[ad_1]
General methods
CRISPRi sgRNAs were cloned into pU6-sgRNA EF1Alpha-puro-T2A-BFP (Addgene, 60955)13 as described in https://weissman.wi.mit.edu/resources/sgRNACloningProtocol.pdf (Supplementary Table 4). Plasmids for transfection expressing pegRNAs, epegRNAs and non-CRISPRi sgRNAs were cloned by Gibson Assembly of gene fragments without adapters from Twist Bioscience and pU6-pegRNA-GG-acceptor plasmid (Addgene, 132777)4 digested using NdeI or BsaAI/BsaI-HFv2 (New England Biolabs, R0111S, R0531S, R3733S) (Supplementary Table 4). Plasmids for transduction expressing pegRNAs and epegRNAs were cloned by Gibson Assembly of gBlock from Integrated DNA Technologies and pU6-sgRNA EF1Alpha-puro-T2A-BFP digested using BstXI and XhoI (New England Biolabs, R0113S and R0146S) (Supplementary Table 4). The FACS and MCS reporter plasmids were cloned by Gibson Assembly with pALD-lentieGFP-A (Aldevron) as the backbone, IRES2 from pLenti-DsRed_IRES_eGFP (Addgene, 92194)41 and the synthetic surface marker from pJT039 (Addgene, 161927)15. The AAVS1 PEmax knock-in plasmid was generated by restriction cloning with a backbone plasmid modified from pAAVS1-Nst-MCS (Addgene, 80487)20, PEmax editor from pCMV-PEmax (Addgene, 174820)5 and IRES2 from pLenti-DsRed_IRES_eGFP. Plasmids of PEmax fused to La or the La N-terminal domain (Supplementary Table 5), including pCMV-PE7 (Addgene, 214812), were generated by restriction cloning using pCMV-PEmax as the backbone (linker A, SGGS×2-XTEN16-SGGS×2; linker B, SGGS×2-bpNLSSV40-SGGS×2; linker C, SGGS). pCMV-PE7-P2A-hMLH1dn was cloned by Gibson Assembly with pCMV-PE7 as the backbone and an insert fragment PCR amplified from pCMV-PEmax-P2A-hMLH1dn (Addgene, 174828)5. pCMV-PE7-mutant (Q20A, Y23A, Y24F and F35A) was cloned by Gibson Assembly with pCMV-PE7 as the backbone and a mutation-containing gene fragment without adapters from Twist Bioscience. The plasmid for in vitro transcription (IVT) of PE7 mRNA, pT7-PE7 for IVT (Addgene, 214813), was cloned by Gibson Assembly with pT7-PEmax for IVT (Addgene, 178113)5 as the backbone and an insert fragment PCR amplified from pCMV-PE7. Lentiviral transfer plasmids expressing PEmax (pWY005/pWY004) or PE7 (pWY008/pWY007) with IRES2-driven eGFP or eGFP-T2A-NeoR as the selectable marker were cloned by Gibson Assembly with pU6-sgRNA EF1Alpha-puro-T2A-BFP as the backbone, UCOE and SFFV promoter from pMH0001 (Addgene, 85969)42, IRES2 from pLenti-DsRed_IRES_eGFP and T2A-NeoR from pAAVS1-Nst-MCS. All DNA amplification for molecular cloning was performed using Platinum SuperFi II PCR master mix (Invitrogen, 12368010). All plasmids were extracted using NucleoSpin Plasmid, Mini kits (Macherey-Nagel, 740588.250), ZymoPURE II Plasmid Midiprep kits (Zymo Research, D4201) or EndoFree Plasmid Maxi kits (Qiagen, 12362). Primers were ordered from Integrated DNA Technologies (Supplementary Table 6).
Flow cytometry and FACS
Flow cytometry data were analysed using BD FACSDiva (8.0.1), Attune Cytometric Software (5.2.0) or FlowCytometryTools (0.5.1; https://github.com/eyurtsev/FlowCytometryTools)43. Data from flow cytometry analysis and FACS can be found in Figs. 1c and 2f, Extended Data Figs. 1d–f,h–j, 2a–c,f, 3a,f,g, 4a and 10b,c, Supplementary Figs. 1–7 and Supplementary Table 7.
In vitro transcription of prime editor mRNA
Prime editor mRNA was in vitro transcribed as previously described44. Plasmids with PEmax or PE7 coding sequence flanked by an inactivated T7 promoter, a 5′ untranslated region (UTR) and a Kozak sequence in the upstream as well as a 3′ UTR in the downstream were purchased from Addgene (pT7-PEmax for IVT) or cloned as described above (pT7-PE7 for IVT). In vitro transcription templates were generated by PCR to correct the T7 promoter and to install a 119-nucleotide poly(A) tail downstream of the 3′ UTR. PCR products were purified by DNA Clean & Concentrator-5 (Zymo Research, D4003) and SPRIselect (Beckman Coulter, B23317) for cell line and T cell experiments, respectively, and stored at −20 °C until further use. mRNA was generated using a HiScribe T7 mRNA kit with CleanCap Reagent AG (New England BioLabs, E2080S) for cell line experiments and a HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs, E2040S) in the presence of RNase inhibitor (New England Biolabs, M0314L) and yeast inorganic pyrophosphatase (New England Biolabs, M2403L) for T cell experiments. All mRNA was produced with UTP fully replaced with N1-methylpseudouridine-5′-triphosphate (TriLink Biotechnologies, N-1081) and co-transcriptional capping by CleanCap Reagent AG (TriLink Biotechnologies, N-7113). Transcribed mRNA was precipitated by 2.5 M lithium chloride (Invitrogen, AM9480), resuspended in nuclease-free water (Invitrogen, AM9939), quantified by a NanoDrop One UV-Vis spectrophotometer (Thermo Scientific), normalized to 1 μg μl−1 and stored at −80 °C. mRNA for T cell experiments was additionally quantified by Agilent 4200 TapeStation. Prime editor mRNA for HSPC experiments was in vitro transcribed as described in the section ‘HSPC isolation, culture and prime editing’.
General mammalian cell culture conditions
Lenti-X 293T was purchased from Takara (632180). K562 (CCL-243), HeLa (CCL-2) and U2OS (HTB-96) were purchased from the American Type Culture Collection. The K562 CRISPRi cell line constitutively expressing dCas9-BFP-KRAB (pHR-SFFV-dCas9-BFP-KRAB, Addgene, 46911)12 was a gift from J. Weissman. Lenti-X 293T, HeLa and U2OS cells were cultured and passaged in Dulbecco’s modified Eagle’s medium (DMEM) (Corning, 10-013-CV), DMEM (Corning, 10-013-CV) and McCoy’s 5A (Modified) medium (Gibco, 16600082) supplemented with 10% (v/v) FBS (Corning, 35-010-CV) and 1× penicillin–streptomycin (Corning, 30-002-CI). For lipofection and nucleofection, 1× penicillin–streptomycin was not supplemented. K562 and K562 CRISPRi cells were cultured and passaged in RPMI 1640 medium (Gibco, 22400089) supplemented with 10% (v/v) FBS (Corning, 35-010-CV) and 1× penicillin–streptomycin–glutamine (Gibco, 10378016). For nucleofection, 1× penicillin–streptomycin–glutamine was replaced by 1× l-glutamine at 292 μg ml−1 final concentration (Corning, 25-005-CI). All cell types were incubated, maintained and cultured at 37 °C with 5% CO2. Cell lines were authenticated by short tandem repeat profiling and tested negative for mycoplasma.
