Cell culture (University College London)
Key reagents can be found in Supplementary Table 1. SH-SY5Y cells (American Type Culture Collection (ATCC)) and SK-N-BE(2) (ATCC) with stable doxycycline-inducible short-hairpin RNA (shRNA) to TARDBP were described in ref. 6 and were maintained in DMEM–F12 with GlutaMAX (Thermo Fisher Scientific) with 10% fetal bovine serum (FBS) (Thermo Fisher Scientific), 1% penicillin–streptomycin (Thermo Fisher Scientific) and split with TrypLE Express (Thermo Fisher Scientific) when 80% confluent. The WTC11 iPS cell line derived from a healthy human participant (GM25256) with stable integration of doxycycline-inducible expression of NGN2 at the AAVS1 locus and stable integration of dCas9-BFP-KRAB at the CLYBL locus was a gift from M. Ward51. This iPS cell line is heterozygous for UNC13A risk SNPs (rs12608932 and rs12973192). Cells were maintained in E8 Flex Medium (Thermo Fisher Scientific) in Geltrex-coated (Thermo Fisher Scientific) plates and passaged with Versene solution (Thermo Fisher Scientific) or Accutase (Thermo Fisher Scientific) when 80% confluent. All cell lines were authenticated by short tandem repeat profiling and were routinely tested for mycoplasma contamination, with negative results throughout. For induction of iPS cells to iNeurons, iPS cells were passaged with Accutase (Thermo Fisher Scientific) and plated into Geltrex-coated plates with induction media: DMEM–F12 with GlutaMAX (Thermo Fisher Scientific), 1× N2-Max Supplement (R&D Systems), 1× non-essential amino acids (Thermo Fisher Scientific), 2 μg ml−1 doxycycline hyclate (Sigma-Aldrich), 2 μM XAV939 (Cayman Chemical), 10 μM SB431542 (Cayman Chemical) and 100 nM LDN-193189 (Cayman Chemical)52,53. Medium was changed daily for 3 days. On the third day, cells were replated to poly-l-ornithine-coated (10 μg ml−1; Sigma-Aldrich) plates for RNA and protein experiments or on 50 μg ml−1 poly-d-lysine (PDL) (Gibco; Thermo Fisher Scientific) and 10 μg ml−1 laminin-coated (Gibco; Thermo Fisher Scientific) 18-mm coverslips (Deckglaser) with primary rat astrocytes for electrophysiology, live imaging and immunofluorescence experiments. Differentiated neurons were maintained in neuronal medium (synaptic medium) with extra supplements: BrainPhys (StemCell Technologies), with 1× N2-Max Supplement (R&D Systems), 1× N21-Max Supplement (R&D Systems), 10 ng ml−1 NT3 (StemCell Technologies), 20 ng ml−1 glial cell line-derived neurotrophic factor (GDNF) and brain-derived neurotrophic factor (BDNF) (Peprotech), 2.5% FBS (Thermo Fisher Scientific), 1× Non-Essential Amino Acids (Thermo Fisher Scientific), 0.2 mg ml−1 cAMP (Sigma-Aldrich), 1× GlutaMAX (Thermo Fisher Scientific), 1% penicillin–streptomycin (Thermo Fisher Scientific) and 200 nM ascorbic acid (Sigma-Aldrich)54. This medium was used for all experiments, with the exception of MEA recordings that were carried out without FBS. Half-medium changes were performed twice per week for all cultures, or after recording on MEA cultures.
For rat astrocyte preparation, primary cortices were dissected from E18 Wistar rat embryos (Charles River Laboratories) and treated with 0.5 mg ml−1 trypsin (Worthington) for 15 min at 37 °C. Cortices were washed with Hanks’ balanced saline solution (Thermo Fisher Scientific) and triturated with fire-polished glass Pasteur pipettes of decreasing diameter in DMEM (Thermo Fisher Scientific) + 10% FBS (Gibco; Thermo Fisher Scientific). Cells were collected by centrifugation at 900 r.p.m. for 10 min, resuspended and passed through a 70-µm cell strainer. Roughly 15–18 million cells were plated in a T-75 flask and cultured in DMEM + 10%FBS + 1% penicillin–streptomycin (Thermo Fisher Scientific). After 2 days a complete medium change was conducted to remove antibiotics and medium was replaced every 3 days thereafter. Once reaching confluence, the cultures were enriched for astrocytes by shaking at 180 r.p.m. on an orbital shaker for 30 min, after which the medium was removed. Fresh medium was added and shaking increased to 240 rpm for 6 h, after which the medium was replaced. These steps remove microglia and oligodendrocyte precursor cells. Astrocyte-enriched cultures were passaged using 0.25% trypsin–EDTA (Thermo Fisher Scientific) and cultured in fresh T-75 flasks for 12–14 days, with a medium change every 2–3 days, until confluent. Astrocytes were then passaged and either stored in liquid nitrogen or plated on 50 μg ml−1 PDL (Gibco; Thermo Fisher Scientific) and 10 μg ml−1 laminin-coated (Gibco; Thermo Fisher Scientific) 18 mm coverslips (Deckglaser) for culturing with iNeurons.
Cell culture (Leibniz-FMP-Berlin)
The GM25256 human iPS cell line, which is heterozygous for UNC13A risk SNPs (rs12608932 and rs12973192) (Coriell Institute for Medical Research) was maintained in mTeSR1 stem cell culture media on Matrigel-coated plates (StemCell Technologies, 85850; Corning, 354277). Human iPS cells were fed daily and split every 4–5 days. Differentiation of iPS cells into motor neurons (iMNs) was carried out using three-dimensional developmental pathways for 14 days (refs. 7,55). On day 14, neuronal spheroids were dissociated, counted and frozen using 70% KnockOut Serum Replacement (Gibco; Thermo Fisher Scientific, 10828010), 20% 1 M Trehalose (Thermo Fisher Scientific, 182550250) and 10% DMSO (Sigma-Aldrich, D2650). Neurons were thawed, and plated on PDL–laminin-coated coverslips or directly on PDL-coated coverslips on which mouse astrocytes were plated25, and maintained in a medium containing Neurobasal medium (Gibco; Thermo Fisher Scientific, 12348017) supplemented with 1× N-2 supplement (Gibco; Thermo Fisher Scientific, 17502001), 1× B-27 supplement (Gibco; Thermo Fisher Scientific, A1486701), 1× penicillin–streptomycin (Gibco; Thermo Fisher Scientific, 15140-122), 20 µM l-ascorbic acid (Sigma-Aldrich, A4403-100MG), 1% KnockOut Serum Replacement (Gibco; Thermo Fisher Scientific, 10828010), 5 µM ROCK inhibitor Y-27632 (StemCell Technologies, 72304), 10 ng ml−1 GDNF (R&D Systems, 212-GD-050), 10 ng ml−1 CNTF (R&D Systems, 257-NT-050) and 20 ng ml−1 BDNF (R&D Systems, 11166-BD-050) for the first 2 days. After 2 days, half of the medium was exchanged with neuron maintenance medium without the ROCK inhibitor and supplemented with 5 µM DAPT (Sigma-Aldrich, D5942) and 10 ng ml−1 BDNF. Five days later, iMNs were fed with neuron maintenance medium without ROCK inhibitor and DAPT. iMNs were supplemented with fresh medium every 7 days.
