seq

RNA libraries were prepared using the Direct RNA Sequencing kit (SQK-RNA002). Sequencing was performed on the Oxford Nanopore PromethION P24 sequencer using the FLO-PRO002 flow cell. Sequencing was performed using MinKNOW v.22.03.4 and MinKNOW Core v.5.0.0 with a pore scan frequency of 1.5 h, active channel selection set to on and reserved pores set to on. Libraries were run for 72 h. Basecalling was performed using Bream v.7.0.9 and Guppy v.6.0.7. Data processing was performed on an Ubuntu 20.04 system. Sequencing was performed by the BioMicro Center at Massachusetts Institute of Technology.

Computational analysis of long-read direct RNA-seq data

Individual passing FASTQ files from the same sample were merged to generate a single FASTQ file per sample. Except in the case of JAFFAL17 v.2.2 and v.2.3, all mouse data analyses were performed using reference files from GENCODE58 release M28 (GRCm39), and all human data analyses were performed using reference files from GENCODE Release 43 (GRCh38.p13). For JAFFAL, matched reference files were downloaded from the UCSC genome browser59 and prepared using the instructions provided on the JAFFAL wiki (https://github.com/Oshlack/JAFFA/wiki). Genomic alignments for NanoPlot60 v.1.42.0 were performed using Minimap261 v.2.24 with the parameters -ax splice -uf -k14 and aligned reads were processed and analysed using SAMtools62 v.1.15. Gene quantification was performed by aligning FASTQ files to the reference transcriptome with Minimap2 using the parameters -ax splice -uf -k14 and then quantifying these alignments with Salmon63 v.1.10.2 using the command salmon quant –ont -t -lU –numBootstraps 30 -a -o . Salmon data files were imported into R using tximport64 v.1.38.2 with counts scaled using the lengthScaledTPM method. Differential gene expression analysis was performed using DESeq265 v.1.50.2 with cooksCutoff=TRUE using the resulting Salmon quant files. log2(transcripts per million (TPM) + 1) summary gene quantification data were derived directly from Salmon TPM abundance estimates for genes with expression > 0 in at least one sample.

We created a dedicated pipeline for chimeric RNA analysis called TYPHON, which is available at GitHub (https://github.com/erenada/TYPHON) and reimplements the manually computed chimeric RNA analysis performed in this study using Python modules as part of an integrated, modular workflow. TYPHON provides the ability for users to easily install and run the computational tools and commands used for chimeric RNA analysis in this paper. Please see the TYPHON GitHub page for more details and instructions on running TYPHON.

Chimeric RNA identification using LongGF16 v.0.1.2, JAFFAL17 and Genion18 v.1.2.3. Genomic alignments for LongGF were performed with Minimap2 using the parameters -ax splice -uf -k14–secondary=no -G 50k and processed using SAMtools. LongGF was run on name-sorted .bam files using the command LongGF 100 50 100 2 0 1 0 > . JAFFAL was run with MIN_LOW_SPANNING_READS=1 in the make_final_table.R script using the previously generated JAFFAL-specific reference files. As Genion expects reference files to be formatted in the format of Ensembl66 reference files, GENCODE reference files were reformatted to be compatible with Genion using a reference script from 10x Genomics67 (https://support.10xgenomics.com/single-cell-gene-expression/software/release-notes/build), the command sed ‘s/^chrM/MT/;s/^chrX/X/;s/^chrY/Y/;s/^chr//’ and pygtftk68 v.1.6.2 using the command gtftk convert_ensembl -i -o . For running Genion, we patched the tool to be able to output the read IDs for all chimeric RNA detected. This was done by modifying line 1037 of the annotate.cpp file (located in ./genion/src from: “bool full_debug_output = false;” to “bool full_debug_output = true;” and line 1195 from “outfile ≪ fusion_id ≪ “\t” ≪ cand.second.forward.size() ≪ “\t”” to “outfile ≪ fusion_id ≪ “\t” ≪ read_id ≪ “\t” ≪ cand.second.forward.size() ≪ “\t””.). In TYPHON, we enabled full debug output and modified the Genion annotation step to emit one line per supporting read with the Read_ID appended as the final column. Genion was then compiled with this modified annotate.cpp file according to the author’s instructions, and this modified Genion installation was used to run Genion for all chimeric RNA analysis except the analysis of K562 cell data for BCR-ABL1 benchmarking19,69, which was run using the standard Genion installation without any modifications. The selfalign.tsv file required for running Genion was generated by aligning the reference transcriptome fasta file against itself using Minimap2 with the parameters -X -c and the resulting selfalign.paf file was processed to tsv format using pafr v.0.0.2 and tidyverse v.2.0.0. Input .paf files for running each sample through Genion were generated from the same alignment files previously used for running LongGF using the Minimap2 command paftools.js sam2paf > . Genion was run using the parameters –min-support 1 and with a blank genomicSuperDups.txt file, as an updated version of the genomicSuperDups.txt file for GRCm39 was not available at the time of analysis (see the Genion GitHub page (https://github.com/vpc-ccg/genion) for further details). To keep mouse and human data analyses consistent, a blank genomicSuperDups.txt file was also used for running Genion on human long-read direct RNA-seq data.

For compiling results from LongGF, JAFFAL and Genion, all chimeras in the following results files were considered: the log results files from LongGF, the summary results files from JAFFAL, and the result.tsv files from Genion. For BCRABL1 benchmarking with Genion, results.tsv and .fail files were considered. Results from LongGF, JAFFAL and Genion were combined and made distinct by Read ID using tidyverse. Chimeric RNA fasta files were prepared from alignment files using SAMtools and SeqKit70 v.2.4.0. Chimeric RNA reads were filtered using BLAST+ (blast)71 v.2.13.0 by generating blast reference files using the reference transcriptome and makeblastdb with the parameters -in -parse_seqids -blastdb_version 5 -title -dbtype nucl -out command, and then running blastn with the parameters -query -db -outfmt 6 -out on a single fasta file containing chimeric RNA reads. Processing of blast results and generation of exon-repaired chimeric RNA reads was performed using SeqKit, BEDOPS72 v.2.4.41, BEDTools73 v.2.31.0, Clustalo74 v.1.2.4, Clustalw75 v.2.1, Biopython76 v.1.81, Seqtk v.1.4, tidyverse and data.table v.1.15.2. In brief, chimeric RNAs that did not map to at least one isoform of each chimeric RNA parent gene were removed. Mapping to isoforms containing retained introns was disallowed. BLAST mappings were ranked by descending bit.score and the BLAST mapping with the highest bit.score was selected for each chimeric RNA parent gene. Blast mappings for each chimeric RNA were ordered according to BLAST mapping order in the original chimeric RNA read. The genomic coordinates for every exon present in each selected chimeric RNA isoform were imported from the reference GTF file using BEDTools and the breakpoint exons for each chimeric RNA transcript were estimated by calculating cumulative exon length on a per-transcript basis and comparing against the length of each chimeric RNA segment provided by BLAST. This method enabled the calculation of which exons were expected to be present in each repaired chimeric RNA transcript. Selected exon coordinates were then ordered and added to bed files. Corresponding exonic sequences were extracted from the reference genome and fasta files containing the exon-repaired reads for each chimeric RNA were generated.