Lentivirus packaging and transduction
To package lentiviruses, Lenti-X 293T cells were seeded at 9 × 105 cells per well in 6-well plates (Greiner Bio-One, 657165) and were transfected at 70% confluency. For transfection, 6 μl TransIT-LT1 (Mirus, MIR 2300) was mixed and incubated with 250 μl Opti-MEM I reduced serum medium (Gibco, 31985070) at room temperature for 15 min, then mixed with 100 ng pALD-Rev-A (Aldevron), 100 ng pALD-GagPol-A (Aldevron), 200 ng pALD-VSV-G-A (Aldevron) and 1,500 ng transfer plasmids at room temperature for another 15 min, and was added dropwise to Lenti-X 293T cells followed by gentle swirling for proper mixing. At 10 h after transfection, ViralBoost reagent (ALSTEM, VB100) was added at 1× final concentration. At 48 h after transfection, the virus-containing supernatant was collected, filtered through a 0.45-µm cellulose acetate filter (VWR, 76479-040) and stored at −80 °C. Lentiviruses for CRISPRi screens were similarly packaged with hCRISPRi-v2 library (Addgene, 83969)14 as transfer plasmids in 145 mm plates (Greiner Bio-One, 639160). For transduction of K562 cells, cells were resuspended in fresh culture medium supplemented with 8 µg ml−1 polybrene (Santa Cruz Biotechnology, sc-134220), mixed with lentivirus-containing supernatant and centrifuged at 1,000g at room temperature for 2 h. For transduction of U2OS and HeLa cells, the cell culture was supplemented with 8 µg ml−1 polybrene and lentivirus-containing supernatant. The percentages of transduced (positive for the fluorescent protein marker) cells were determined by AttueNXT flow cytometry 72 h after transduction. To generate stably transduced cell lines, cells were selected by 3 μg ml−1 puromycin (Goldbio, P-600-100) 48 h after transduction until >95% of live cells were marker positive.
Construction of FACS reporter cell line and FACS-based genome-scale CRISPRi screen
To construct our FACS reporter cell line, K562 CRISPRi cells were transduced with FACS reporter lentiviruses at a 0.17 multiplicity of infection (m.o.i.; 15.3% infection). The transduced (mCherry+) population was isolated using a BD FACSAria Fusion flow cytometer and expanded as the FACS reporter cell line. For the FACS-based genome-scale CRISPRi screen, two replicates were independently performed a day apart. For each replicate, 2.4 × 108 FACS reporter cells were transduced with hCRISPRi-v2 lentiviruses at a 0.29 m.o.i. (25% infection) and were selected by 3 μg ml−1 puromycin 48 h after transduction. Seven days after transduction, 3.2 × 108 fully selected cells were nucleofected using the SE Cell Line 4D-Nucleofector X kit L (Lonza, V4XC-1024) and pulse code FF120, according to the manufacturer’s protocol. Each nucleofection consisted of 1 × 107 cells, 7,500 ng pCMV-SaPE2 (Addgene, 174817)5, 2,500 ng +7 GG-to-CA pegRNA plasmid and 833 ng +50 nicking sgRNA plasmid. Three days after nucleofection, 1.5 × 108 cells were sorted using a BD FACSAria Fusion flow cytometer. Specifically, cells were first gated on mCherry+ and BFP+, of which eGFP+ and eGFP– populations were collected. gDNA was extracted from both populations using a NucleoSpin Blood XL Maxi kit (Macherey-Nagel, 740950.50). The entirety of gDNA from both populations was used for PCR amplification of integrated hCRISPRi-v2 sgRNAs. Each 100 μl PCR reaction was performed with 10 μg of gDNA, 1 μM of forward primer that anneals in the mouse U6 promoter, 1 μM of reverse primer that anneals to the sgRNA constant region, and 50 μl of NEBNext Ultra II Q5 master mix (New England BioLabs, M0544X) with the following cycling conditions: 98 °C for 30 s, 23 cycles of (98 °C for 10 s, 65 °C for 75 s), followed by 65 °C for 5 min. The PCR product was purified using SPRIselect (Beckman Coulter, B23318) with a double size selection (0.65× right side and 1.35× left side), quantified using a Qubit 1× dsDNA High Sensitivity kit (Invitrogen, Q33231) and a high-sensitivity DNA chip (Agilent Technologies, 5067-4626) on an Agilent 2100 Bioanalyzer, and sequenced using a NovaSeq 6000 SP Reagent kit (v.1.5) for 100 cycles (Illumina, 20028401) with 50 cycles for the R1 read with a custom sequencing primer and 8 cycles for the i7 index read.
Construction of the MCS reporter cell line and MCS-based genome-scale CRISPRi screen
To construct our MCS reporter cell line, K562 CRISPRi cells were transduced with MCS reporter lentiviruses at a 0.09 m.o.i. (8.5% infection). The transduced (eGFP+) population was isolated using a BD FACSAria Fusion flow cytometer and expanded as the MCS reporter cell line. MCS-based genome-scale CRISPRi screens with +7 GG-to-CA PE3+50, PE4 and PE5+50 edits were performed in parallel with two replicates each. A total of 2.1 × 108 MCS reporter cells were transduced with hCRISPRi-v2 lentiviruses at a 0.16 m.o.i. (15% infection) for all screen conditions and were selected by 3 μg ml−1 puromycin 48 h after transduction. Seven days after transduction, 1 × 108 fully selected cells were nucleofected for each replicate of each edit using the SE Cell Line 4D-Nucleofector X kit L (Lonza, V4XC-1024) and pulse code FF120, according to the manufacturer’s protocol. Each nucleofection consisted of 1 × 107 cells and varying amounts of plasmids encoding prime editing components. Specifically, for PE2 and PE3, 7,500 ng pCMV-SaPE2, 2,500 ng +7 GG-to-CA pegRNA plasmid, 833 ng +50 nicking sgRNA plasmid (PE3) were used per nucleofection. For PE4 and PE5, 6,000 ng pCMV-SaPE2, 3,000 ng pEF1a-hMLH1dn (Addgene, 174823)5, 2,000 ng +7 GG-to-CA pegRNA plasmid and 667 ng +50 nicking sgRNA plasmid (PE5) were used. Four days after nucleofection, cells from each replicate and condition were magnetically separated into bead-bound and unbound fractions as previously described15. The gDNA extraction, PCR, NGS library quality control and sequencing were performed as described in the section above. We note that the MCS reporter was less efficient in cell separation than the FACS reporter (Extended Data Fig. 1f,g), which is possibly due to the failure to remove dead cells, debris or doublets from the bead-bound or unbound fraction.