Spinal iMNs release the neurotransmitter acetylcholine, but do not express postsynaptic nicotinic receptors. As such, iMN cultures express synaptic markers, but the cells are not synaptically connected. To record synaptic transmission properties in these neurons, we expressed the vesicular glutamate transporter (VGlut1) tagged by green fluorescent protein (GFP) in iMNs 1 week before electrophysiological recordings, on the basis of previous observations that its expression can confer the release of glutamate in inhibitory neurons56. Complementary DNA (cDNA) encoding rat VGlut1 tagged with enhanced GFP (EGFP) at the carboxy terminus was used to prepare lentiviral particles (Viral Core Facility of the Charité–Universitätsmedizin Berlin). The FUGW vector57, in which the ubiquitin promoter was exchanged with the human synapsin 1 promoter, was used according to a previously published57, modified protocol58, using helper plasmids59 (Addgene, 8454 and 8455).
Lentivirus production for CRISPRi knockdown
sgRNA pU6-sgRNA EF1Alpha-puro-T2A-BFP vector (Addgene 60955) was used to express the following sgRNAs:
sgCTRL, GTCCACCCTTATCTAGGCTA
sgTARDBP, GGGAAGTCAGCCGTGAGACC
sgUNC13A, GGAACCAAGATGGCCGGTGG
sgRNA transfer plasmid with packaging (pCMVΔ8.91) and VSVG envelope (pMD.G) plasmids were transfected into human embryonic kidney 293T (HEK293T) cells (Horizon Discovery) with TransIT-293 (Mirus). Medium was collected on days 2 and 3 after transfection, combined and concentrated 1:10 with Lenti-X concentrator (Takara Bio).
HaloTag editing of TARDBP
iPS cells were electroporated with 10 μg of HaloTag-TARDBP homology-directed repair template (gift from M. Ward, National Institutes of Health (NIH)), 500 pmol of Cas12 CRISPR-RNA (crRNA) (GGAAAAGTAAAAGATGTCTGAAT, Integrated DNA Technologies) and 20 μg of recombinant Cas12 (Integrated DNA Technologies) using the P3 Primary Cell 4D-Nucleofector kit (Lonza) and 4D-Nucleofector X unit (Lonza) using the CA-137 program. After electroporation iPS cells were plated in E8 Flex Media supplemented with 1× RevitaCell (Thermo Fisher Scientific) and 1× Alt-R HDR Enhancer V2 (Integrated DNA Technologies) for 24 h and then expanded in E8 Flex Media. Cells were labelled with HaloTag-TMR ligand (Promega) and positive clones were selected for genotyping by PCR.
UNC13A exon 20–21 cryptic exon deletion
sgRNAs were designed to target 45 bp upstream of the acceptor splice site of the long cryptic exon (GGAAAAGTAAAAGATGTCTGAAT) and 10 bp downstream of the donor splice site (GAGATGGGTGAGTACATGGA). Sense and antisense bridging oligonucleotides 5′-AAAGTCCAGATTCAGGG TCACCTCCTCTGGGAAGCCCACC TTGGCCTCCBGGATGGATAGATGGATGAGTTGGTGGGTAGATTCGTGGCTAGATGGATGA-3′ and 5′-TCATCCATCTAGCCACGAATCTACCCACCAACTCATCCATCTATCCATCDTGGAGGCCAAGGTGGGCTTCCCAGAGGAGGTGACCCTGAATCTGGACTTT-3′, which include degenerate base B (C, G or T) and D (A, G or T) were designed as homology-directed repair templates. The WTC11 iPS cell line (GM25256) and SH-SY5Y were electroporated with 250 pmol of each Cas9 sgRNA (Integrated DNA Technologies) along with 20 μg of recombinant Cas9 (Integrated DNA Technologies) and 1 pmol of each bridging oligonucleotide using the P3 Primary Cell 4D-Nucleofector kit (Lonza) using the CA-137 program60. Following electroporation cells were maintained in media with 1× Alt-R HDR Enhancer V2 (Integrated DNA Technologies) for 24 h.
ASO synthesis
Locked nucleic acid-modified ASOs were purchased from Integrated DNA Technologies. The 21-nt MOE-modified UNC13A splice-correcting ASOs or TDP-43 gapmer ASOs were purchased from Dharmacon, Wuxi or Biospring, and a gift from Trace Neuroscience. A panel of 18-nt MOE-modified ASOs was designed to tile across the region of interest before being subjected to further selection on the basis of potential sequence-driven off-target effects and secondary structure. The resulting panel of 24 ASOs was generated by solid-phase synthesis using MerMade12 automated synthesizer using prepacked controlled pore glass columns (1-µmol scale, 1,000 Å). Phosphoramidites (TheraPure by Thermo Fisher Scientific) were prepared at 0.08 M using acetonitrile. Cleavage and deprotection of oligonucleotides were performed using concentrated ammonia for 6 h at 55 °C. After deprotection, samples were dried and resuspended in water. Purification of the oligonucleotides was performed by reversed-phase high-performance liquid chromatography using 0.1 M triethylammonium acetate pH 7 and acetonitrile in an XBridge BEH C18 Prep column (Waters). Oligonucleotides were desalted using ethanol precipitation and quantification performed measuring the absorbance at 260 nm and the corresponding molecular extinction coefficient for each ASO. Quality control of the synthesized oligonucleotides was performed by liquid chromatography with mass spectrometry. ASO sequences are in Supplementary Table 2.
ASO treatment (University College London)
SH-SY5Y cells with stable integration of a shRNA cassette for TARDBP were treated with 25 ng ml−1 doxycycline (Sigma-Aldrich) for 5 days and then transfected while replating into 12-well plates using Lipofectamine RNAiMax (6 μl per well, Thermo Fisher Scientific) and ASOs at 50 nM final concentration. Following transfection, doxycycline concentration was increased to 1 μg ml−1 and cells were collected 5 days after transfection. To test 18-nt MOE-based ASOs, shTARDBP SH-SY5Y cells were treated with 25 ng ml−1 doxycycline for 5 days, then 100 ng ml−1 doxycycline for 24 h, plated into 96-well plates and transfected using Lipofectamine RNAiMax (0.72 μl per well) and ASOs at 10 nM or 50 nM final concentration. Cells were collected 48 h after transfection.
SK-N-BE(2) cells with stable integration of a shRNA cassette for TARDBP were treated with 25 ng ml−1 doxycycline for 3 days and then transfected while replating into 12-well plates using Lipofectamine RNAiMax (6 μl per well) and ASOs (4 μl of 100 μM stock). Following transfection doxycycline concentration was increased to 1 μg ml−1 and cells were collected 3 days after transfection.
HaloTDP iNeurons were cultured for 2 weeks after replating in neuronal media and then treated with 30 nM HaloPROTAC-E21 (University of Dundee) or HaloPROTAC3 (Promega). ASOs were added directly to neuronal media to enable free uptake. ASO treatments (1 μM) for protein and RNA collection were started at the same time as PROTAC treatment on DIV14 and were included in each media change for 2 weeks until cells were collected. ASO details for all functional experiments are outlined in Supplementary Table 3.