Conservation analysis between chimeric RNA present in mice and humans was performed by conducting predicted chimeric protein analysis, constructing BLAST and BLASTp references using human chimeric RNA sequences and predicted chimeric protein sequences, and then running BLAST or BLASTp on mouse chimeric RNA transcripts and predicted chimeric protein sequences against the computed human chimeric RNA and chimeric protein databases. Chimeric RNA peptide prediction was performed using orfipy77 v.0.0.4 using the parameters –min 90 –max 1000000000 –procs 1 –strand f –start ATG –stop TAA,TAG,TGA –table 1 –outdir –pep . The BLASTp reference construction command was makeblastdb with the parameters -in -parse_seqids -blastdb_version 5 -title -dbtype prot -out . Nichenetr78 v.2.2.0 was used to convert human to mouse gene symbols using the convert_human_to_mouse_symbols R function, and mouse and human transcript BLAST matches were required to be derived from parent gene orthologues in both species. BLASTp was run using the parameters -query -db -outfmt 6 -out . The resulting BLAST and BLASTp results were ordered by decreasing bit.score (high to low) and alignment length (longer to shorter) and the top hit for each mouse chimeric RNA Read ID was selected. dplyr v.1.1.4, stringr v.1.5.1, data.table and rtracklayer79 v.1.64.0 were used for processing of BLAST data. For applications downstream of exon repair, long-read RNA-seq-derived chimeric RNA chimera IDs were corrected to appear in biological order as determined using BLAST+ and exon repair, with coordinates and other information also reordered appropriately.

Short-read RNA-seq

RNA libraries were prepared using the KAPA mRNA HyperPrep Kit (Roche). Total-RNA samples were quantified using the Agilent 4200 TapeStation instrument, with the corresponding Agilent TapeStation RNA assay. The resulting RNA-integrity number (RIN) scores and concentrations were considered when qualifying samples to proceed. An average RIN score of >9 was recorded for all samples. Samples were normalized to 200 ng of input in 50 μl (4 ng μl−1), and the mRNA was captured using oligo-dT beads as part of the KAPA mRNA HyperPrep workflow. cDNA synthesis, adapter ligation and amplification were conducted subsequently as part of the same workflow. After amplification, residual primers were eluted away using KAPA Pure Beads in a 0.63× SPRI-based cleanup. The resulting purified libraries were run on the Agilent 4200 Tapestation instrument, with the corresponding Agilent High Sensitivity D1000 ScreenTape assay to visualize the libraries and check that the size and concentrations of the libraries matched the expected product. qPCR using the KAPA Library Quantification kit, which uses primers complementary to the sequencing flowcell oligos, was run to confirm the functional concentration. Molarity values obtained from this assay were used to normalize all samples in equimolar ratio for one final pool. The pool was denatured and loaded onto the Illumina NovaSeq6000 instrument, with an S4 300-cycle kit to obtain paired-end 150 bp reads. The pool was loaded at 1.2 pM, with 5% PhiX spiked in as a sequencing control. Basecall files were demultiplexed through the Harvard BPF Genomics Core’s pipeline, and the resulting FASTQ files were used in subsequent analysis.

Computational analysis of short-read RNA-seq data

FASTQ files were trimmed using fastp v.0.23.2 with the default parameters and trimmed FASTQ files were used as input for short-read chimeric RNA detection unless otherwise specified. GENCODE M28 reference files were used unless otherwise specified. Chimeric RNA were detected in short-read RNA-seq data using n = 6 different computational tools, Arriba, FusionCatcher, STAR-Fusion, STAR-SEQR, JAFFA and Pizzly20,21,22,23,24. Arriba v.2.4.0 was run by first running star v.2.7.11b with the parameters –outSAMattributes Standard –outSAMtype BAM Unsorted –outSAMunmapped Within –outFilterMultimapNmax 50 –peOverlapNbasesMin 10 –alignSplicedMateMapLminOverLmate 0.5 –alignSJstitchMismatchNmax 5 -1 5 5 –chimSegmentMin 10 –chimOutType WithinBAM HardClip –chimJunctionOverhangMin 10 –chimScoreDropMax 30 –chimScoreJunctionNonGTAG 0 –chimScoreSeparation 1 –chimSegmentReadGapMax 3 –chimMultimapNmax 50, and then running Arriba with the default settings and a blank blacklist.txt file. Reference files for running Arriba were generated using STAR –runMode genomeGenerate –genomeFastaFiles –sjdbOverhang 150. Results from Arriba were processed to remove ambiguous intergenic chimeric RNA reads. The reference for FusionCatcher v.1.33 was built on 13 March 2025 using Ensembl 113 mouse reference files using fusioncatcher-build -g mus_musculus. FusionCatcher was run on untrimmed FASTQ files using the default settings other than –limitSjdbInsertNsj 3000000 –limitOutSJcollapsed 3000000. STAR-Fusion references were generated by downloading the Mouse_GRCm39_M31_CTAT_lib_Nov092022.source.tar.gz archive from https://data.broadinstitute.org/Trinity/CTAT_RESOURCE_LIB/ and following the ‘Building a Custom Genome Resource Library for Fusion Detection’ instructions from https://github.com/TrinityCTAT/ctat-genome-lib-builder/wiki to build the reference with GENCODE M28 reference files. STAR-Fusion v.1.12.0 was run with the parameters –no_annotation_filter –min_FFPM 0 –min_sum_frags 1.

STAR-SEQR was run using STAR-SEQR v.0.6.7 by first generating reference files using STAR –runMode genomeGenerate –genomeFastaFiles –sjdbOverhang 150 –genomeSAsparseD 1 with GENCODE M28 reference files. Individual FASTQ from different lanes for the same sample were concatenated into single R1 and R2 files and the parameters -m 1 -vv –keep_mito were used. JAFFA v.2.3 was run using the same reference files as used for long-read RNA-seq analysis on sample-level concatenated single R1 and R2 FASTQ files using the parameters run . pizzly v.0.37.3 was run on untrimmed fastq files by first running kallisto80 v.0.48.0. The kallisto reference was generated by modifying the GENCODE M28 transcriptome reference using zcat | tr ‘|’ ‘ ‘ | gzip -1> and building the reference using kallisto index -i . Kallisto was then run using kallisto quant with the –fusion parameter and pizzly was run using pizzly with the parameters -k 31 –align-score 2.

For calculation of junction-level overlap between chimeric RNA from long-read and short-read RNA-seq data, coordinates provided by Arriba, FusionCatcher, STAR-Fusion, STAR-SEQR and JAFFA were used and compared against long-read coordinates derived from exon-repair (that is, breakpoint exon coordinates). For FusionCatcher, coordinates were first translated from Ensembl 113 to GENCODE M28 coordinates by mapping the FusionCatcher-provided gene symbol to the corresponding GENCODE M28 gene symbol using Mouse Genome Informatics (MGI) (https://www.informatics.jax.org/) as an intermediate with the scCustomize81 v.3.2.0 Updated_MGI_Symbols function. Then, using exon breakpoints, the closest (in terms of absolute nucleotide distance) matching exon in the Ensembl reference was calculated against GENCODE coordinates to determine GENCODE M28 coordinates for each chimeric RNA found using FusionCatcher. These inferred GENCODE M28 coordinates were then used for junction-level overlap calculation. For Pizzly, which provides transcriptomic information, a strategy similar to that used for exon-repair was used to infer coordinate breakpoints for junction-level overlap. The transcript breakpoints in the annotated Pizzly chimeric RNA parent transcripts were compared against matched cumulative exon length metrics for GENCODE M28 transcripts and breakpoint exons were inferred based on minimum absolute nucleotide distance. An absolute nucleotide distance of ≤10 nucleotides between the short-read RNA-seq chimeric RNA gene A and gene B breakpoints and the long-read gene A and gene B breakpoints was required for a chimeric RNA to be considered to have the same breakpoint junction. For breakpoint junction calculation, long-read RNA-seq-derived chimeric RNA chimera IDs were corrected to appear in biological order as determined using BLAST+ and exon repair, with coordinates and other information also reordered appropriately. The chimera IDs from chimeric RNA derived from short-read RNA-seq were not reordered, as these chimeric RNA were not processed with BLAST/exon-repair.