Analysis of genome-scale CRISPRi screen
Sequencing reads were aligned to the hCRISPRi-v2 library (five sgRNAs per gene) using custom Python (2.7.18) scripts as previously described14 (scripts available at GitHub (https://github.com/mhorlbeck/ScreenProcessing)45). sgRNA-level phenotypes were calculated as the log2 enrichment of normalized read counts (sgRNA counts normalized to the total count from the sample and relative to the median of non-targeting controls) within populations of marker-positive cells (GFP+ or bead-bound) compared with marker-negative cells (GFP– or bead-unbound) (Supplementary Table 1). Before calculation, a read count minimum of 50 was imposed for each sgRNA within each sample. Gene-level phenotypes were then calculated for each annotated transcription start site by averaging the phenotypes of the strongest 3 sgRNAs by absolute value. Negative control pseudogenes were generated by random sampling, assigning five non-targeting sgRNAs to each pseudogene. sgRNA-level phenotypes were used as input to the CRISPhieRmix (v.0.1.0)16 under default parameters with µ = 2 to formally evaluate the effect each gene has on prime editing efficiency (Supplementary Tables 2 and 3). Screen results were plotted using R (4.2.2) and ggplot2 (3.4.1).
Considerations regarding the design of our prime editing reporter system
The reporter assays used for our genome-scale CRISPRi screens were designed with two primary considerations: scale and phenotype.
Scale
We developed our reporter system to perform cost-effective, high-throughput prime editing screens. Although easy to implement and scale, reporter screens are always limited in their ability to identify genes with subtle phenotypes owing to their reliance on low-resolution readouts—especially compared with screens performed with molecular readouts (for example, Repair-seq5). Our prime editing reporter assays should therefore be considered a scalable means of identifying strong prime editing regulators. Additionally, owing to lower technical variability observed in data from the FACS-based screen, hits from that screen should be considered higher priority candidates than those from our MCS-based screens.
Our FACS-based screen identified 36 hit genes (35 negative regulators and 1 positive regulator, FDR ≤ 0.01). Although this rate of hit identification is lower than typically observed in genome-scale screens designed to interrogate cellular processes, prime editing is a synthetic system, and cellular regulators, although present and important, are therefore not expected to be abundant. Indeed, previously performed Repair-seq screens identified only 10 sgRNAs against 4 genes with >2-fold change in similarly implemented PE3-based editing (out of 476 DNA repair associated genes)5. The paucity of hits over this >2-fold threshold was therefore expected in our screens, but combined with the fact that our screens were designed to identify only strong regulators, correlations between screen replicates were expectedly low. Pearson correlation coefficients for replicate sgRNA-level phenotypes were 0.053 (FACS, PE3), 0.042 (MCS, PE3), 0.058 (MCS, PE4) and 0.054 (MCS, PE5). For replicate gene-level phenotypes, correlation coefficients were 0.125 (FACS, PE3), 0.071 (MCS, PE3), 0.090 (MCS, PE4) and 0.073 (MCS, PE5).
Phenotype
When validating our prime editing reporter constructs, we observed enrichment of outcomes containing only intended edits and enrichment of outcomes with intended edits and accompanying indels among marker-positive cells (that is, GFP+ FACS reporter cells isolated by flow cytometry or MCS reporter cells bound to protein G beads) (Extended Data Fig. 1f,g,i). Accumulation of both types of outcomes within our marker-positive populations reflected a design choice. Specifically, we designed the target site in our reporters such that PE3-induced indels, which typically fall between the primary and complementary strand nicks5, would not frequently disrupt the open reading frame of the reporter genes and therefore would not prevent marker expression induced by a concomitantly installed intended edit (Fig. 1b). Phenotypes from this reporter system therefore represent overall frequencies of editing outcomes with the intended edit, but not the homogeneity of editing outcomes within marker-positive populations.
Tissue culture transfection and transduction protocols and gDNA extraction
For La knockdown in Lenti-X 293T by siRNA reverse transfection, 120 pmole ON-TARGETplus Human SSB siRNA (Horizon, LQ-006877-01-0005) or ON-TARGETplus Non-targeting Control Pool (Horizon, D-001810-10-05) were mixed thoroughly with 500 μl Opti-MEM I reduced serum medium (Gibco, 31985070) and 4 μl Lipofectamine RNAiMAX transfection reagent (Invitrogen, 13778150) in each well of 6-well plates (Greiner Bio-One, 657165), incubated at room temperature for 15 min before 4 × 105 Lenti-X 293T cells in 2.5 ml penicillin–streptomycin-free medium were added. The reverse transfected cells were used for RT–qPCR or downstream prime editing experiments as described in the corresponding Methods sections.
For prime editing in Lenti-X 293T cells by plasmid transfection, 18,000 cells were seeded in 100 μl penicillin–streptomycin-free medium per well in 96-well plates (Nunc, 167008). At 18 h after seeding, a 10 μl mixture of 200 ng pCMV-PE2 (Addgene, 132775)4, 66 ng pegRNA, 22 ng nicking sgRNA, 0.5 μl Lipofectamine 2000 transfection reagent (Invitrogen, 11668027) and Opti-MEM I reduced serum medium (Gibco, 31985070) was incubated at room temperature for 15 min and added to each well. At 72 h after transfection, the culture medium was removed, cells were washed with DPBS (Gibco, 14190144) and gDNA was extracted by adding 40 μl freshly prepared lysis buffer into each well. The lysis buffer consisted of 10 mM Tris pH 8.0 (Gibco, AM9855G), 0.05% SDS (Invitrogen, 15553027), 25 μg ml−1 proteinase K (Invitrogen, AM2546) and nuclease-free water (Invitrogen, AM9939). The gDNA extract was incubated at 37 °C for 90 min and then transferred into PCR strips (USA Scientific, 1402-4700) for 80 °C inactivation of proteinase K for 30 min in a Bio-Rad T100 thermal cycler.