ASO treatment (Leibniz-FMP-Berlin)
To make 100 µg µl−1 storage stock solution, lyophilized ASO was resuspended in the appropriate amount of sterile PBS, pH 7.4. Once fully dissolved, the ASO was filter sterilized using a spin column (0.22 µm). The 100 µg µl−1 storage stock solution of ASO was aliquoted and stored at −20 °C for future use. To make roughly 500 µM working stock solutions for dosing neurons, the 100 µg µl−1 storage stock solution was diluted appropriately with sterile PBS, pH 7.4 and filter sterilized using a spin column (0.22 µm). To determine the concentration of the ASO working stock solution, the absorbance at 260 nm was measured on a NanoDrop One (Thermo Fisher Scientific) and concentrations were calculated using the molecular extinction coefficient for that ASO. The working stock solution of ASO was aliquoted and stored at −20 °C for future use. Dilutions of working stocks to the appropriate dose levels were made with the appropriate amount of sterile PBS, pH 7.4. On day 45 after neuronal plating, TRTDP43 ((moeA)*(moeA)*(moeG)*(moeG)*(moe5C)*(dT)*(dT)*(d5C)*(dA)*(dT)*(dA)*(dT)*(dT)*(dG)*(dT)*(moeA)*(moe5C)*(moeT)*(moeT)*(moeT); where moe denotes MOE base, d denotes DNA base, 5C denotes 5-methylcytosine) (2–4 μM)) was added to the culture wells to knock down TDP-43. In parallel, UNC13A splice-correcting M21-6 (2–4 μM) was added to some of the samples. Application was carried out once a week for 3 weeks. Electrophysiological recordings were carried out precisely 1 week following the last application.
RT–qPCR
RNA was extracted from SH-SY5Y cells, SK-N-BE(2) cells and iNeurons with a RNeasy kit (Qiagen) using the manufacturer’s protocol including homogenization of samples with QIAshredder spin columns (Qiagen). RNA concentrations were measured by NanoDrop (Thermo Fisher Scientific) and 500 ng of RNA was used for reverse transcription. First-strand cDNA synthesis was performed with RevertAid (Thermo Fisher Scientific, K1622) using random hexamer primers and following the manufacturer’s protocol including all optional steps. Gene expression analysis was performed by RT–qPCR using TaqMan Multiplex Universal Master Mix (Thermo Fisher Scientific, 4461882) with custom IDT RT–qPCR assays (Supplementary Table 4) and TaqMan assays (GAPDH-Jun assay; Thermo Fisher Scientific, 4485713) on a QuantStudio 5 Real-Time PCR system (Applied Biosystems) and quantified using the ΔΔCt method61. For RT–qPCR based on intercalating dyes PowerUp SYBR Green master mix (Thermo Fisher Scientific) was used with gene-specific primers (Supplementary Table 4).
RT–PCR
RNA extraction and cDNA synthesis were performed as in RT–qPCR methods. The UNC13A cryptic exon was amplified with a forward primer in exon 19 5′-CAGACGATCATTGAGGTGCG-3′ and reverse primer in exon 22 5′-ATACTTGGAGGAGAGGCAGG-3′ using Q5 Hot Start High Fidelity 2× Master Mix (New England Biolabs). PCR products were resolved on a TapeStation 4200 (Agilent) and bands were quantified with TapeStation Systems Software v.3.2 (Agilent). For the primary screen of ASOs in SK-N-BE(2) cells, PCR products were analysed with a QIAxcel capillary electrophoresis machine (Qiagen). Raw data were exported and analysed with the QIAxcelR package (v.0.1) (https://github.com/Delayed-Gitification/QIAxcelR).
Amplicon sequencing
Genomic DNA from SH-SY5Y cells and iPS cells were extracted with the Monarch Genomic DNA Purification Kit (New England Biolabs). PCR was performed with Q5 Hot Start High Fidelity 2× Master Mix (New England Biolabs) and purified with Monarch PCR cleanup kit (New England Biolabs). Purified amplicons were sequenced using the Premium PCR long-read sequencing service (Plasmidsaurus). Raw FASTQ reads were mapped to UNC13A and TARDBP genes using Minimap2 (ref. 62) with the -x splice flag enabled (v.2.26-r1175) and converted to BAM files with SAMtools63 (v.1.21). Results were visualized with the Integrative Genomics Viewer (IGV) browser64. For quantification of UNC13A allele-specific rescue, RT–PCR was performed as described above and amplicons were sequenced by Plasmidsaurus. Raw FASTQ reads were mapped to UNC13A using Minimap2, converted to BAM files with SAMtools and SNPs were quantified with custom Python scripts.
Low-pass whole-genome sequencing
Genomic DNA was extracted from iPS cells using the Monarch Genomic DNA Purification Kit (New England Biolabs). Low-pass whole-genome sequencing (roughly 10× mean coverage) was performed by Azenta Life Sciences. Adapter trimming and quality control of FASTQ files were carried out with fastp65 (v.0.23.4). Reads were aligned to the human reference genome GRCh38 (GCA_000001405.15) using bwa-mem2 (ref. 66) (v.2.2.1), and the resulting alignments were converted to sorted BAM format with SAMtools (v.1.21). Copy-number variant analysis was performed with CNVkit67 (v.0.9.12) using the batch command with the whole-genome sequencing pipeline (–method wgs). Sequencing-accessible regions were defined by masking gaps and repeat tracks from the UCSC genome browser (–access access-hg38.bed). Bins of 20-kilobase average size were used (–target-avg-size 20,000), GC bias and low-coverage bins were corrected (–drop-low-coverage), gene annotations were added from refFlat.txt (–annotate) and a flat male reference was constructed (–male-reference –normal –output-reference WTC11-WT_flat.cnn). Segmented copy number profiles were generated with the default circular binary segmentation algorithm.
Off-target PCR and sequencing
For Cas9 genome edits (UNC13A cryptic exon deletion) off-target sites were identified using the CRISPR–Cas9 gRNA checker tool (Integrated DNA Technologies). For Cas12 genomic edits (HaloTag-TDP-43), off-target sites were predicted by Cas-OFFinder68 using the following settings: LB Cas12, PAM motif TTTV, DNA Bulge = 1 and mismatch = 3. Predicted off-targets sites within annotated genes were examined. Genomic DNA from iPS cells was extracted with Monarch Genomic DNA Purification Kit (New England Biolabs). PCR was performed with 50 ng of DNA using Q5 Hot Start High Fidelity 2× Master Mix (New England Biolabs) with the primers described in Supplementary Table 5.
PCR products were resolved on a TapeStation 4200 (Agilent) and bands were analysed with TapeStation Systems Software v.3.2 (Agilent). PCR products were sequenced using the Premium PCR long-read sequencing service (Plasmidsaurus) to generate full-length reads of individual amplicons. Raw FASTQ files were aligned with Minimap2, outputs were converted to BAM files with SAMtools (v.1.21) and then visualized with IGV.