FFPM-like metrics for each short-read RNA-seq tool were calculated using the broad strategy of FFPM_metric = (split_reads1 + split_reads2 + discordant_mates)/(total_mapped_reads/1,000,000) on a per tool basis (as non-identical methodologies and outputs are used/provided by each chimeric RNA detection tool). Notably, the detection of FFPM-like metrics for fusion genes, as well as any downstream differential analysis, is difficult and estimative by nature, and was used in this study for the purpose of selecting potentially interesting downstream candidates in tandem with long-read RNA-seq co-identification; metrics derived using this methodology should be considered an estimate and should not be interpreted in the same manner as standard gene expression and differential analysis metrics. For Arriba, the sum of split_reads1 + split_reads2 + discordant_mates was calculated on a chimera ID level with total mapped reads being derived from STAR-generated bam files using samtools view -@ 30 -c -F 1028. For FusionCatcher, Spanning_unique_reads was used in place of (split_reads1 + split_reads2 + discordant_mates) and the number for total mapped reads was derived from the ‘# reads with at least one reported alignment’ in the info.txt files provided by FusionCatcher. Metrics for STAR-Fusion were calculated using JunctionReadCount + SpanningFragCount in place of (split_reads1 + split_reads2 + discordant_mates) using the same total mapped reads counts as used for Arriba. For STAR-SEQR, the total mapped reads counts were extracted from the STAR-SEQR Log.final.out log files as the ‘Uniquely mapped reads number’ number, and metrics were calculated using NREAD_SPANS + NREAD_JXNLEFT + NREAD_JXNRIGHT in place of (split_reads1 + split_reads2 + discordant_mates). For Pizzly, the total mapped reads counts were extracted from the run_info.json files n_processed numbers provided by Pizzly, and metrics were calculated using total_paircount + total_splitcount instead of (split_reads1 + split_reads2 + discordant_mates). Finally, for JAFFA, total mapped reads counts were calculated using the result of (seqkit stats -T -j 4 | tail -n +2 | cut -f4)*2 with the _filtered_reads.fastq.1.gz file for each sample as the input, with spanning.pairs + spanning.reads used in place of (split_reads1 + split_reads2 + discordant_mates). All FFPM-like metric results were filtered to only apply to short-read chimeric RNA with breakpoint junctions overlapping long-read RNA-seq-derived chimeric RNA breakpoint junctions. FFPM calculations were performed by taking individually derived FFPM-like metrics for each tool and calculating log_ffpm <- log2(total_filter + 0.01). Differential testing was performed using limma82. Calculation of relative enrichment between interchromosomal and distal/proximal intrachromosomal chRNA was performed using the summed counts originally derived for ffpm-like metrics. Counts were combined for individual read IDs corresponding to the same chRNA ID or for the same chRNA ID and junction in the case of density plots. Significance testing was performed using the R t.test function with the default settings.

NanoString nCounter analysis

NanoString nCounter analysis was conducted on purified, extracted RNA by the Genetics and Genomics Core at Boston Children’s Hospital in accordance with standard NanoString protocols using a NanoString nCounter Max System. Analysis of NanoString RCC files from BMDMs was performed using the NanoTube83 v.1.6.0 package using nSolver normalization, a background proportion of 0.33 and a background threshold of 2. The normalized count matrix of passing chimeric RNA expression data was converted to log2 format using the formula log2(x + 0.5), where x is defined as the normalized count matrix. For BMDM data, chimeric RNAs that were expressed below the background, defined as a value of −1 in the log2 normalized matrix, in less than 75% of replicates of any one polarization condition were removed from the analysis. Differential expression analysis was performed using the runLimmaAnalysis function. For analysis of Gsdmd-Tmem106a expression in vivo, the nSolver analytical pipeline was followed using standard settings using nSolver version ≤4.0.

Hi-C processing

The Hi-C libraries were processed as previously described with changes in parameters84. Libraries were aligned with the presplit_map.py script in the diffHic package (v.1.38.0)85. Reads were split into 5′ and 3′ segments if they contained the MboI ligation signature (GATCGATC), in cutadapt (v.4.8)86 with the default parameters. Reads were aligned to the mm39 build of the mouse genome with bowtie2 (v.2.5.3)87 in single-end mode. The FixMateInformation command from the Picard suite v.1.117 (https://broadinstitute.github.io/picard/) was applied to synchronize mate information for each read pair. Duplicates were marked with MarkDuplicates from Picard and sorted by name with SAMtools. Each BAM file was processed to identify alignments for each read to a specific MboI restriction fragment with the preparePairs function in diffHic. Duplicate reads and those with mapping quality scores below 10 were discarded. Read pairs were determined to be dangling ends and removed if the pairs of inward-facing reads or outward-facing reads on the same chromosome were separated by less than 1,000 bp for inward-facing and outward-facing reads. Read pairs with fragment sizes above 1,000 bp were removed. Biological replicates were summed with the mergePairs function. HDF files of read pairs were converted to the Juicer format .hic with juicer tools (v.1.22.01)88.

APA

Aggregate peak analysis (APA) was performed using the R package GENOVA89 v.1.0.1. Files were loaded using the load_contacts function with resolution 500 kb and balancing equal TRUE. A total of 1,047 interchromosomal chRNA fusions found in BMDMs and co-detected by LongGF, JAFFAL and Genion were used for APA. Two controls were created for comparisons. For randomized chRNA fusion partners, 10,000 random combinations of the interchromosomal fusion regions were created, intrachromosomal combinations were removed. For random exons, 10,000 exon combinations were created by sampling from all exons in the genome; the inbuilt mm39 annotation from Rsubread90 version ≤2.26.0 was used to define exons and intrachromosomal combinations were removed. APA plots were created using the APA function with size_bin=11 and dis_thres = c(500000, Inf) and all plotted on the same scale. APA was quantified with the quantify function and the fold-change value used for each interaction (the ratio of the foreground and background). Fold-change values in cases in which the background was 0 were removed for all samples. P values were calculated using a paired t-test of the log2(0.5 + fold change) values.

Mice

All mouse experiments were carried out in compliance with Harvard Medical School Animal Care and Use Committee protocols. For most experiments unless otherwise specified in the text, experiments were conducted using male and female, 8–12-week-old C57BL/6J (000664) mice from Jackson Laboratory in an unblinded manner. BALB/cJ (000651) and wild-derived WSB/EiJ (001145) mice were also procured from Jackson Labs. Gsdmd-knockout mice were gifted by I. Chiu.