For prime editing in Lenti-X 293T, HeLa and U2OS cells by plasmid nucleofection, 750 ng prime editor plasmid, 250 ng pegRNA plasmid and 83 ng nicking sgRNA plasmid (PE3 and PE5) were nucleofected. For each sample, 2 × 105 LentiX-293T cells, 1 × 105 HeLa cells or 1 × 105 U2OS cells were nucleofected using SF (Lonza, V4XC-2032), SE (Lonza, V4XC-1032) and SE Cell Line 4D-Nucleofector X kit S with program CM-130, CN-114 and DN-100, respectively, according to the manufacturer’s protocols. PE4 and PE5 experiments in U2OS cells were performed with pCMV-PEmax-P2A-hMLH1dn and pCMV-PE7-P2A-hMLH1dn editor plasmids. After nucleofection, cells were cultured in 24-well plates (Greiner Bio-One, 662165), and the culture medium was removed 72 h after nucleofection. Cells were washed with DPBS (Gibco, 14190144) and gDNA was extracted by adding 110 μl freshly prepared lysis buffer (described above) into each well. The gDNA extract was incubated at 37 °C for 90 min and transferred into PCR strips (USA Scientific, 1402-4700) for 80 °C inactivation of proteinase K for 40 min in a Bio-Rad T100 thermal cycler.
For nucleofections in K562 cells (except those for CRISPRi screens, AAVS1 knock-in, La knockout, small RNA sequencing and RNA sequencing), 1 × 106 cells were nucleofected with specified amounts of plasmids or synthetic guide RNAs using the SE Cell Line 4D-Nucleofector X kit S (Lonza, V4XC-1032) and program FF-120, according to the manufacturer’s protocol. For testing FACS-reporter and MCS-reporter and validation of La phenotype in reporter cell lines, 900 ng pCMV-SaPE2, 300 ng pegRNA plasmid, 100 ng nicking sgRNA plasmid (PE3 and PE5) and 450 ng pEF1a-hMLH1dn (PE4 and PE5) were nucleofected. For validation of La phenotype in K562 PEmax parental and La knockout clones, 500 ng pegRNA plasmid was nucleofected. For rescue experiments, 500 ng pegRNA plasmid and 1,000 ng plasmid encoding La, La mutants or mRFP control were nucleofected. For SaCas9 cutting in MCS reporter cells, 800 ng pX600 (Addgene, 61592)21 and 400 ng +7 GG-to-CA pegRNA plasmid were nucleofected. For SaPE2 editing using the PE4 approach in K562 PEmax parental and La-ko4 cells, 800 ng pCMV-SaPE2, 400 ng pegRNA plasmid and 400 ng pEF1a-hMLH1dn were nucleofected. For SaCas9, SaBE4 and SaABE8e editing in K562 PEmax parental and La-ko4 cells, 400 ng pegRNA or sgRNA plasmid and 800 ng pX600, SaBE4-Gam (Addgene, 100809)23 or SaABE8e (Addgene, 138500)24 were nucleofected. Synthetic pegRNAs and a nicking sgRNA with specified sequences and chemical modifications were ordered as Custom Alt-R gRNA from Integrated DNA Technologies (Supplementary Table 8). According to an incremental titration of a DNMT1 +5 G-to-T no-polyU synthetic pegRNA in K562 PEmax parental cells, intended editing efficiencies were already saturated at 100 pmole input (Extended Data Fig. 5b). Therefore, 100 pmole synthetic pegRNA and 50 pmole nicking sgRNA (PE3) were used for nucleofection unless otherwise specified. At 72 h after nucleofection, 1 × 106–2 × 106 cells were collected in 1.5 ml tubes (Eppendorf, 0030123611), washed with 1 ml DPBS (Gibco, 14190144) and resuspended in 100 μl freshly prepared lysis buffer described above. The gDNA extract was incubated at 37 °C for 120 min and transferred into PCR strips (USA Scientific, 1402-4700) for 80 °C inactivation of proteinase K for 40 min in a Bio-Rad T100 thermal cycler.
For prime editing in K562 and U2OS cells using editor mRNA and synthetic pegRNA, 1 × 106 K562 and 1 × 105 U2OS cells were nucleofected with 1 µg editor mRNA and 50 pmole synthetic pegRNA using the SE Cell Line 4D-Nucleofector X kit S (Lonza, V4XC-1032) with program FF-120 and DN-100, respectively, according to the manufacturer’s protocols. After nucleofection, cells were cultured for 72 h and collected for gDNA extract.
For prime editing in HeLa and U2OS cells by lentiviral delivery of pegRNAs or epegRNAs and nucleofection of editor plasmids or mRNA, cells were transduced with lentiviruses expressing pegRNAs or epegRNAs (20–40% infection) and were fully selected by 3 μg ml−1 puromycin. 1 × 105 stably transduced HeLa and U2OS cells were nucleofected with 750 ng editor plasmid or 1 µg editor mRNA using the SE Cell Line 4D-Nucleofector X kit S (Lonza, V4XC-1032) with program CN-114 and DN-100, respectively, according to the manufacturer’s protocols. After nucleofection, cells were cultured for 72 h and collected for gDNA extract.
For prime editing in K562 cells by lentiviral delivery of prime editors and pegRNAs or epegRNAs, K562 cells were transduced with lentiviruses expressing PEmax or PE7 (with IRES2-driven eGFP or eGFP-T2A-NeoR as the selectable marker). The transduced populations (eGFP+, 20–30%) were isolated using a BD FACSAria Fusion flow cytometer 9 days after transduction, further transduced with lentiviruses expressing pegRNAs or epegRNAs (approximately 50% infection), fully selected by 3 μg ml−1 puromycin and collected 11 days after the second transduction for gDNA extract.
Amplicon sequencing
gDNA sequences containing target sites were amplified through two rounds of PCR reactions (PCR1 and PCR2). In PCR1, genomic regions of interest were amplified with primers containing forward and reverse adapters for Illumina sequencing. Each 20 μl PCR1 reaction consisted of 1–2 μl gDNA extract, 0.5 µM of each forward and reverse primer, 10 μl Phusion U Green Multiplex PCR master mix (Thermo Scientific, F564L) and nuclease-free water (Invitrogen, AM9939) and was performed with the following cycling conditions: 98 °C for 2 min, 28 cycles of (98 °C for 10 s, 61 °C for 20 s, and 72 °C for 30 s), followed by 72 °C for 2 min. Successful PCR1 amplification was confirmed by 1% agarose (Goldbio, A-201-100) gel electrophoresis before proceeding to PCR2 to uniquely index each sample. Each 14 µl PCR2 reaction consisted of 1 µl unpurified PCR1 product, 0.5 µM of each forward and reverse Illumina barcoding primer, 7 μl Phusion U Green Multiplex PCR master mix (Thermo Scientific, F564L) and nuclease-free water (Invitrogen, AM9939) and was performed with the following cycling conditions: 98 °C for 2 min, 9 cycles of (98 °C for 10 s, 61 °C for 20 s, and 72 °C for 30 s), followed by 72 °C for 2 min. Successful PCR2 amplification was confirmed by 1% agarose gel electrophoresis before reactions were pooled by common amplicons. A total of 30 µl pooled PCR2 reactions of each common amplicon was purified by 1% agarose gel electrophoresis with a manual size selection of 200–600 bp according to a 100 bp DNA ladder (Goldbio, D001-500), extracted using the Zymoclean Gel DNA Recovery kit (Zymo Research, D4001) and eluted in 30 µl buffer EB (Qiagen, 19086). The gel-purified PCR2 products were quantified using a Qubit 1× dsDNA High Sensitivity kit (Invitrogen, Q33231) and a high-sensitivity DNA chip (Agilent Technologies, 5067-4626) on an Agilent 2100 Bioanalyzer and sequenced using the MiSeq Reagent Micro kit v2 300 cycles (Illumina, MS-103-1002) or Nano kit v2 300 cycles (Illumina, MS-103-1001) with 300 cycles for the R1 read, 8 cycles for the i7 index read and 8 cycles for the i5 index read. Sequencing reads were demultiplexed through HTSEQ (Princeton University High Throughput Sequencing Database, https://htseq.princeton.edu/) and sequencing adapters were trimmed using Cutadapt (4.1)46.