Western blot analysis (University College London)
Cells were collected with RIPA buffer (Thermo Fisher Scientific) with cOmplete mini protease inhibitors (Sigma-Aldrich) and protein concentration was quantified using the Pierce bicinchoninic acid (BCA) Protein Assay Kit (Thermo Fisher Scientific). Protein lysates were resolved on 4–12% precast Bis-Tris gels (Thermo Fisher Scientific) or poured 7% Bis-Tris gels and transferred to 0.2-μm polyvinylidene difluoride membranes (Merck Millipore). Membranes were blocked with 5% non-fat milk in tris-buffered saline with Tween (TBST) and then probed overnight with primary antibodies (Supplementary Table 6) in 5% non-fat milk in TBST at 4 °C. Blots were washed 3 times with TBST and subsequently probed with horseradish peroxidase (HRP)-conjugated secondary antibodies at room temperature for 1 h (Goat anti-Mouse HRP Bio-Rad 1706516; 1:10,000 or Goat anti-Rabbit HRP Bio-Rad 1706515; 1:10,000) and developed with Chemiluminescent substrate (Merck Millipore, WBKLS0500) on a ChemiDoc Imaging System (Bio-Rad). Band intensity was measured with Fiji (ImageJ)69 (NIH version 2.0.0-rc-69). Band intensities were normalized to loading control (Tubulin) within each lane. Normalized values were log10-transformed before analysis. The effect of treatment was assessed by repeated-measures one-way analysis of variance (ANOVA), with biological replicate (blot) as the matching factor and the Geisser–Greenhouse correction applied (sphericity not assumed), followed by Tukey’s multiple comparisons test for all pairwise comparisons between groups.
Western blot analysis (Leibniz-FMP-Berlin)
Motor neurons were lysed in RIPA buffer (25 mM Tris, 150 mM NaCl, 0.5% (w/v) SDOC, 1% IGEPAL (NP-40), 0.1% (w/v) SDS) with 0.1% of each protease inhibitor (aprotinin, leupeptin, phenylmethylsulfonyl fluoride), sonicated and centrifuged in a tabletop centrifuge at 4 °C for 45 min at 15,000 r.p.m. Supernatants were transferred into a fresh tube, and protein concentration was determined using Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, 23225). Samples were diluted in Laemmli buffer (3% (w/v) SDS, 41.6 mM Tris, 1 mM EDTA, 10% (v/v) glycerol, 0.06% (w/v) bromophenol blue, 0.77%, (w/v) dithiothreitol in double-distilled H2O (ddH2O)) and incubated for 10 min at 95 °C. Then 10 µg of the lysed samples was loaded onto a commercial 4–12% Bis-Tris gels (NuPAGE 4–12% Bis-Tris Gel (1.0 mm × 10 wells), Invitrogen, NP0321BOX) and separated in cold MOPS buffer (20 mM MOPS free acid, 5 mM sodium acetate, 1 mM Na2EDTA) at a constant voltage of 120 V. Transfer of the proteins was conducted in transfer buffer (192 mM glycine, 25 mM Tris, 10% methanol) on a nitrocellulose membrane for 14 h at 65 mA. Membranes were then stained for total protein as a loading control with Pierce Reversible Protein Stain Kit for Nitrocellulose Membranes (according to the manufacturer’s manual; Thermo Fisher Scientific, 24580). The membranes were blocked with 5% milk in TBST buffer (10 mM Tris/HCl, 100 mM NaCl, 0.1% Tween 20, pH 7.5) for 1 h at room temperature. After this step, the membranes were cut and incubated with primary antibodies: rabbit anti-Munc13-1 (Synaptic Systems, 126 103, 1:250), rabbit-TDP-43 (Proteintech, 10782-2-AP, 1:1,000), mouse anti-Vinculin (Sigma-Aldrich, V9131-100UL 1:1,000) and rabbit anti-Stathmin-2 (Bio-Techne, NBP1-49461, 1:1,000). The corresponding secondary antibodies used were: anti-mouse HRP (Jackson ImmunoResearch, 115-035-146, 1:3,000) and anti-rabbit HRP (Jackson ImmunoResearch, 111-035-144, 1:3,000). The chemiluminescence signal was detected with Pierce ECL Western Blotting Substrate (Thermo Fisher Scientific, 32106) on an ECL ChemoStar imager (Intas). Protein signals were analysed in Fiji (ImageJ). Protein levels were first normalized to the total protein staining in the corresponding lane, and then to the control condition. Finally, statistical analysis was conducted in GraphPad Prism (GraphPad Software) using one-way ANOVA with multiple comparisons. Error bars represent mean ± s.e.m.
MEA recordings
Maestro 96-well cytoview MEA plates (Axion Biosystems M768-tMEA-96B) were drop-wise coated in 0.05 mg ml−1 PDL (Gibco; Thermo Fisher Scientific, A38904-01) at room temperature for 2 h, washed 3× in 50 μl of ddH2O and left to dry overnight. Wells were then drop-wise coated with 10 μg ml−1 laminin (Thermo Fisher Scientific) for 1–2 h at 37 °C. 50,000 neurons and 12,500 primary rat astrocytes were drop-wise plated in synaptic media (described above) containing ROCK inhibitor (Y-27632; Tocris, 1254) at 1 μM. Cells were left to attach for 1.5 h before media containing CultureOne Supplement (Gibco; Thermo Fisher Scientific) was added for 3 days. Half-medium changes (without ROCK inhibitor or CultureOne) were thereafter performed every 2–3 days and HaloPROTAC-E 30–300 nM was added to cultures with each media change starting on DIV14 for early TDP-43 KD and at DIV33 for late TDP-43 KD. ASO treatment was performed every 2 weeks starting at DIV14, at a final concentration of 0.5 μM. MEA plates were recorded from every 2–3 days on the Maestro Pro (Axion Biosystems). Plates were left inside the Maestro Pro for 15 min preceding each recording to allow for acclimatization and recordings occurred immediately after and continued for 15 min. Data were processed using the Neural Metric Tool (Axion Biosystems). Active electrode criteria were set to five spikes per min. Single electrode burst parameters used an inter-spike interval threshold, consisting of a minimum of five spikes and a maximum inter-spike interval of 100 ms. Network bursts used envelope analysis, with a threshold factor of 1.25, minimum inter-burst interval of 100 ms, 35% minimum electrode and a burst exclusion of 75%. All synchrony metrics were measured with a synchrony window of 20 ms. Wells with fewer than three active electrodes were excluded from the analysis. For visualization of combined replicate time-course traces, data were normalized to the maximum mean of each control condition. All quantification was done using raw data and all log2[fold changes] shown were derived from raw data. Statistical analysis was performed on area under the curve values of each individual experiment. This was done for time-course data between day 28 and the last day of neuronal survival for early TDP-43 KD and UNC13A KD, between day 37 and the last day of survival for late TDP-43 KD phenotype recordings and between day 43 and last day of neuronal survival for late TDP-43 KD with ASO rescue experiments. The last day of neuronal survival was defined as the last day that every replicate plate had a viable set of recordings, regardless of whether individual plates lasted longer.