To generate G-TMYC mice, a ssDNA donor oligonucleotide containing a flexible linker sequence followed by a MYC epitope tag sequence flanked with homology arms was provided to facilitate homology-directed repair insertion of the sequence into the C terminus of the Gsdmd-Tmem106a open reading frame. In brief, a guide RNA (GAGGGACGTTACCTGCTCAC) and ssDNA Ultramer (IDT) donor template (GGCCCATTGGCCAGGGTGGTTCTGGTGGTGGTTCTGGTGGTGGTTCTGGTGAACAAAAACTCATCTCAGAAGAGGATCTGTGAGCAGGTAACGTCCCTCTTCCTGGCCAGCCCTCTACACAGGCATGTAATGTGGTGACGGAGAGGGGCCAGCCTGAGGT) (bold font represents the knock-in cassette; non-bold represents homology arms) were designed targeting the stop codon locus of Gsdmd-Tmem106a in exon 6 of Tmem106a. The sequence of the knock-in mouse was confirmed using Sanger sequencing of the genomic loci. The forward primer (TTTCTGGTGCATCTGAAGACA) and reverse primer (GAGACCAAAGGGCACTCACT) were designed to amplify the mutation site. Knock-in alleles were identified as 496 bp PCR products and wild-type alleles were identified as 430 bp PCR products by gel electrophoresis.

To generate G-TStop mice, a ssDNA donor oligonucleotide containing a point mutation with homology arms was provided to facilitate homology-directed repair insertion of the sequence into exon 6 of Tmem106a. Two guide RNAs (AGTGACACAGCTGACGGCCG; AGATGTTCAGGACATTCTGG) and ssDNA Ultramer (IDT) donor template (TCTTTTTTAAAAAAGGTCTGAAAAAAATTTTAAATTATGCTTTTCCTTGCTGTCAACTCCAGAATGTCCTTAACATCTTCAACAGCAACTTCTATCCCATCACAGTGACACAGCTGACGGCCGAAGTGCTCCACCAGGCCTCT) were designed targeting exon 6 of Tmem106a. The sequence of knock-in mice was confirmed using Sanger sequencing of the genomic loci. The forward primer (ACACCCTCTTTCTGGTGCAT) and reverse primer (TACCTCAGCAGCCCTTCAGT) were designed to amplify the mutation site.

Mouse BMDM generation and polarization

BMDMs were generated from progenitor cells isolated from the femurs and tibias of C57BL/6J (obtained from the Jackson Laboratory), G-TStop or G-TMYC mice and maintained in macrophage-colony stimulating factor (M-CSF) (50 ng ml−1) for 7 days. Medium containing M-CSF was refreshed after 4 days. To induce an inflammatory phenotype, cells were stimulated with LPS (100 ng ml−1) (serotype O55:B5; Enzo, ALX-581-013-L001) and recombinant mouse IFNγ (20 ng ml−1) (PeproTech, 315-05) for 24 h. To induce a tissue reparative phenotype, cells were stimulated with recombinant mouse IL-4 (20 ng ml−1) (PeproTech, 214-14) and mouse recombinant IL-13 (20 ng ml−1) (PeproTech, 210-13) for 24 h.

Human MDM generation and polarization

MDMs were generated from CD14+ cells. For Oxford Nanopore Sequencing, anonymous peripheral blood samples were collected from the Mississippi Valley Regional Blood Center as waste cellular products and CD14+ cells were isolated using the MojoSort Human CD14 Selection Kit (BioLegend, 480026). For PCR and Sanger sequencing, anonymous cryopreserved CD14+ monocytes were purchased from Lonza (2W-400C). All monocytes were stimulated with M-CSF (50 ng ml−1) (BioLegend, 574806) and granulocyte-macrophage-colony stimulating factor (GM-CSF) (50 ng ml−1) (BioLegend, 572904) in RPMI 1640 containing 10% FBS for 7 days. To induce an inflammatory phenotype, cells were stimulated with LPS (100 ng ml−1) (serotype O55:B5; Enzo, ALX-581-013-L001) and recombinant IFNγ (20 ng ml−1) (BioLegend, 570204) for 24 h.

DNA and RNA extraction, Sanger sequencing and PCR

RNA and DNA were extracted from BMDMs using Trizol according to the manufacturer’s protocol. cDNA synthesis for PCR and RT–qPCR was performed using Maxima Reverse Transcriptase (Thermo Fisher Scientific, EP0741). PCR and RT–qPCR for chRNA were performed using a forward primer in gene A and a reverse primer in gene B. The primers used for PCR and Sanger sequencing of chRNAs that were co-identified by all three long-read RNA-seq tools and have a parent gene with an annotated function in immunity are provided in Supplementary Table 9. PCR and RT–qPCR for CD44-FAM168B was performed using a forward primer against CD44 (CCCATCCCAGACGAAGACAG) and a reverse primer against FAM168B (GTACACGGCAGTCTGGTAGG). PCR and RT–qPCR for ITGAX-CD52 was performed using a forward primer against ITGAX (GGGATGCCGCCAAAATTCTC) and a reverse primer against CD52 (GCTGAGACGTGTCACCTCAA). PCR and Sanger sequencing for HDAC8-CITED1 in human cDNA and Hdac8-Cited1 in mouse cDNA were performed using a forward primer in HDAC8 (human: TTATGACTGCCCAGCCACTG; mouse: TTGCGACGGAAATTTGACCG) and a reverse primer in CITED1 (human: TCCCGAGGAACTAGTGGGAG; mouse: TGCCTTGCGATCCTTCACTC). PCR and Sanger sequencing for TBC1D22B-RNF8 in human cDNA and Tbc1d22b-Rnf8 in mouse cDNA were performed using a forward primer in TBC1D22B (human: CGTCAACTTCTCTCCAGCCA; mouse: TGACATTCCGAGGACGAACC) and a reverse primer in RNF8 (human: TCCGACAAATGGGGCATTCT; mouse: CCTTCACGTCTGAGCTTAGGTC). PCR was performed using a ProFlex 3×32-well PCR system from Applied Biosystems. For long-range genomic PCRs, Phusion high fidelity DNA polymerase was used (New England Biolabs, M0530S) and the extension time was increased to amplify products up to 10 kb. Sanger sequencing was performed on a 1% agarose-gel-purified PCR product using a forward primer. Gel purification was conducted using the Monarch Spin DNA Gel Extraction kit (New England Biolabs, T1120L). RT–qPCR was performed using Sybr Green (Thermo Fisher Scientific, S7567) on the QuantStudio 5 Real-Time PCR System and all gene expression was assayed in duplicate.

LPS injection for NanoString peritoneal macrophage isolation

C57BL/6J mice (male, aged 8 weeks) from Jackson Laboratory were treated intraperitoneally with 100 μl PBS or LPS (E. coli strain O111:B4; InvivoGen, tlrl-3pelps) in PBS (5 mg kg−1) for 16 h. Peritoneal lavage was collected in PBS containing 3% FBS and F4/80+ cells were isolated using MACS magnetic bead enrichment with anti-F4/80 MicroBeads (Miltenyi Biotec, 130-110-443) according to the manufacturer’s protocol. F4/80+ cells from three mice within the same treatment group were pooled in Trizol and RNA was extracted for NanoString nCounter analysis.

Intracisternal infection and brain macrophage isolation

C57BL/6J mice (male, aged 8 weeks) from Jackson Laboratory were subjected to intracisternal injection of 5 μl PBS or 1.2 × 103 CFU E. coli (strain C5; ATCC, 700973) in 5 μl PBS. Then, 18 h after treatment, the mice were euthanized and perfused for collection and homogenization of the hindbrain. Isolated cells were resuspended in HBSS and an enrichment for myeloid cells was performed by adding 90% Percoll and centrifuging at 500g for 60 min at 4 °C. CD11b+ cells were isolated using MACS magnetic bead enrichment with anti-CD11b MicroBeads (Miltenyi Biotec, 130-126-725) according to the manufacturer’s protocol. Cells were collected in Trizol and RNA was extracted for NanoString nCounter analysis.