To quantify prime editing outcomes, amplicon sequencing reads were aligned to the corresponding reference sequence (Supplementary Table 9) with CRISPResso2 (2.2.11)47 in HDR batch mode using the intended editing outcome as the expected allele (“-e”) with the parameters “-q 30”, “–discard_indel_reads”, and with the quantification window centred at the pegRNA nick (“-wc −3”). The quantification window sizes (“-w”) are specified in Supplementary Table 74,5,18. The frequency of intended editing without indels was calculated as follows: (number of non-discarded HDR-aligned reads)/(number of reads that aligned all amplicons). The frequency of intended editing with indels was calculated as follows: (number of discarded HDR-aligned reads)/(number of reads that aligned all amplicons). The frequency of total intended editing (with or without indels) was calculated as (number of HDR-aligned reads)/(number of reads that aligned all amplicons). The frequency of total indels was calculated as follows: (number of discarded reads)/(number of reads that aligned all amplicons). The frequency of indels without intended editing was calculated as (number of discarded reference-aligned reads)/(number of reads that aligned all amplicons). Throughout, we refer to ‘intended edit’ efficiencies as the frequencies of intended editing without indels and ‘indel’ efficiencies as the frequencies of total indels (with and without the intended edit) in this study unless otherwise specified. In Figs. 2b,c, 3b,d, 4c,f and 5a,c,d,f,h and Extended Data Figs. 3b,h, 5c–e, 9a,b, 10a and 11a,d,f,g, the indel frequency is included for each sample adjacent to the corresponding intended editing efficiency.
To quantify off-target prime editing, two to four of the most common Cas9 off-target sites experimentally determined32 for each on-target locus were amplified from gDNA extracts of U2OS cells nucleofected with plasmids encoding PEmax or PE7 and pegRNAs targeting HEK3, HEK4, FANCF and EMX1 loci in Fig. 4c. Off-target editing was quantified as previously described with minor modifications4,5,18. Specifically, reads were aligned to corresponding off-target reference sequences using CRISPResso2 (2.2.11) in standard batch mode with parameters “-q 30”, “-w 10” and “–discard_indel_reads”. Each off-target amplicon sequence was compared with the 3′ DNA flap sequence encoded by the pegRNA extension starting from the nucleotide 3′ of Cas9 nick to the downstream until reaching the first nucleotide on the off-target amplicon that is different from the 3′ DNA flap. Any reads with this nucleotide converted to that on the 3′ DNA flap were considered off-target reads and the number of such reads can be found in the output file ‘Nucleotide_frequency_summary_around_sgRNA’. Off-target editing efficiencies were calculated as (number of off-target reads + number of indel-containing reads)/(number of reads that aligned all amplicons).
To quantify Cas9 cutting outcomes, CRISPResso2 (2.2.11) was run in standard batch mode with the parameters “-q 30” and “–discard_indel_reads”. The intended editing efficiency referred to the frequency of indels that was calculated as follows: (number of discarded reference-aligned reads)/(number of reads that aligned all amplicons). Base editing outcomes were quantified using CRISPResso2 (2.2.11) as previously described23,24.
RT–qPCR
To quantify knockdown efficiencies of La-targeting CRISPRi sgRNAs in MCS reporter cells or La siRNA in Lenti-X 293T cells, total RNA was extracted using a Quick-RNA Miniprep kit (Zymo Research, R1054) with DNase I treatment and 1 µg total RNA was converted to cDNA with SuperScript IV First-Strand Synthesis system (Invitrogen, 18091050) according to the manufacturer’s protocol. Each 20 µl RT–qPCR reaction consisted of 2 µl cDNA, 0.3 µM of each forward and reverse primer, 10 μl SYBR Green PCR master mix (Applied Biosystems, 4309155) and nuclease-free water (Invitrogen, AM9939) and was performed in triplicate on a ViiA 7 Real-Time PCR system (Applied Biosystems) with the following cycling conditions: 50 °C for 2 min, 95 °C for 10 min, and 40 cycles of (95 °C for 15 s, 60 °C for 1 min). Relative La expression levels were calculated using the \({2}^{-\Delta \Delta {C}_{{\rm{T}}}}\) method48 with ACTB (a housekeeping gene) as the internal control in comparison to a non-targeting sgRNA or a non-targeting control siRNA pool.
Generation of K562 clones with PEmax knock-in at AAVS1
A total of 91.5 pmole Alt-R S.p. Cas9 Nuclease V3 (Integrated DNA Technologies, 1081058) and 150 pmole custom Alt-R gRNA targeting AAVS120 (Integrated DNA Technologies) (Supplementary Table 8) were complexed for 20 min at room temperature and were nucleofected together with 2,000 ng AAVS1 PEmax knock-in plasmid as the HDR template into 7.5 × 105 K562 cells using the SE Cell Line 4D-Nucleofector X kit (Lonza, V4XC-1032) and program FF-120, according to the manufacturer’s protocol. Four days after nucleofection, cells were selected using 400 μg ml−1 geneticin (Gibco, 10131027) for 2 weeks before sorted using a BD FACSAria Fusion flow cytometer into 96-well plates at 1 cell per well with 150 μl conditioned culture medium. Single cells were grown and expanded for 2–3 weeks into clonal lines, from which the one with the highest and most homogenous eGFP expression by AttueNXT flow cytometry analysis was selected as the K562 PEmax parental cell line.