Electrophysiology recordings
For whole-cell patch clamp recordings, 500,000 neurons were plated onto 18 mm no. 1 coverslips (Deckglaser) coated with 50 μg ml−1 PDL (Gibco; Thermo Fisher Scientific) and mouse 10 μg ml−1 laminin (Gibco; Thermo Fisher Scientific). Primary rat astrocytes were plated 1 week before and treated with CultureOne Supplement (Gibco; Thermo Fisher Scientific) 2 days before. mEPSCs were recorded at 4-weeks maturation on rat astrocytes, in extracellular solution containing: 136 mM NaCl, 2.5 mM KCl, 10 mM HEPES, 1.3 mM MgCl2, 2 mM CaCl2, 10 mM glucose, pH 7.3, 300 mOsm l−1, supplemented with 1 μM tetrodotoxin (Tocris) and 10 μM gabazine (Tocris). Patching pipettes were filled with caesium methanosulfate-based internal solution: 135 mM CsMeSO3, 10 mM HEPES, 10 mM Na2-phosphocreatine, 5 mM glutathione, 4 mM MgCl2, 4 mM Na2ATP, 0.4 mM NaGTP supplemented with 5 μM QX-314 (Tocris). Pipettes were pulled from borosilicate glass (outer diameter 1.5 mm, inner diameter 0.86 mm, Sutter Instruments) to a resistance of between 3 MΩ and 5 MΩ. Whole-cell patch clamp recordings were then made, without whole-cell compensation applied, for 5 min at the soma. Cells were held at −70 mV using a Multiclamp 700B amplifier (Molecular Devices) and the data were acquired using a Digidata 1440A digitizer (Molecular Devices). All recordings were carried out on a heated stage set to 37 °C. Data were acquired with Clampex software (Molecular Devices) and Axon Multiclamp Commander Software (Molecular Devices), data were sampled at a rate of 20 kHz and filtered at 10 kHz. mEPSCs were analysed in a fully automated manner using Clampfit v.10.7 software (Molecular Devices). Passive membrane properties were measured by applying a subthreshold voltage step and analysed using custom MATLAB scripts. Series resistance (Rs) was calculated as proportional to the current response amplitude, membrane capacitance (Cm) was estimated from the transient time constant by fitting the current transients to exponential functions and membrane resistance (Rm) was estimated from the steady-state response following the current transients. Passive membrane properties and series resistance were measured at the beginning and at the end of all recordings to ensure proper access (Rs < 30 MΩ) had been maintained.
Autaptic cultures and recordings (University College and King’s College London)
Autaptic micro-islands were prepared according to a previously published protocol27. Briefly, 18 mm No.1 coverslips (Deckglaser) were etched in 1 M HCl for 2 h, neutralized in 1 M NaOH for 1 h then washed 3× in ddH2O, 1× in 70% ethanol and then stored in 100% ethanol. Coverslips were then briefly coated for 30 s with heated (55 °C) 0.0015% agarose type II-A and left to dry overnight. Microdots were then applied using a solution of 0.16 mg ml−1 PDL (Gibco; Thermo Fisher Scientific), 1.16 mg ml−1 rat tail collagen (BD Biosciences) and 5.6 mM acetic acid using a custom rubber stamp with a dot diameter of 250 μm (gift from M. Verhage). Around 10,000 primary rat astrocytes were plated in DMEM–F12 (Gibco; Thermo Fisher Scientific) with 10% ES-FBS (Gibco; Thermo Fisher Scientific) and 1× penicillin–streptomycin (Gibco; Thermo Fisher Scientific) for 1 week before plating 2,000 NGN2 forward-programmed iNeurons. Cultures were then matured in synaptic media (above) for 10 weeks before electrophysiology recordings, with HaloPROTAC and ASO treatments started at 2 weeks post-plating. Recordings were carried out in extracellular solution containing: 136 mM NaCl, 2.5 mM KCl, 10 mM HEPES, 1.3 mM MgCl2, 2 mM CaCl2, 10 mM glucose, pH 7.3 (300 mOsm l−1) and intracellular solution containing 125 mM KMeSO4, 5 mM MgCl2, 10 mM EGTA, 10 mM HEPES, 0.5 mM NaGTP and 5 mM Na2ATP, pH 7.4 (290 mOsm l−1). Cells were recorded in voltage clamp and given an 80-mV stimulus for 1 ms and a paired-pulse interval of 100 ms. Passive membrane properties were measured before and after recordings to ensure proper access (Rs < 30 MΩ) had been maintained.
Autaptic cultures and recordings (Leibniz-FMP-Berlin)
WT astrocyte micro-island cultures were prepared according to a published protocol70. Roughly 7 days after astrocyte preparation, 10,000 iMNs per well were plated to obtain a low-density culture. Cultures were kept at 37 °C and 5% CO2 until recordings were made at DIV60–70. Whole-cell voltage-clamp data were acquired using a HEKA EPC10 USB amplifier and the PATCHMASTER software (HEKA Elektronik, Harvard Bioscience). All recordings were performed using a standard external solution containing 140 mM NaCl, 2.4 mM KCl, 10 mM HEPES, 10 mM glucose, 2 mM CaCl2 and 2 mM MgCl2 (320 mOsm l−1). The standard internal solution contained 136 mM KCl, 17.8 mM HEPES, 1 mM EGTA, 4.6 mM MgCl2, 4 mM NaATP, 0.3 mM Na2GTP, 15 mM creatine phosphate and 5 U ml−1 creatine phosphokinase (315–320 mOsm l−1), pH 7.4. eEPSCs were evoked by depolarizing the cell from −70 mV to 0 mV for a 1-ms duration. Basal eEPSCs were recorded at a frequency of 0.1 Hz and mEPSCs were recorded for 50 s. mEPSC traces were filtered at 1 kHz, and miniature events were identified using a sliding template function in Igor Pro (5–200 pA; rise time, 0.15–1.5 ms; half-width, 0.5–5 ms). Analyses were performed using custom-made Igor Pro macros (WaveMetrics). Data were obtained from three cultures. Recordings were made at room temperature (roughly 22 °C).
Live imaging of synaptic release probability
For live imaging, iNeurons were transfected with pAAV.CAG.iGluSnFR3.v857.PDGFR, a gift from K. Podgorski28 (Addgene plasmid no. 178333). Transfections were conducted after 3 weeks maturation on rat astrocytes using Lipofectamine LTX (Thermo Fisher Scientific) following the manufacturer’s protocol. Imaging was conducted when neurons reached 5–6 weeks’ maturation in extracellular solution containing: 136 mM NaCl, 2.5 mM KCl, 10 mM HEPES, 1.3 mM MgCl2, 2 mM CaCl2, 10 mM glucose, pH 7.3, (290 mOsm l−1), supplemented with 10 μM NBQX, 25 μM AP-V and 10 μM gabazine (Tocris) to prevent recurrent activity. Neurons were transferred to a field stimulation chamber with parallel platinum electrodes (RC-49FS, Harvard Bioscience) and imaged on an inverted Olympus IX71 microscope equipped with a ×60/1.42 numerical aperture oil objective. Images were acquired with an ORCA-Flash4.0 V2 C11440-22CU scientific CMOS camera (Hamamatsu Photonics) cooled to roughly −20 °C with an Exos2 water cooling system (Koolance) and controlled using HCImageLive Software (Hamamatsu Photonics). The excitation light source was a 470 nm LED (CoolLED) set at 70% power, filtered with an excitation–emission filter set optimized for EGFP (49002 ET-EGFP, Chroma). Full frame images were acquired with 4 × 4 binning (pixel size 433 nm), frame bundling at 4 images and 10 ms exposure to achieve a frame rate of 100 Hz. Stimulation was delivered by an SD9 stimulator (Grass Technologies) using a pulse of 80 V for 1 ms to elicit a single action potential per pulse and consisted of 15 action potentials at 1 Hz in 3 separate images, which were combined during analysis. The triggering of LEDs, camera acquisition and stimulation were controlled externally through Clampex software (pCLAMP10, Molecular Devices) and a Master-8 programmable stimulator (A.M.P.I). The investigator was blinded to the treatment condition for iGluSNFR3 imaging.