Intranasal infection and pulmonary macrophage isolation

C57BL/6J mice (female, aged 8 weeks) from Jackson Laboratory were infected intranasally with 30 μl PBS or influenza A (strain PR8) for 7 days. In brief, after infection, mice were euthanized and the perfused lung was collected. Lung tissue was digested in 2 mg ml−1 collagenase IV solution in PBS with DNase I (100 μg ml−1) at 37 °C shaking for 30 min. Homogenized and filtered lung tissue was subjected to a 33%/66% Percoll gradient and centrifuged at 3,000 rpm for 30 min at room temperature. Immune cells in the interface were isolated for FACS. Live CD45+F4/80+CD64+ single cells were sorted and stored in Trizol for RNA extraction.

Pladienolide B splice inhibitor treatment

BMDMs were plated 1.5 × 106 cells per well in a 6-well plate and co-treated with 100 ng ml−1 LPS (Serotype O55:B5; Enzo, ALX-581-013-L001) and 100 nM pladienolide B (PlaB) (Santa Cruz Biotechnology, sc-391691) or 0.1% DMSO (Sigma-Aldrich, D2438) for 6 h. Cells were collected in 1 ml of Trizol per well for RNA extraction.

Actinomycin D transcription inhibitor treatment

BMDMs were plated 1.5 × 106 cells per well in a 6-well plate and co-treated with 100 ng ml−1 LPS (Serotype O55:B5; Enzo, ALX-581-013-L001) and 5 μg ml−1 actinomycin D (Gibco, 11805017) or 0.1% DMSO (Sigma-Aldrich, D2438) for 3 h. Cells were collected in 1 ml of Trizol per well for RNA extraction.

siRNA transfection for knockdown

Two siRNA were designed and pooled to target the junction sequence of Gsdmd-Tmem106a (CAGAACCAGAAUGUCCUGAACAU; AGAACCAGAAUGUCCUGAACA). Scrambled target sequences were generated for scrambled control siRNA design (AUAGCGAUACCAACAUAUCGACG; GAUUAACACGAACUAGCGAAC). siRNAs targeting Ctcf (CGAUCAGUUUCUGUCCUGAAAG), Gsdmd (GUGGUCAAGAAUGUGAUCAAGG) and Rnu1a1 (GGAGAUACCAUGAUCACGAAGGUGG) were additionally designed and synthesized by IDT. Negative control siRNA (siCtrl) was purchased from IDT (51-01-14-03). BMDMs were plated at a density of 2 × 105 cells per well in a 24-well-plate for cytokine secretion and LDH assays, and 1 × 106 cells per well in a 6-well-plate for all RT–qPCR and western blot analyses. Once cells adhered (over 12 h after plating), siRNA was transfected in Lipofectamine RNAiMAX (Thermo Fisher Scientific, 13778100) according to the manufacturer’s protocol. Assays examining the effects of siG-T and siGsdmd were performed 48 h after transfection. Assays examining the effects of siCtcf and siRnu1a1 were conducted 24 h after transfection.

Endogenous GSDMD–TMEM106A western blots

BMDMs were generated from homozygous G-TMYC and wild-type littermate control mice. Cells were plated at 8 × 106 and left untreated or stimulated with LPS (100 ng ml−1) (serotype O55:B5; Enzo, ALX-581-013-L001) for 6 or 24 h. After stimulation, whole-cell lysates were collected using NP40 lysis buffer containing 10% PMSF and 1× protease inhibitor and subjected to western blot using anti-MYC antibody (9B11) (Cell Signaling Technology, 2276S) (1:1,000) and anti-mouse HRP-linked secondary antibody (Cell Signaling Technology, 7076S) (1:3,000). Anti-β-Actin antibody (13E5) (Cell Signaling Technology, 4970, 1:1,000) was used as the loading control for whole-cell lysates.

Production and purification of a custom antibody against GSDMD–TMEM106A were performed by Thermo Fisher Scientific. In brief, rabbits were immunized with peptide antigen CGRPGHQQPPPAHRPIGQ, including an initial injection and three booster injections over the course of 56 days. Antibody was affinity purified from serum and titred by indirect ELISA against our target peptide. For detection of endogenous GSDMD–TMEM106A in wild-type and G-TStop mice, BMDMs were left untreated or were treated with LPS (100 ng ml−1) (serotype O55:B5; Enzo, ALX-581-013-L001) for 6 h. Whole-cell lysates were collected using NP40 lysis buffer containing 10% PMSF and 1× protease inhibitor and processed for western blotting using anti-GSDMD–TMEM106A custom antibody (1:500) and anti-rabbit HRP-linked secondary antibody (Cell Signaling Technology, 7074S, 1:3,000). For detection of endogenous GSDMD–TMEM106A in different cellular fractions of wild-type and G-TStop mice, 5 × 106 BMDMs were collected after no stimulation, after 6 hr LPS (10 ng ml−1) treatment alone, or after LPS prime and nigericin treatment (10 μM) for 15 min. Subcellular fractionation was conducted using the Thermo Fisher Scientific Subcellular Protein Fractionation Kit for Cultured Cells (Thermo Fisher Scientific, 78840) according to the manufacturer’s instructions. Western blotting was performed using anti-GSDMD–TMEM106A custom antibody (1:500) and anti-rabbit HRP-linked secondary antibody (Cell Signaling Technology, 7074S, 1:3,000). Anti-α-tubulin antibody (DM1A, Cell Signaling Technology, 3873, 1:1,000) was used as subcellular fractionation control for cytoplasmic protein isolation. Anti-Na,K-ATPase antibody (Cell Signaling Technology, 3010, 1:1,000) was used as subcellular fractionation control for membrane protein isolation.

All western blots were conducted using 4–12% NuPAGE Bis-Tris gels (Thermo Fisher Scientific, NP0321BOX) according to the manufacturer’s protocol for the XCell SureLock Mini-Cell system and transferred using the XCell II Blot Module (Thermo Fisher Scientific, EI9051).

mRNA transfection for overexpression

Codon optimized mRNA expressing the amino acid sequence of interest was designed and synthesized by Moderna. Gsdmd-Tmem106a mRNA was designed to encode the wild-type GSDMD–TMEM106A sequence, while GsdmdTmem106aΔCT mRNA encodes the same truncated sequence expressed by G-TStop mice, whereby a stop codon is placed just three amino acids into the Tmem106a-encoded C terminus. mRNA was transfected into BMDMs using MessengerMax lipofectamine (Thermo Fisher Scientific, LMRNA001) for 24 h before the assay. Single mRNA transfections for measuring IL-1β secretion were performed in 24-well plates in which cells were plated at 2E5 cells-per-well in 500 μl medium and treated with 500 ng mRNA, according to the MessengerMax lipofectamine protocol. Transfections of mRNA encoding GSDMD and GSDMD–TMEM106A or GSDMD–TMEM106AΔCT encoding mRNA together were performed in 96-well plates in which cells were plated at 4 × 104 cells per well in 100 μl medium and treated with 120 ng mRNA. In experiments using different doses of GSDMD–TMEM106A, non-translating control mRNA was used to normalize total mRNA input across samples.

Subcellular fractionation was conducted using a Thermo Fisher Scientific Subcellular Protein Fractionation Kit for Cultured Cells (Thermo Fisher Scientific, 78840) according to the manufacturer’s instructions. Western blotting for HA was performed using anti-HA antibody (C29F4) (Cell Signaling Technology, 3724S, 1:1,000) and anti-rabbit HRP-linked secondary antibody (Cell Signaling Technology, 7074S, 1:3,000). Anti-α-tubulin antibody (DM1A) (Cell Signaling Technology, 3873, 1:1,000) was used as the subcellular fractionation control for cytoplasmic protein isolation. Anti-Na,K-ATPase antibody (Cell Signaling Technology, 3010, 1:1,000) was used as subcellular fractionation control for membrane protein isolation.