Generation of La knockout K562 PEmax cells
A total of 122 pmole Alt-R S.p. Cas9 Nuclease V3 (Integrated DNA Technologies, 1081058) and 200 pmole Alt-R CRISPR-Cas9 sgRNA targeting La (Integrated DNA Technologies, Hs.Cas9.SSB.1.AA) (Supplementary Table 8) were complexed for 20 min at room temperature and were nucleofected into 5 × 105 K562 PEmax parental cells using the SE Cell Line 4D-Nucleofector X kit (Lonza, V4XC-1032) and program FF-120, according to the manufacturer’s protocol. Five days after nucleofection, cells were sorted using a BD FACSAria Fusion flow cytometer into 96-well plates at 1 cell per well with 150 μl conditioned culture medium. Single cells were grown and expanded for 2–3 weeks into clonal lines. Clones with high eGFP+ cell% according to AttueNXT flow cytometry analysis were selected for further characterization by targeted sequencing at the genomic La (SSB) locus and CRISPResso2 (2.2.11) analysis. For each experiment involving K562 PEmax parental cells and derived La knockout cells, eGFP+ cell percentage of each cell line was quantified by flow cytometry before transfection (Supplementary Table 7).
Western blotting
Cells were washed with DPBS (Gibco, 14190144), lysed in 2× western lysis buffer, boiled for 5 min at 95 °C and stored at −80 °C before use. For SDS–PAGE, samples were reheated at 95 °C for 5 min, thoroughly mixed, loaded to a 10% gel and run for 1.5 h at 150 V. Precision Plus Protein Dual Color standards (Bio-Rad, 161-0374) was loaded as the marker. The proteins were transferred into a nitrocellulose membrane (VWR, 10120-060) using a Trans-Blot SD semi-dry transfer cell (Bio-Rad). Antibodies were diluted in 5% Blotto (5% nonfat dry milk in TBST) and incubated with the membrane for 1 h at room temperature. The same membrane was sequentially immunoblotted with the following primary antibodies: anti-La mouse monoclonal antibody (1:5,000; Abcam, ab75927), anti-GAPDH rabbit monoclonal antibody (1:5,000; Abcam, ab181602) and Guide-it Cas9 rabbit polyclonal antibody (1:1,000; Takara, 632607). The following secondary antibodies were used: HRP-conjugated sheep anti-mouse polyclonal antibody (1:2,000; VWR, 95017-332) and HRP-conjugated donkey anti-rabbit polyclonal antibody (1:2,000; VWR, 95017-556). After incubating with secondary antibodies, the membrane was washed with TBST and immersed into Lumi-LightPLUS western blotting substrate (Sigma, 12015196001) for 3 min in the dark before exposure. The blotting results were developed with films (SpCas9 not imaged with this technique) and/or taken with Azure Biosystems 600. The Restore Western Blot Stripping buffer (Thermo Scientific, 21059) was applied to strip the membrane before reprobing. Cropped portions of western blot analyses are presented in Fig. 2a and Extended Data Fig. 3d. Uncropped images and imaging details are provided in Supplementary Fig. 8.
Cell growth assay
To quantify the effect of La knockout on cell growth, K562 PEmax parental, La-ko4, and La-ko5 cells were monitored using AttueNXT flow cytometry with three individual replicates per cell line and each replicate in a 100 mm cell culture dish (Greiner Bio-One, 664160). On each day, live cell density (average of three repeat measurements) of each replicate and each cell line was quantified by flow cytometry, diluted to approximately 5 × 105 cells per ml and quantified again immediately and 24 h after dilution. The cell doubling was calculated as the ratio of live cell density measured 24 h after dilution to that measured immediately after dilution in log2 scale.
Small RNA sequencing
Small RNA sequencing with targeting pegRNAs and epegRNAs was performed in triplicate and for each replicate, 5 × 106 K562 PEmax parental or La-ko4 cells were nucleofected with 2,500 ng either one of the two pegRNA and epegRNA plasmid sets (set 1 and set 2) using the SE Cell Line 4D-Nucleofector X kit L (Lonza, V4XC-1024) and pulse code FF120, according to the manufacturer’s protocol. Set 1 consisted of plasmids encoding FANCF +5 G-to-T pegRNA, HEK3 +1 T-to-A pegRNA, DNMT1 +5 G-to-T pegRNA, RUNX1 +5 G-to-T epegRNA (evopreQ1), VEGFA +5 G-to-T pegRNA and EMX1 +5 G-to-T epegRNA (mpknot). Set 2 consisted of plasmids encoding RNF2 +1 C-to-A pegRNA, HEK3 +1 T-to-A epegRNA (mpknot), DNMT1 +5 G-to-T epegRNA (evopreQ1), RUNX1 +5 G-to-T pegRNA, VEGFA +5 G-to-T pegRNA and EMX1 +5 G-to-T pegRNA. The VEGFA +5 G-to-T pegRNA plasmid was shared by both sets and served as the internal control for potential cross-set normalization. The FANCF +5 G-to-T pegRNA plasmid and the RNF2 +1 C-to-A pegRNA were specific to set 1 and 2, respectively. For HEK3, DNMT1, RUNX1 and EMX1 genomic loci, one set had the pegRNA plasmid whereas the other set had the epegRNA plasmid encoding the same prime edit. Each set only had one evopreQ1 epegRNA plasmid and one mpknot epegRNA plasmid. The sets were formulated so that each pegRNA or epegRNA transcript from cells nucleofected with one set could be aligned uniquely to the corresponding pegRNA or epegRNA in that set, based on the observation in preliminary experiments that few fragments were solely mapped to the sgRNA scaffold shared by different pegRNAs and epegRNAs.
Small RNA sequencing with non-targeting mus DNMT1 (mDNMT1) +6 G-to-C pegRNA or epegRNA (tevopreQ1) was performed in quadruplicate, and for each replicate, 5 × 106 K562 PEmax parental or La-ko4 cells were nucleofected with 5,000 ng pegRNA or epegRNA plasmid using the SE Cell Line 4D-Nucleofector X kit L (Lonza, V4XC-1024) and pulse code FF120, according to the manufacturer’s protocol.
In both experiments, half of the cells from each nucleofection were collected 24 and 48 h after nucleofection, and total RNA was extracted using the mirVana miRNA Isolation kit with phenol (Invitrogen, AM1560) and was quantified using a NanoDrop One UV-Vis spectrophotometer (Thermo Scientific). For each sample, a small RNA library was constructed with 1 μg total RNA as the input using NEBNext Multiplex Small RNA Library Prep Set for Illumina (set 1) (New England Biolabs, E7300S) and NEBNext Multiplex Oligos for Illumina Index Primers Set 3 (New England Biolabs, E7710S) and Set 4 (New England Biolabs, E7730S) according to the manufacturer’s protocol. Equivolume libraries of all samples were pooled, purified using SPRIselect (Beckman Coulter, B23318) with a double size selection (0.5× right side and 1.35× left side), quantified using a Qubit 1× dsDNA High Sensitivity kit (Invitrogen, Q33231) and a high-sensitivity DNA chip (Agilent Technologies, 5067-4626) on an Agilent 2100 Bioanalyzer, and sequenced using a NovaSeq 6000 SP Reagent kit v.1.5 100 cycles (Illumina, 20028401) with 40 cycles for the R1 read, 8 cycles for the i7 index read and 90 cycles for the R2 read.