Analysis of iGluSNFR3 images
iGluSNFR3 images were analysed using a custom-built MATLAB pipeline (https://github.com/f-hamidlab/iGluSNFR3/tree/publication_branch). Dendrites of iNeurons were first traced manually using the NeuronJ plugin71 for Fiji (ImageJ), converted to binary images and dilated twice. Binary masks were used to segment the region to be analysed using pixel-based analysis in the iGluSNFR3 pipeline. The gradient of the rising slope in the raw data trace was determined for each pixel and pixels with low signal-to-noise were removed. A sliding window was used to determine the baseline fluorescence (F0) for each pixel, pixels with high baseline drift were removed and ΔF/F0 was calculated. iGluSNFR3 events were detected using thresholds of three times the standard deviation of the baseline for both rising slope and peak ΔF/F0. Pixels with no events were removed resulting in punctate structures along the segmented dendrite that represented putative synapses. Pixels were then clustered into individual synaptic regions of interest (ROIs) both spatially (less than 5 pixels apart) and temporally (event peaks within 2 frames) and the number of evoked events per synapse was calculated by detecting peaks in the ΔF/F0 trace within a 150-ms time window after stimulation that were greater than 2.5 times the standard deviation of the baseline. Locations of synaptic ROIs were compared across the 3 images, and those within 5 pixels were considered to represent the same synapse. The overall release probability per synapse was calculated as the number of detected events divided by the number of stimulation trials (45).
TDP-43 and nuclear marker immunofluorescence
Here 20,000 neurons were grown on PDL–laminin-coated coverslips. Neurons were fixed at DIV28 in 4% paraformaldehyde (PFA), 4% sucrose for 15 min. Cells were then permeabilized in 0.1% Triton X-100 in PBS for 10 min. Primary antibodies used were mouse anti-TDP-43 (Abcam ab104223, 1:1,000), chicken anti-MAP2 (Abcam ab5392, 1:10,000), rabbit anti-CTIP2 (Abcam, ab18465, 1:200), rabbit anti-NKX2.1 (Abcam, ab76013, 1:200), chicken anti-PAX6 (Developmental Studies Hybridoma Bank University of Iowa, 1:200), mouse anti-NeuN (Merck, MAB377, 1:1,000) and guinea pig anti-B3-Tubulin (Cosmo Bio, MSFR105980, 1:1,000), and were diluted in PBS and incubated overnight at 4 °C. Cells were washed 3× in PBS. Secondary antibodies used were goat anti-mouse IgG (H+L) Alexa Fluor 488 (Thermo Fisher Scientific, A-11029), goat anti-rabbit IgG (H+L) Alexa Fluor 555 (Thermo Fisher Scientific), goat anti-guinea pig IgG (H+L) Alexa Fluor 647 (Thermo Fisher Scientific A-21450) and goat anti-chicken IgY (H+L) Alexa Fluor 647 (Thermo Fisher Scientific, A-21449), and were diluted in PBS 1:1,000 and incubated at room temperature for 1 h. Cells were washed 3× in PBS, labelled with 4′,6-diamidino-2-phenylindole (DAPI) (1:1,000) for 5 min at room temperature and mounted in ProLong Gold mounting medium (Thermo Fisher Scientific). Cells were imaged using a Zeiss 980 Airyscan confocal microscope using a ×63 objective.
UNC13A immunofluorescence
Roughly 500,000 neurons were grown on 50,000 primary rat astrocytes on PDL–laminin-coated coverslips. Neurons were fixed at DIV28 in 4% PFA for 10 min. Cells were then permeabilized in 0.1% Triton X-100 in PBS for 10 min. Primary antibodies used were guinea pig anti-Munc13-1 (Synaptic Systems 126 104) and mouse anti-Synapsin1 (Synaptic Systems 106 011), and were diluted in PBS at 1:500 and 1:1,000, respectively, and incubated for 1 h at room temperature. Cells were washed 3× in PBS. Secondary antibodies used were goat anti-mouse IgG (H+L) Alexa Fluor 488 (Thermo Fisher Scientific A-11029) and goat anti-guinea pig IgG (H+L) Alexa Fluor 647 (Thermo Fisher Scientific A-21450), and were diluted in PBS 1:1,000 and incubated at room temperature for 1 h. Cells were washed 3× in PBS and mounted in Mowiol-4-88 (PolySciences) mounting medium containing 1:1,000 DAPI (Thermo Fisher Scientific). Cells were imaged using a Zeiss 980 Airyscan confocal microscope using a ×63 objective with a 3× crop. Z-stacks of 7× 0.5-μm intervals were taken of synapses along a single neurite. Fiji (ImageJ) was used to analyse mean UNC13A intensity on the basis of manually selected synapsin-positive ROIs. Four Synapsin1 positive ROIs per neurite were manually selected on the basis of prominent size and intensity, while being blinded to the UNC13A channel. Selected ROIs were then used to measure the integrated density (IntDen) of the UNC13A channel. Selection of comparable Synapsin1 ROIs was confirmed through a separate comparison of ROI size (Control 0.405 s.e. ± 0.01, HaloPROTAC 0.419 s.e. ± 0.03, P = 0.68).
Further immunofluorescence at Leibniz-FMP-Berlin
Immunostainings were made in iMNs mass cultures at DIV66. The neurons were washed twice with PBS and fixed by adding 4% PFA for 30 min at room temperature. The PFA was removed and leftover was quenched by adding 50 mM cold glycine for 10 min, followed by washing the neurons twice with PBS. The cells were either stored in PBS at 4 °C or immediately used for immunostaining. The cell membrane was permeabilized with cold 0.25% Triton X-100 in PBS for 10 min and rinsed once in pure PBS. To block non-specific binding sites, the cells were incubated in cold 0.3% NGS in PBS for 20 min. To label the proteins of interest, the following antibodies were applied in blocking solution: chicken anti-MAP2 (Novus Biologicals, NB300-213, 1:500), guinea pig anti-VAChT (Synaptic Systems, 139 105, 1:500), rabbit anti-Islet-1 (Abcam, ab109517, 1:500) and mouse anti-Bassoon (Abcam, ab82958, 1:500). Incubation was performed for 1 h at room temperature in the dark. To remove unbound antibodies, the cultures were washed 3 times with 1 ml of blocking solution before applying the following secondary antibodies conjugated with fluorophores: anti-chicken IgY (H&L) Alexa Fluor 405 (Abcam, ab175674, 1:500), anti-guinea pig Atto647N (synthesized from donkey anti-guinea pig IgG (H+L); Jackson ImmunoResearch, 706-005-148, by the FMP Imaging Facility, diluted 1:500) and anti-mouse Atto542 (synthesized from donkey anti-mouse IgG (H+L); Jackson ImmunoResearch, 715-005-151, FMP Imaging Facility, diluted 1:500) and anti-rabbit Alexa Fluor Plus 594 (Thermo Fisher Scientific, A-11012, diluted 1:500). VGluT1-GFP was labelled at this stage using GFP Booster Atto488 (ChromoTek, gba488, diluted 1:200). The neurons were incubated with secondary antibodies for 30 min at room temperature in the dark and washed 4 times in PBS to remove unbound products. The coverslips on which the neurons were fixed were mounted with ProLong Gold Antifade Mountant (Thermo Fisher Scientific, P36934) on microscope glass slides and stored in the dark at room temperature for 48 h until dry before imaging.