BMDMs transfected with mRNA expressing GSDMD–TMEM106A–HA (G–T–HA mRNA) or a non-translating control mRNA were observed for GSDMD–TMEM106A localization under a Nikon Ti inverted microscope using plan apo ×60 oil-immersion objective lens. Wheat germ agglutinin (WGA) with Alexa fluor 488 conjugate (Thermo Fisher Scientific, W11261) was used to stain the plasma membrane before cell fixation, using 2% PFA for 10 min, and cell permeabilization, using a PBS solution containing 2% BSA and 0.1% Triton X-100. Blocking was conducted using 2% BSA for 1 h at room temperature. HA-tagged GSDMD–TMEM106A was marked with an anti-HA antibody (16B12) conjugated to PE (1:500) (BioLegend, 901518) and visualized using a 561 nm laser. Membrane stain was visualized using a 488 nm laser.

Pyroptosis assay, including cytokine measurement, GSDMD and CASP-1 western blotting, LDH and PI uptake

IL-1β, IL-18 and IL-6 were measured in cell-free supernatants. R&D Systems ELISA kits were used according to the manufacturer’s instructions for IL-18 (R&D Systems, DY7625-05) and IL-6 (R&D Systems, DY406-05), and BioLegend kits were used for IL-1β measurements (BioLegend, 432616). IL-1β and IL-18 were measured in the supernatant after 6 h LPS (10 ng ml−1 for siRNA and G-TStop experiments; 100 ng ml−1 for lentivirus and mRNA transfection experiments; serotype O55:B5; Enzo, ALX-581-013-L001) prime alone and after addition of nigericin (10 μM) (InvivoGen, Tlrl-nig-5) for 30 min to activate the NLRP3 inflammasome. IL-6 secretion was measured after a 6 h LPS treatment alone. Absorbance was read using the Synergy HTX plate reader at 450 nm. The samples were diluted appropriately to fall within the standard range of 2,000 to 31.3 pg ml−1 for IL-1β ELISAs and 250 to 7.8 pg ml−1 for IL-6 ELISAs. Gsdmd-knockout iBMDMs were gifted from the laboratory of J. Kagan and were not tested for mycoplasma contamination.

Western blots for GSDMD and CASP-1 were performed on BMDM cell lysates left at steady state, after 6 h LPS (10 ng ml−1) alone, or after LPS prime and nigericin treatment (10 μM) for 15 min. Whole-cell lysates were collected using NP40 lysis buffer containing 10% PMSF and 1× protease inhibitor. Western blots for GSDMD and CASP-1 were performed using anti-GSDMD antibody (E9S1X, Cell Signaling Technology, 39754, 1:1,000) and mixed anti-CASP-1 (E9R2D, Cell Signaling Technology, 83383) and anti-cleaved CASP-1 (E2G2I, Cell Signaling Technology, 89332) antibodies (1:1,000), respectively, and anti-rabbit HRP-linked secondary antibody (Cell Signaling Technology, 7074S, 1:3,000). Anti-β-actin antibody (13E5, Cell Signaling Technology, 4970, 1:1,000) was used as the loading control for whole-cell lysates.

LDH was measured in cell-free supernatants after 6 h LPS prime (10 ng ml−1 for siRNA and G-TStop experiments; 100 ng ml−1 for lentivirus and mRNA transfection experiments; serotype O55:B5; Enzo ALX-581-013-L001) and 2 h nigericin treatment (10 μM; InvivoGen, Tlrl-nig-5). Promega CytoTox 96 Non-Radioactive Cytotoxicity Assay kits were used according to the manufacturer’s instructions (Promega, G1780). Maximum LDH was determined by replacing the medium with fresh medium containing 1% Triton X-100 for 15 min. The absorbance was read using the Synergy HTX plate reader at 490 nm.

For the measurement of PI uptake, cells were plated in black 96-well plates with optically clear bottoms. After mRNA transfection for GSDMD–TMEM106A overexpression, PI uptake was assessed after 6 h LPS prime (100 ng ml−1) and 1 h nigericin treatment (10 μM). Diluted PI solution (1:500, Sigma-Aldrich, P4864-10ML) was added to the cell culture medium 30 min before the timepoint. The plate was centrifuged at 500g for 5 min and population PI staining was assayed using the Synergy HTX plate reader, conducting bottom reading of fluorescence with an excitation wavelength of 530 nm and emission wavelength of 617 nm. Maximum PI was determined after lysis of cells with 1% Triton X-100. For analysis of PI uptake in G–TStop and wild-type BMDMs, diluted PI solution (1:500) was added to the cell culture medium after LPS priming at the time of nigericin treatment (5 μM) and the plate was imaged using an Incucyte Live-Cell Analysis System with 5% CO2 and 37 °C incubation with phase and red channel images taken every 15 min for 5 h. The counts of red fluorescent cells in a well were quantified to determine the total PI uptake. Maximum PI uptake is reported as the percentage of the number of red fluorescent cells at a time over the number of red fluorescent cells in the same well after 5 h of nigericin treatment. For live imaging of PI uptake by G-TStop and wild-type BMDMs, after LPS priming, diluted PI solution (1:500) was added to the cell culture medium at the time of nigericin treatment (5 μM). The plate was imaged using the Nikon Ti inverted microscope with the Physik Instrumente Piezo Z motor using a ×20 objective lens under 5% CO2 and 37 °C incubation; bright-field and 561 nm laser channel images taken every 2.5 min for 2 h.

LNP-encapsulated mRNA treatment

Wild-type littermate mice were randomly assigned to mRNA treatment groups and treated intravenously through tail vein injection with 100 μl of lipid nanoparticle (LNP)-encapsulated mRNA (1 mg kg−1) for 18 h before LPS sepsis or S. Typhimurium infection.

LPS sepsis

For serum cytokine analysis, female mice treated with LNP-encapsulated mRNA were injected intraperitoneally with 100 μl LPS (E. coli strain O111:B4; InvivoGen, tlrl-3pelps) in PBS (3 mg kg−1) and monitored every 3 h for change in body temperature using a thermometer equipped with a rectal probe. Then, at 6 h after LPS injection, mice were bled retro-orbitally for serum cytokine analysis by Eve Technologies using the Mouse Cytokine Proinflammatory Focused 10-Plex Discovery Assay Array (Eve Technologies, MDF10). For assessment of survival, female mice treated with LNP-encapsulated mRNA were injected intraperitoneally with 100 μl LPS (E. coli strain O111:B4; InvivoGen, tlrl-3pelps) in PBS (6 mg kg−1). G-TStop and wild-type littermate control males were injected intraperitoneally with 100 μl LPS (E. coli strain O111:B4; InvivoGen, tlrl-3pelps) in PBS (15 mg kg−1) and the body temperature was recorded every 12 h for 24 h. All mice were regularly monitored for humane end-point survival, defined as having lost greater than 25% of their body temperature, severely hunched posturing and a severe lack of normal ambulation. Sample sizes were selected based on previous experiments.