To validate La phenotype with non-targeting mDNMT1 +6 G-to-C pegRNA or epegRNA, K562 PEmax parental and La-ko4 cells were transduced with lentiviruses harbouring a target site adapted from mDNMT1. Overall, 1 × 106 each transduced cells were nucleofected with 500 or 1,000 ng pegRNA or epegRNA plasmid using the SE Cell Line 4D-Nucleofector X kit S (Lonza, V4XC-1032) and program FF-120, according to the manufacturer’s protocol. One quarter of the number of cells from each nucleofection were collected 1, 2, 3 and 4 days after nucleofection, and the editing outcomes were quantified by amplicon sequencing and CRISPResso2 (2.2.11) analysis.
Small RNA sequencing data analysis
Sequencing reads were demultiplexed through HTSEQ (Princeton University High Throughput Sequencing Database (https://htseq.princeton.edu/)). The reads were trimmed, aligned and processed using a Snakemake (7.32.4) workflow49 and R (4.3.2) (scripts available at Zenodo (https://doi.org/10.5281/zenodo.10553303)50 or at GitHub (https://github.com/Princeton-LSI-ResearchComputing/PE-small-RNA-seq-analysis)51).
Adapters were trimmed using Cutadapt (4.1) -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A GATCGTCGGACTGTAGAACTCTGAACGTGTAGATCTCGGTGGTCGCCGTATCATT. The trimmed reads were then aligned to the appropriate reference sequences (pegRNAs or epegRNAs) using Bowtie2 (2.5.0)52 with default alignment options. Reads that did not align to the appropriate reference (or references) were then aligned to the human genome (GRCh38 primary assembly from Ensembl release 10753) using Bowtie2 (2.5.0) with default alignment parameters. Downstream analysis of the alignments used only reads mapped in proper pair, ensuring both ends of the sequenced fragment were properly mapped. Each of such read defines an RNA fragment originating from an RNA molecule for which the sequence was determined by the alignment.
Quantifications of human small RNA, including assigning fragments to human transcripts, genes and biotypes (GENCODE gene annotation release 43)54, as well as counting, were performed on properly paired alignments using a custom Python (3.11) script available in the Zenodo or GitHub repository (links provided above). To distinguish between overlapping annotations, each aligned fragment was assigned to the annotation that most closely matched the start and end point of the fragment. The pegRNAs and epegRNAs were quantified for each sample by assigning each properly aligned fragment into one of three bins defined in Supplementary Discussion (cis-active, trans-active and inactive) using Rsamtools (2.16.0)55 and plyranges (1.20.0)56. Differential expression was calculated using DESeq2 (1.38.3)33 with a design consisting of two covariates: pegRNA and epegRNA plasmid set nucleofected (set 1 or 2) and cell line (K562 PEmax parental or La-ko4). Default parameters were used to estimate library size factors, gene-wise dispersion and fitting of the negative binomial GLM to determine log2 fold change values. The log fold change shrinkage was performed using the apeglm algorithm (1.22.1)57. The default two-sided Wald test was used to determine the P values and the Bonferroni Holm method was used for multiple test correction. Coverage plots were generated using ggplot2 (3.4.4) on data organized using the readr (2.1.4), dplyr (1.1.3), tidyr (1.3.0) and stringr (1.5.0) packages58.
For initial quality control of the small RNA sequencing data with targeting pegRNAs and epegRNAs, the following three metrics were calculated: (1) the minimum percentage of pegRNA or epegRNA mapping paired-end reads properly aligned and defined as ‘fragments’ for any sample (98.9%); (2) the minimum percentage of pegRNA or epegRNA fragments uniquely mapped to any one of the 11 pegRNAs and epegRNAs for any sample (94.7%); (3) the minimum percentage of uniquely mapped pegRNA or epegRNA fragments that map to the sense strand of pegRNA or epegRNA for any sample (96.9%). The last metric confirms sequencing of RNA rather than any potential DNA contaminant.
RNA sequencing and data analysis
Each condition of RNA sequencing was performed in quadruplicate, and for each replicate, 1 × 106 K562 cells were nucleofected with 750 ng PEmax, PE7 or PE7 mutant plasmid and 250 ng pegRNA plasmid encoding HEK3 +1 T-to-A or PRNP +6 G-to-T using the SE Cell Line 4D-Nucleofector X kit S (Lonza, V4XC-1032) with program FF-120, according to the manufacturer’s protocols. Nucleofected cells were cultured in 6-well plates with 2.5 ml medium per well. At 24, 48 and 72 h after nucleofection, 150 µl cell culture from each replicate and condition was analysed by AttueNXT flow cytometry to quantify cell viability and live cell density. At 72 h after nucleofection, 1 ml cell culture from each replicate and condition was collected for gDNA extract to quantify prime editing outcomes at the HEK3 or PRNP locus. The remaining 1 ml cell culture was pelleted and washed with DPBS (Gibco, 14190144) for total RNA extraction using a RNeasy Plus Mini kit (Qiagen, 74134) with on column DNase I treatment. Total RNA was quantified using a NanoDrop One UV-Vis spectrophotometer (Thermo Scientific) and RNA 6000 Pico chips (Agilent Technologies, 5067-1513) on an Agilent 2100 Bioanalyzer. 3′ mRNA SMART-seq libraries were prepared using total RNA as input on an Apollo NGS library prep system (Takara) following the manufacturer’s protocol. Sequencing libraries were pooled, quantified using a Qubit 1× dsDNA High Sensitivity kit (Invitrogen, Q33231) and a high-sensitivity DNA chip (Agilent Technologies, 5067-4626) on an Agilent 2100 Bioanalyzer and sequenced using a NovaSeq 6000 SP Reagent kit v.1.5 100 cycles (Illumina, 20028401) with 112 cycles for the R1 read and 10 cycles for the index read.
Sequencing reads were demultiplexed through HTSEQ (Princeton University High Throughput Sequencing Database (https://htseq.princeton.edu/)). Alignment, quantification and differential expression were performed using a Snakemake (7.32.3) workflow and R (4.3.1) (scripts available at Zenodo (https://doi.org/10.5281/zenodo.10553340)59 or GitHub (https://github.com/Princeton-LSI-ResearchComputing/PE-mRNA-seq-diffexp)60). The reads were aligned to the GRCh38 genome from Ensembl release 10053 using STAR (2.7)61 with default alignment parameters. Quantification was performed by STAR during alignment. Differential expression between editors was performed separately for each pegRNA. The standard DESeq2 (1.38) procedure was performed to determine the differential expression between each editor within the set of samples for each pegRNA. Fold changes for lowly expressed genes were shrunken using the adaptive shrinkage estimator from the ashr package (2.2_54)62. Figures were generated using R (4.3.1) packages ggplot2 (3.4.3) and ggpubr (0.6.0)58. Differential expression analysis results are available in Supplementary Table 10.