Synapse density analysis
Here, 500,000 iNeurons were grown on 50,000 primary rat astrocytes on PDL–laminin-coated coverslips. Neurons were transfected after 3 weeks maturation on rat astrocytes with CAG::tdTomato, using Lipofectamine LTX (Thermo Fisher Scientific) following the manufacturer’s protocol. After 5 weeks of maturation, neurons were fixed in 4% PFA for 10 min. Cells were then permeabilized in 0.1% Triton X-100 in PBS for 10 min and incubated in blocking solution (2% bovine serum albumin in PBS) for 1 h. Primary antibodies: mouse anti-Synapsin1 (Synaptic Systems, 106 011), rabbit anti-Homer1 (Synaptic Systems, 160 002) were diluted in blocking solution at 1:1,000 and 1:500, respectively, and incubated for 1 h at room temperature. Neurons were washed 3× in PBS. Secondary antibodies, goat anti-mouse IgG (H+L) Alexa Fluor 488 (Thermo Fisher Scientific, A-11029) and goat anti-rabbit IgG (H+L) Alexa Fluor 647 (Thermo Fisher Scientific, A-21245) were diluted in blocking solution at 1:1,000 with FluoTag-X4 anti-RFP nanobody conjugated to ATTO565 (NanoTag Biotechnologies, N0404) at 1:500 and incubated at room temperature for 1 h. Cells were washed 3× in PBS and mounted in Mowiol-4-88 (PolySciences) mounting medium.
Neurons expressing tdTomato were imaged on a Nikon AXR confocal microscope equipped with a ×60/1.40 numerical aperture oil-immersion objective, controlled by NIS-Elements software (Nikon). Excitation lasers were 488 nm, 561 nm and 640 nm and the same gain and power settings were used across all conditions for each culture. Then 2,048 × 2,048 images (pixel size 0.111 µm) were taken as sequential linescans, generating a z-stack with steps of 0.3 µm to cover the depth of the tdTomato-positive neuron. For one culture, 1,024 × 1,024 images were taken (pixel size 0.222 µm). Several z-stacks were taken to cover the entire dendritic arbour of each cell. The investigator was blinded to the treatment condition for synapse density imaging. Images were then analysed in Fiji (ImageJ) using custom-written macros. First, maximum projections of the tdTomato channel were used to trace dendrites using the NeuronJ plugin. Binary traces were dilated three times to generate a dendritic mask. Maximum projection images of the Synapsin1 (presynaptic) staining were filtered with a top hat filter of radius of two and an automated threshold using the Moments algorithm was applied, followed by watershed processing to separate merged puncta. Particles of size 0.08–2.5 µm2 were analysed to generate presynaptic ROIs. Maximum projections of the Homer1 (postsynaptic) staining were filtered using a top hat filter of radius 1 and underwent automated thresholding using the Renyi Entropy algorithm, followed by watershed processing and analysis of particles of size 0.00–1.2 µm2 to identify postsynaptic ROIs. Postsynaptic ROIs were enlarged by 1 pixel and analysed for overlap with both the dendrite masks and presynaptic ROIs. Synapses on dendrites that consisted of both a presynaptic and postsynaptic partner were counted and divided by the total area of the dendrite mask to calculate the synapse density for each cell.
Neuronal survival analysis
Around 10,000 HaloTDP iNeurons were plated on 5,000 primary rat astrocytes in 96-well imaging phenoplates (Revvity) and matured in synaptic media (BrainPhys, StemCell Technologies), with 1× N2-Max Supplement (R&D Systems), 1× N21-Max Supplement (R&D Systems), 10 ng ml−1 NT3 (StemCell Technologies), 20 ng ml−1 GDNF and BDNF (Peprotech), 2.5% FBS (Thermo Fisher Scientific), 1× Non-Essential Amino Acids (Thermo Fisher Scientific), 0.2 mg ml−1 cAMP (Sigma-Aldrich), 1× GlutaMAX (Thermo Fisher Scientific), 1% penicillin–streptomycin (Thermo Fisher Scientific) and 200 nM ascorbic acid (Sigma-Aldrich)54. HaloPROTAC (30 nM) was added at DIV14. Plates were longitudinally imaged and neuronal cell bodies automatically quantified by means of phase-contrast detection using the Incucyte S3 imaging platform. Subsequently, plates were fixed with PFA at weekly timepoints and stained for NeuN and DAPI (as above). NeuN automated imaging was carried out on an Opera Phenix high-content screening system (Revvity) and NeuN/DAPI counts quantified using Harmony v.4.9 Software.
Generation of hUNC13A reporter mice
Mouse C57BL/6J embryonic stem cells (B6.N6) were transfected with a targeting vector, designed to replace mouse intron 20 with the orthologous human sequence using an 817-bp 5′ homology arm and a 1,462-bp 3′ homology arm. Two risk allele SNPs for ALS and frontotemporal dementia (rs12973192 (G) and rs12608932 (C)) were present within the human intron sequence used to replace the endogenous mouse intron. Two CRISPR–Cas9 site-specific nucleases targeting the boundaries of intron 20 (5′-GGAGCCAGCTGTATGCGTCT-3′ and 5′-GTACCAAGGAGACGTGGCAT-3′) were cotransfected as pX459 (Addgene no. 62988) vectors. Following transient selection in 1.8 μg ml−1 puromycin for 48 h, applied 24 h after transfection, clones were grown, isolated and screened for homologous recombination events using primers 5′-LR-FWD1–REV1 and 3′-LR-FWD1–REV1 to amplify over the 5′ and 3′ homology arms, respectively. qPCR assays were designed against the mouse and human intron 20 and used to verify the loss of the mouse intronic sequence and the gain of the human intronic sequence. Recombinant embryonic stem cells were microinjected into albino C57BL/6J blastocysts and the resulting chimeras were bred with C57BL/6J mice. The offspring were genotyped for the presence of the targeted allele.
An aberrantly targeted line of mice was generated in which the homologous recombination event had occurred, but with a tandem duplication of the vector that led to a portion of the vector backbone being integrated within intron 23. Despite the tandem duplication, the human intron was correctly positioned within the context of the murine Unc13a gene, which was expressed and appropriately spliced. We refer to this mouse line as a human UNC13A reporter mouse and it was used in subsequent in vivo studies.