S. Typhimurium Infection

Salmonella was grown from glycerol stock overnight in Luria broth (LB) with ampicillin (100 μg ml−1) then diluted to obtain an optical density at 600 nm (OD600) of 0.9 (109 CFU ml−1). Mice were injected intraperitoneally with 100 μl stationary-phase S. Typhimurium in PBS (102 for G-TStop experiments) (105 CFU for in vivo LNP experiments). Then, 24 h after infection, tissue was collected and homogenized in 2 ml of PBS. Tissue homogenate supernatants were plated onto LB agar with ampicillin (100 μg ml−1) for CFU calculations. Sample sizes were based on previous experiments.

Co-immunoprecipitation

Wild-type BMDMs (107) were transfected with mRNA encoding GSDMD–TMEM106A–HA, GSDMD–TMEM106AF50G/W51G−HA or a non-translating control. Then, 24 h later, cells were stimulated with LPS (100 ng ml−1) for 4 h, followed by treatment with nigericin (10 μM) and glycine (10 mM) for 30 min. Cells were lysed by adding 1 ml of Pierce IP lysis buffer (Thermo Fisher Scientific, 87787) to the dish for 30 min with gentle rocking at 4 °C. Cleared lysates were added to 25 μl of prewashed Pierce Anti-HA magnetic beads (Thermo Fisher Scientific, 88836) and incubated overnight at 4 °C for immunoprecipitation of HA-tagged protein. After thorough washing, protein was eluted from anti-HA magnetic beads by adding NuPAGE LDS sample buffer and NuPAGE sample reducing agent (Thermo Fisher Scientific, NP0007 and NP0004) and heating at 70 °C for 10 min. Immunoblotting was conducted using an antibody against cleaved GSDMD (Cell Signaling Technology, 10137S, 1:1,000), and against the HA-tag (C29F4) (Cell Signaling Technology, 3724S, 1:1,000) with anti-rabbit HRP-linked secondary antibody (Cell Signaling Technology, 7074S, 1:3,000). Immunoblotting of input control lysates was performed using an anti-GSDMD antibody (E9S1X, Cell Signaling Technology, 39754, 1:1,000), β-actin antibody (13E5, Cell Signaling Technology, 4970, 1:1,000) and an HA-tag antibody (C29F4, Cell Signaling Technology, 3724S, 1:1,000).

Lentiviral transduction

Plasmids and lentiviral packaging were designed and performed by Vector Builder. For immunofluorescence microscopy, BMDMs were plated 2 × 105 cells per well in a black 24-well-plate optically clear bottom pretreated with poly-l-lysine. For inflammasome activation and IL-1β-release assays, BMDMs were plated 2 × 105 cells per well in standard tissue-culture-treated 24-well-plates. For subcellular protein fractionation BMDMs were plated at 1.5 × 106 cells per well in standard tissue-culture-treated 6-well plates. In all experiments cells were transduced at a multiplicity of infection of 10 in medium containing polybrene (8 μg ml−1). Fresh medium was added 3 h after transduction and cells were assayed 72 h later.

BMDMs transduced with lentivirus expressing GSDMD–TMEM106A–HA (Lenti(G-T-HA)) or an empty vector control were observed for GSDMD–TMEM106A localization under a Nikon Ti inverted microscope with the Physik Instrumente Piezo Z motor using a plan apo ×100 oil-immersion objective lens. WGA with Alexa fluor 488 conjugate (Thermo Fisher Scientific, W11261) was used to stain the plasma membrane before cell fixation, using 4% PFA for 10 min, and cell permeabilization, using a PBS solution containing 2% BSA and 0.1% Triton X-100. Blocking was conducted using 2% BSA for 1 h at room temperature. HA-tagged GSDMD–TMEM106A was marked with an anti-HA antibody (16B12) conjugated to PE (1:500, BioLegend, 901518) and visualized using the 561 nm laser. Membrane staining was visualized using a 488 nm laser.

Subcellular fractionation was conducted using the Thermo Fisher Scientific Subcellular Protein Fractionation Kit for Cultured Cells (Thermo Fisher Scientific, 78840) according to the manufacturer’s instructions. Western blotting for HA was performed using anti-HA antibody (C29F4, Cell Signaling Technology, 3724S, 1:1,000) and anti-rabbit HRP-linked secondary antibody (Cell Signaling Technology, 7074S, 1:3,000). Anti-α-tubulin antibody (DM1A, Cell Signaling Technology, 3873, 1:1,000) was used as the subcellular fractionation control for cytoplasmic protein isolation. Anti-Na,K-ATPase antibody (Cell Signaling Technology, 3010, 1:1,000) was used as subcellular fractionation control for membrane protein isolation.

Doxycycline-inducible GSDMD-NT experiments

iBMDMs stably expressing doxycycline-inducible GSDMD-NT40 were gifted from the laboratory of J. Kagan and were not tested for mycoplasma contamination. Cells were plated at 3 × 104 cells per well in a black 96-well plate with optically clear bottoms and maintained in medium containing puromycin and G418. Once cells adhered (over 12 h after plating), mRNA was transfected for GSDMD–TMEM106A, GSDMD–TMEM106AΔCT or a non-translating control for 24 h. To induce GSDMD-NT expression, cells were treated with doxycycline hyclate (Sigma-Aldrich, D9891-1G) in fresh medium (0.25 µg ml−1). Diluted PI solution (1:300, Sigma-Aldrich, P4864-10ML) was added to the cell culture medium at the time of doxycycline treatment and the plate was imaged using the Incucyte Live-Cell Analysis System under 5% CO2 and 37 °C incubation; phase and red channel images were taken every hour for 24 h. The count of red fluorescent cells in a well was quantified to determine PI uptake. Maximum PI uptake is reported as the percentage of the number of red fluorescent cells at a time over the number of red fluorescent cells in the same well after 24 h of doxycycline treatment.

Recombinant protein constructs

Full-length GSDMD was cloned into the pDB.His.SUMO vector using Gibson Assembly Master Mix (New England Biolabs, E2611L). GSDMD–TMEM106A–FLAG (rG–T–FLAG) or rGSDMD–TMEM106AΔCT−FLAG were cloned into the pDB.His.MBP-3C vector, downstream of the N-terminal His6–maltose-binding protein (MBP) tag and human rhinovirus 3C protease site, using the Gibson Assembly Master Mix.

Expression and purification of proteins in bacteria

pDB-His-SUMO-GSDMD, pDB.His.MBP-3C-rG-T-FLAG and pDB.His.MBP-3C-rG-TΔCT-FLAG constructs were transformed into E. coli BL21 (DE3) cells (Agilent Technologies, 230280). Transformants were plated and incubated overnight at 37 °C. Single colonies were inoculated into LB medium containing 50 μg ml−1 kanamycin and cultured at 37 °C. At an OD600 of 0.6, protein expression was induced with 500 μM isopropyl β-d-1-thiogalactopyranoside, and cells were grown for 16 h at 18 °C before collection.

For His-SUMO-GSDMD, cells were pelleted by centrifugation at 4,000g for 30 min and resuspended in buffer A (40 mM HEPES, pH 7.0, 150 mM NaCl) supplemented with 5 mM imidazole. Cells were lysed by sonication, and His–SUMO-tagged GSDMD was captured on Ni-NTA resin and eluted with buffer A containing 300 mM imidazole. The His–SUMO tag was removed by ULP1 protease at 4 °C for 4 h. Cleaved tag was separated using Ni-NTA, and the flow-through containing GSDMD was further purified on the Superdex 200 Increase 10/300 GL size-exclusion column (Cytiva) equilibrated in buffer A. Peak fractions were assessed by SDS–PAGE and snap-frozen for downstream assays.