T cell isolation, culture and prime editing
Human peripheral blood Leukopaks enriched for peripheral blood mononuclear cells were sourced from StemCell (StemCell Technologies, 200-0092) with approved StemCell institutional review board (IRB). No preference was given with regard to sex, ethnicity or race. Use of de-identified cells is considered exempt human subjects research and is approved by the UCSF IRB. T cells were isolated using the EasySep Human T cell isolation kit (StemCell Technologies, 100-0695) according to manufacturer’s instructions. Immediately after isolation, T cells were used directly for in vitro experiments. All T cells were cultured in complete X-VIVO 15 consisting of X-VIVO 15 (Lonza Bioscience, 04-418Q) supplemented with 5% FBS (R&D systems), 4 mM N-acetyl-cysteine (RPI, A10040) and 55 μM 2-mercaptoethanol (Gibco, 21985023). Pan CD3+ T cells were activated with anti-CD3/anti-CD28 Dynabeads (Gibco, 40203D) at a 1:1 bead-to-cell ratio in the presence of 500 IU ml−1 IL-2. Two days after stimulation, T cells were magnetically de-beaded and taken up in P3 buffer with supplement (Lonza Bioscience, V4SP-3096) at 37.5 × 106 cells per ml. Next, 1.5 μg PEmax or PE7 mRNA mixed with 50 pmole synthetic pegRNA (Integrated DNA Technologies; Supplementary Table 8) was added per 20 µl cells, not exceeding 25 µl total volume per reaction. Cells were subsequently electroporated using a Lonza 4D Nucleofector with program DS-137. Immediately after electroporation, 80 µl warm complete X-VIVO15 was added to each electroporation well, and cells were incubated for 30 min in a 5% CO2 incubator at 37 °C followed by distribution of each electroporation reaction into 3 wells of a 96-well round-bottom plate. Each well was brought to 200 µl complete X-VIVO 15 and 200 IU ml–1 IL-2. Cells were subcultured and expanded through the addition of fresh medium and IL-2 every 2–3 days. Four days after electroporation, approximately 5 × 105 cells were spun down at 500g for 5 min, and gDNA was extracted using a DNeasy Blood & Tissue kit (Qiagen, 69506) per the manufacturer’s instructions with an elution volume of 100 µl. To assess editing efficiency, PCR was performed with 25 µl of eluted gDNA per sample in a 100 µl PCR reaction with KAPA HiFi HotStart ReadyMix (Roche, 09420398001) with the following cycling conditions: 95 °C for 3 min, 28 cycles of (98 °C for 20 s, 63 °C for 15 s, and 72 °C for 60 s), followed by 72 °C for 2 min. PCR products were purified by SPRIselect (Beckman Coulter, B23317) and 2 µl eluted product was used for 8 cycles of additional PCR with KAPA HiFi HotStart ReadyMix to add Illumina sequencing adapters and indices. The final PCR products were purified by SPRIselect, quantified using a Qubit 1× dsDNA High Sensitivity assay kit (Invitrogen, Q33230), equimolarly pooled and sequenced using a MiSeq Reagent kit v2 300 cycles (Illumina, MS-102-2002) with 300 cycles for the R1 read, 8 cycles for the i7 index read and 8 cycles for the i5 index read. Sequencing data were demultiplexed using BaseSpace and analysed using CRISPResso2 (2.2.11).
HSPC isolation, culture and prime editing
mRNA in vitro transcription template plasmids for HSPC experiments were constructed by cloning PEmax and PE7 into a previously described vector63. mRNA was generated using a HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs, E2040S) and BbsI linearized plasmids as templates with UTP fully replaced by N1-methylpseudouridine-5′-triphosphate (TriLink Biotechnologies, N-1081) and co-transcriptional capping by CleanCap Reagent AG (TriLink Biotechnologies, N-7113). Following IVT, mRNA was purified using a Monarch RNA Cleanup kit (500 µg) (NEB, T2050S), eluted in IDTE pH 7.5 (Integrated DNA Technologies, 11-05-01-15) and quantified using a Qubit RNA High Sensitivity Assay kit (Invitrogen, Q32852). Synthetic pegRNAs and an epegRNA were ordered as Custom Alt-R gRNA from Integrated DNA Technologies (Supplementary Table 8) and resuspended at 200 µM in IDTE pH 7.5. Cryopreserved human CD34+ HSPCs from mobilized peripheral blood of de-identified healthy donors were obtained from the Fred Hutchinson Cancer Research Center (Seattle, Washington). The CD34+ HSPCs used in this study were de-identified and research use consent had been previously obtained. As the de-identified human specimens were not collected specifically for this study and our study team could not access any subject identifiers linked to the specimens or data, the Boston Children’s Hospital IRB has determined this is not considered human-related research. CD34+ HSPCs were cultured with X-Vivo-15 medium supplemented with 100 ng ml−1 human stem cell growth factor, 100 ng ml−1 human thrombopoietin and 100 ng ml−1 recombinant human FMS-like tyrosine kinase 3 ligand. CD34+ HSPCs were thawed and cultured for 24 h in the presence of cytokines before nucleofection. Overall, 2.5 × 105 CD34+ HSPCs were electroporated using a P3 Primary Cell X kit S (Lonza Bioscience, V4SP-3096) according to the manufacturer’s recommendations with 2,000 ng PEmax or PE7 mRNA and 200 pmole synthetic pegRNA or epegRNA using pulse code DS-130. gDNA was collected 3 days after nucleofection using QuickExtract DNA Extraction solution (LGC Biosearch Technologies, QE09050) following the manufacturer’s recommendations. Prime editing outcomes were quantified by amplicon sequencing and CRISPResso2 (2.2.11) analysis as described above.
Statistics and reproducibility
CRISPRi screens were performed in independent biological duplicate. Sample sizes (n) for all other experiments and analyses are defined in the appropriate main or extended data figure legend and experiments were performed as described therein, with the following exceptions. Results in Fig. 2a (and Extended Data Fig. 3d) are from western blotting performed once with specified cell lines. Results in Fig. 2f depict representative flow cytometry plots (n = 3 independent biological replicates). For all instances of n ≤ 10, data points were plotted individually (in relevant or associated figure panel) and/or data are provided in Supplementary Tables 1–3 and 7 or raw data have been made publicly available, except for gene-level phenotypes of our PE4 and PE5 genome-scale CRISPRi screens, from which no significant hits were identified. Select comparisons between editing conditions are indicated in Figs. 1e, 2b,c, 3d, 4b,c,f, 5a,d,f and Extended Data Figs. 3a,b,h, 4a,b, 5c–e, 9a,b,d, 10a and 11d. P values for these comparisons can be found in the associated figure panels or in Supplementary Table 7.
Reporting summary
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.
[ad_2]
Source link
Leave a Reply