TDP-43 knockdown and ASO treatment in hUNC13A reporter mice
Mice were injected with an recombinant AAV (rAAV) (PHP.eB) that expresses a synthetic microRNA targeting the mouse Tardbp gene (PackGene BioTech; gift from Trace Neuroscience) along with UNC13A ASO (M21-4) or vehicle at 8 weeks of age (P56-62). rAAV-Tardbp-microRNA was diluted in sterile PBS and administered as a 150-µl tail-vein injection. A total dose of 1.4 × 1012 vg was delivered per mouse. Mice were subsequently exposed to 5% isoflurane for anaesthetic induction, before reducing the concentration to 1.5–2% for maintenance purposes. Analgesia was provided with 5 mg kg−1 oral Metacam administered in a custard carrier 60 min before surgery, followed by subcutaneous injections of 10 mg kg−1 meloxicam and 0.1 mg kg−1 buprenorphine. A subcutaneous injection of 2 mg kg−1 bupivacaine was given as an incisional block shortly after anaesthetization. Intracerebroventricular injections of 10 µl of ASO (30 mg ml−1 in artificial cerebrospinal fluid (ACSF) (Harvard Apparatus, 59-7316) supplemented with extra Mg2+ to achieve a 3:1 Mg2+:ASO ratio) or vehicle (0 mg ml−1 in ACSF + Mg2+) were performed using a Hamilton syringe at a rate of 1 µl min−1. Injection coordinates were set at −0.35 mm y, +1 mm x, −1.75 mm z relative to the line of best-fit bregma and brain surface. The incision was subsequently sutured closed, and animals were returned to their home cages. Mice were closely monitored for 3 days post-surgery and provided with 5 mg kg−1 Metacam in custard carrier every 24 h postsurgery for the duration. Injections were performed blinded to treatment group. Mice of both sexes were included, with n = 9 (6 females, 3 males) for ASO and n = 7 (5 females, 2 males) for ACSF vehicle. Three weeks post-injection (P77-83), thoracic spinal cord was dissected and snap-frozen in liquid nitrogen and stored at −80 °C. Sample size for the in vivo mouse experiment was based on a pilot study showing a large effect of TDP-43 knockdown in one humanized UNC13A mouse. Subsequently, all animals that could be generated during the experimental period were used. When injections spanned many days, equal numbers of mice from each group were injected on each day. Injections were not randomized.
UNC13A analysis in hUNC13A reporter mice
Spinal cord samples were immersed in 0.5 ml of ice-cold QIAzol Lysis Reagent (Qiagen, 79306) in 2-ml tubes (Fisher 15545809). Two 1.4-mm ceramic beads (Omni International 19-645) were added to each tube and samples were homogenized at 4 °C using a Precellys 24 touch homogenizer (Bertin Technologies) at 6,500 r.p.m. for 30 s on, then 120 s off, four times. Samples were centrifuged for 5 min at 12,000g at room temperature and supernatants were transferred (400 μl) to new tubes. Chloroform (100 μl) was added to each sample and then samples were vigorously shaken for 15 s followed by incubation at room temperature for 3 min. Samples were centrifuged at 12,000g for 15 min at 4 °C and then the upper aqueous phase was transferred to new tubes (200 µl). Then 70% ethanol (200 μl) was added and samples were mixed by vortexing. RNA was purified from samples using the RNeasy (Qiagen) kit including the on-column DNase (Qiagen) digestion step. RNA was eluted with water and quantified using a NanoDrop (Thermo Fisher Scientific). Reverse transcription was performed as described above using the RevertAid first-strand cDNA synthesis kit (Thermo Fisher Scientific). For RT–qPCR the following reagents were used: Mouse Tardbp (Thermo Fisher Scientific, Mm01257504_g1) and Mouse Hprt1 (Thermo Fisher Scientific, Mm03024075_m1), custom UNC13A cryptic exon assay. For RT–PCR, Mouse Unc13a exon 20 forward and Mouse Unc13a exon 21 reverse primer were used (Supplementary Table 4).
Statistical analysis
Datasets were assessed for normality. For normally distributed data, t-tests were used for statistical comparison of two groups. One-way ANOVA tests with post-hoc multiple pairwise comparison of means was used for statistical analysis of three or more groups. For non-normally distributed data, non-parametric tests were used. For MEA analysis, log2[fold change] is presented in figures as a matter of clarity, but all analyses were performed on raw data, or on fold changes derived from raw data for rescue experiments, using paired ratio t-tests. Statistical tests were carried out using GraphPad Prism (v.10.6.1; GraphPad Software) or with the R statistical library. Sample size and P values are specified in figure legends.
Linear mixed-effects models
Statistical analyses of pooled datasets from several experiments (electrophysiology and synaptic imaging) were performed in R (v.4.4.1) using the lme4 (ref. 72) and lmerTest73 packages. Data were log1p-normalized before fitting a Gaussian linear mixed-effects model (LMM) by restricted maximum likelihood with experimental batch as a random intercept to account for between-batch variability. The intraclass correlation coefficient for batch ranged from 0 to 0.4451 across datasets. Inclusion of batch as a random intercept was confirmed by a likelihood ratio test. Normality of model residuals was assessed by Shapiro–Wilk test and Q–Q plot inspection; W statistics ranged from 0.85 to 0.99 across datasets. For datasets in which residuals showed greater deviation from normality (W < 0.90), results were confirmed separately using a Gamma generalized LMM with log link (glmmTMB74), which yielded consistent conclusions in all cases, supporting the robustness of the primary LMM analysis. For experiments designed a priori to test cryptic exon deletion or ASO rescue of the TDP-43-knockdown phenotype, TDP-43 KD was set as the reference condition, with all comparisons made directly against this baseline. P values were derived from Satterthwaite degree-of-freedom-corrected t-tests. For experiments without a priori comparisons, Tukey’s test for multiple comparisons was used.
Ethics statement
iPS cell line
All iPS cell experiments used the established human iPS cell line WTC11 (GM25256), obtained from the NIGMS Human Genetic Cell Repository at the Coriell Institute for Medical Research. The line was originally derived from de-identified adult dermal fibroblast with informed consent and approval from the University of California, San Francisco Institutional Review Board. No new human tissue was collected; therefore, this work did not constitute human subjects research and did not require further ethics committee approval at University College London, King’s College London or Leibniz-FMP-Berlin. All procedures complied with relevant institutional guidelines for the use of human cell lines.
King’s College London
WT astrocytes were obtained from Wistar rat embryos (Charles River Laboratories) as described above. Animals were housed in individually ventilated cages with a 12-h light–12-h dark cycle, with ad libitum access to food and water. Facilities were maintained at 20–24 °C and 55 ± 10% relative humidity. Ethical review and approval was not required for this part of the study because only Schedule 1 procedures performed by a competent individual were used, which are exempt under the Animals (Scientific Procedures) Act 1986.
University College London
The mice were housed in individually ventilated cages with a 12-h light–12-h dark cycle, with ad libitum access to food and water. Facilities were maintained at 20–24 °C and 55 ± 10% relative humidity. All studies were conducted with ethical approval from the institutional Animal Welfare and Ethical Review Body and in accordance with the UK Home Office Animals (Scientific Procedures) Act 1986. Following Tardbp knockdown, mouse body weights were monitored daily, and mice were culled if body weight decreased by more than 15% from baseline. All mice that survived more than 2 weeks post-injection were included in the analysis.
Leibniz-FMP-Berlin
WT astrocytes were obtained from male and female P0-P1 C57BL/6J mice (Charles River Laboratories). Adult mice were kept at the animal house of the Max Delbrück Center (Berlin Buch) under individual ventilated cage and specific pathogen-free conditions with food and water ad libitum, on a 12 h light–12 h dark cycle, at room temperature (22 ± 2 °C) and humidity levels of 55 ± 10%. All experiments performed in Berlin complied with European law and the state of Berlin animal welfare body (Landesamt für Gesundheit und Soziales; LAGeSo).
Materials availability
The shTARDBP SH-SY5Y cell line, shTARDBP SK-N-BE(2) cell line, UNC13A cryptic exon deletion SH-SY5Y cell line, UNC13A cryptic exon deletion iPS cell line and HaloTag-TDP-43 iPS cell line are available from P.F. under a material transfer agreement with University College London. The TDP-43 microRNA rAAV is available from Trace Neuroscience under a material transfer agreement. The hUNC13A mice are available from the Francis Crick Institute under a material transfer agreement.
Reporting summary
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.