For pDB-His-MBP-3C-rG-T-FLAG or pDB.His.MBP-3C-rG-TΔCT-FLAG, cells were pelleted by centrifugation at 4,000g for 30 min and resuspended in buffer A. Cells were lysed by sonication (2 s on, 8 s off; 5 min total on time; 40% amplitude) on ice, and clarified by centrifugation at 18,000g for 1 h. The supernatant was incubated with anti-FLAG G1 affinity resin (GenScript, L00432-25) for 2 h at 4 °C with gentle rotation. After extensive washing, proteins were eluted with buffer A containing 150 ng µl−1 3×FLAG peptide (Sigma-Aldrich, F4799-25MG), analysed for purity and snap-frozen for subsequent assays.

Expression and purification of proteins in mammalian cells

pcDNA3.1-GSDMD-Flag constructs were transfected into Expi293 cells that were maintained in 1,000 ml Expi293 expression medium, fed with 6 mM KCl and grown to 2.5 × 106 cells per ml, using polyethylenimine (PEI, Polysciences). At 12 h after transfection, the culture was fed with 10 mM sodium butyrate and 10 ml of a 45% d-(+)-glucose solution. The cells were then grown for an additional 2 days before being collected by centrifugation at 4,000g for 30 min.

The cell pellet was resuspended in buffer A and lysed by sonication (2 s on, 8 s off, for a total on time of 3.5 min at 40% power). The lysates were clarified by ultracentrifugation at 40,000 rpm for 1 h. The supernatant was collected and incubated with Flag G1 affinity resin (GenScript, L00432-25) for 2 h at 4 °C with gentle rotation. After washing, the protein was eluted using buffer A with 150 ng μl−1 3× Flag peptide (Sigma-Aldrich, F4799-25MG). The eluted GSDMD protein was snap-frozen for other assays. To obtain highly palmitoylated GSDMD, ROT (Sigma-Aldrich, R8875-1G) at 10 μM was used to treat Expi293 cells for 4 h before collection.

Liposome leakage assay

Liposomes were prepared as previously described39,91. In brief, cardiolipin (CL), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (PE) and phosphatidylcholine (PC) (Avanti Polar Lipids) were mixed at a mass ratio of 5:8:4. The solvent was evaporated under a gentle stream of N2 gas, and the dried lipid film was resuspended in 200 μl buffer B (20 mM HEPES, pH 7.4, 150 mM NaCl, 50 mM sodium citrate and 15 mM TbCl3). The suspension was extruded 45 times through 100 nm Whatman Nuclepore Track-Etched membranes to obtain homogeneous liposomes. The filtered suspension was purified through a size-exclusion column (Superose 6, 10/300 GL) in buffer C (20 mM HEPES, 150 mM NaCl) to remove TbCl3 outside liposomes. Fractions close to void were pooled to produce a stock of PC/PE/CL liposomes.

Bacteria or mammalian expressed full-length GSDMD was precleaved by CASP-1 for 1 h. His–MBP–3C–G–T–Flag or His–MBP–3C–G–TΔCT−Flag was precleaved by 3C for 30 min. Catalytically active CASP-1 was expressed and purified as previously described91. In brief, the p20 and p10 subunits (without tags) were individually expressed in E. coli BL21 (DE3) as inclusion bodies. The p20–p10 complex was assembled by denaturation and refolding, and further purified by HiTrap SP cation-exchange chromatography (GE Healthcare Life Sciences).

For leakage assays, liposomes were diluted four times in buffer D (20 mM HEPES, 150 mM NaCl and 15 μM dipicolinic acid). Leakage of Tb3+ from liposomes was monitored by the increase in fluorescence after binding to dipicolinic acid in buffer D. Pre-cleaved proteins were added to 384-well plates (Corning, 3820) containing PC/PE/CL liposomes. The fluorescence intensity was recorded at 545 nm (excitation 276 nm) immediately after mixing and monitored for 2 h on a SYNERGY microplate reader (Biotek). The baseline emission before protein addition was defined as F0. After 2 h, 0.1% Triton X-100 was added to achieve complete Tb3+ release, and the mean of the top three fluorescence readings was defined as F100. The percentage of Tb3+ release at each timepoint is defined as follows: Tb3+ release (%) = (F − F0) × 100/(F100 − F0).

Protein–lipid binding assay

Lipid-binding assay for rG–T–Flag was performed using membrane lipid strips (Echelon Biosciences, P-6002) according to the manufacturer’s instructions. In brief, lipid strip membranes were blocked with 3% BSA in PBS containing 0.1% Tween-20 (PBST) for 1 h at room temperature. The strips were then incubated for 1 h with pre-cleaved rG–T–Flag (His–MBP–3C–rG–T–Flag was pre-cleaved with 3C protease for 30 min to remove the His–MBP–3C tag) at 2 μg ml−1 in 3% BSA/PBST. After three washes with PBST (5 min each), bound proteins were detected using anti-Flag M2-HRP antibody (1:1,000). All steps were performed at room temperature.

Protein structure prediction and visualization

Prediction of three-dimensional protein structures was performed using AlphaFold 392 with AlphaFold Server (https://alphafoldserver.com/) using a random seed value of 9999. Protein structure images were created using Mol*93 and the RCSB PDB platform94 (https://www.rcsb.org/).

Schematic design

Schematics for Figs. 1a, 2k and 3a and Extended Data Figs. 3a and 9a were created using BioRender. All other schematics were created using PowerPoint or Inkscape software.

Data analysis

All sequencing data analysis was performed on a Linux GNU Pop!_OS LTS 22.04 64-bit system or Ubuntu 26.04 LTS 64-bit system. Python analysis was performed using Anaconda Distribution version ≤26.1.1 and Python programming language version ≤3.13.9. Analysis in R was performed using R version ≤4.5.2 running in R Studio version ≤2026.05.0 Build 218. Graphs generated in R were produced using the ggplot2 suite95 version ≤4.0.3 and ComplexHeatmap96 v.2.26.1. Microsoft Excel (v.2607, build 16.0.20228.20110) 64-bit and LibreOffice Calc 26.2.4.2 (X86_64) were used for table generation and data organization. Microsoft Windows 11 Pro 24H2 OS and MacOS BigSur v.11.6 were used for additional data analysis. AlphaFold 3 folding was run using AlphaFold Server (https://alphafoldserver.com/welcome). Mol* and the RCSB PDB platform for AlphaFold 3 result visualization were accessed at https://www.rcsb.org/3d-view.

Except where otherwise indicated, statistical significance for experiments with multiple groups and multiple independent variables was determined using two-way ANOVA with Sidak’s multiple-comparison test. One-way ANOVA with Tukey’s multiple-comparison test was used to determine statistical significance for experiments with multiple groups and a single independent variable. Unpaired t-tests were performed to determine significance between two variables. All non-R/Python adjusted P values were calculated using GraphPad Prism v.10.0.2. GraphPad Prism was run on MacOS BigSur v.11.6.

Ethics

All mouse experiments were performed in accordance with protocols approved by the Harvard Medical School Institutional Animal Care and Use Committee.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.



Source link

Keep Up to Date with the Most Important News

By pressing the Subscribe button, you confirm that you have read and are agreeing to our Privacy Policy and Terms of Use
Add a comment Add a comment

Leave a Reply

Your email address will not be published. Required fields are marked *

Previous Post
Connectome analysis of a cerebellum-like circuit for sensory prediction

Connectome analysis of a cerebellum-like circuit for sensory prediction

Next Post
Audio long read: Could mending damaged DNA prolong life?

Audio long read: Could mending damaged DNA prolong life?

Advertisement